ID: 1105016048

View in Genome Browser
Species Human (GRCh38)
Location 12:132787462-132787484
Sequence GCTCTTGGGGAGGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105016048_1105016063 6 Left 1105016048 12:132787462-132787484 CCCCAGGACCCCTCCCCAAGAGC 0: 1
1: 0
2: 5
3: 39
4: 363
Right 1105016063 12:132787491-132787513 GAACCCTCCCCACAAGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105016048 Original CRISPR GCTCTTGGGGAGGGGTCCTG GGG (reversed) Intronic
900131226 1:1088193-1088215 GCCATGGGGGGGGGGTCCTGGGG - Intronic
900989539 1:6091995-6092017 GCCCTTGGGGTGGGGTCCTGGGG - Intronic
901166895 1:7227843-7227865 GCCCTGGGTGAGGAGTCCTGGGG - Intronic
901631345 1:10649653-10649675 GCTCATGTGGAGGAGCCCTGAGG - Intronic
902155547 1:14482641-14482663 GGAGTTGGGGAGGGGTCTTGGGG + Intergenic
902223174 1:14979655-14979677 GCTCAGGGGAAGGGGCCCTGAGG + Intronic
902672584 1:17985094-17985116 GCCCCTGGGGACGGGACCTGTGG + Intergenic
903124413 1:21238013-21238035 GCTCCTGGGCAGGGGACCTTAGG - Intronic
903681408 1:25099858-25099880 ACTCTGGGGGTGGGGTCCAGTGG - Intergenic
904561356 1:31399636-31399658 GTTTCTGGGGAGGGGACCTGAGG + Intergenic
905018983 1:34795460-34795482 GCTCTTGGCCAAGGGTACTGGGG + Exonic
905365724 1:37450284-37450306 CTACTTGGGGAGGGGTGCTGAGG - Intergenic
906165783 1:43685090-43685112 GATCTTGGGGAGGGGACCAAGGG + Intronic
907762489 1:57375152-57375174 GCTCCTGTGGAGGGCTTCTGTGG - Intronic
912699274 1:111864334-111864356 GCTCTAGGGGAGGGTCCCAGGGG + Intronic
913219043 1:116644726-116644748 GCTGGTGGGGAGGTTTCCTGAGG - Intronic
915083621 1:153369250-153369272 ACTCTGGGAGAGGGGTGCTGTGG + Intergenic
915264775 1:154709039-154709061 ACTCCTTGGCAGGGGTCCTGAGG + Intronic
915363699 1:155301520-155301542 GTTCTGGGGGAGGGATTCTGTGG - Intergenic
915473954 1:156141506-156141528 GCTCTTGAGGAGGAGGGCTGAGG + Intergenic
917519705 1:175737785-175737807 GCTCTAGGATAGGGGTCCCGAGG + Intronic
917979037 1:180258211-180258233 GCTGAGGGGGAGGGGTCCAGGGG + Intronic
919124976 1:193382575-193382597 GGTGTTGGGGGTGGGTCCTGAGG + Intergenic
919751205 1:201039424-201039446 GCCCATGGGCAGGGTTCCTGGGG + Intergenic
920534555 1:206729176-206729198 GCTCTTGGGGAAGGGTGCTGAGG + Intronic
922770546 1:228180273-228180295 GCTTCTGGCGAGGGATCCTGTGG + Exonic
923495727 1:234522631-234522653 GCTCCAGGGGAGGGGCACTGAGG + Intergenic
923656708 1:235923211-235923233 GCTATCTGGGAGGGGTCATGGGG + Intergenic
924581816 1:245330282-245330304 ACTCTTGGGGAGGGGGTGTGAGG + Intronic
1064877490 10:20011276-20011298 GCTCATGGAGAGGTGTGCTGGGG + Intronic
1065773823 10:29101370-29101392 GCTCCTGGGAAGGCCTCCTGTGG - Intergenic
1067448463 10:46367208-46367230 GCTCATGAGGAGGGGGTCTGTGG + Intergenic
1067588910 10:47493558-47493580 GCTCATGAGGAGGGGGTCTGTGG - Intergenic
1067636038 10:48001649-48001671 GCTCATGAGGAGGGGGTCTGTGG - Intergenic
1067944491 10:50681662-50681684 GATCTTGGGGGTGTGTCCTGGGG + Intergenic
1069571399 10:69496476-69496498 GCTCTTGGGGCGTCGTCATGAGG + Intronic
1069594164 10:69659868-69659890 GCACTGGGGGAGGGGCCCTGGGG - Intergenic
1069634538 10:69917364-69917386 GCACTGGGGGAGGGGCCTTGGGG - Intronic
1070132598 10:73665656-73665678 GCTCATGAGGAGGGGGTCTGTGG - Intergenic
1071609084 10:87018419-87018441 GCTCGTGAGGAGGGGGTCTGTGG + Intergenic
1071632891 10:87230754-87230776 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1071646340 10:87362972-87362994 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1071674226 10:87639641-87639663 GGTGTTGGGGCTGGGTCCTGAGG + Intergenic
1072446392 10:95502480-95502502 GCTCTGTGGCAGGGGGCCTGGGG - Intronic
1073127708 10:101162237-101162259 GCTCTAGGGGATGGGCCCTGTGG - Intergenic
1074530835 10:114297614-114297636 GCTCTTGGGGAGGAGAGCTCTGG + Intronic
1074753707 10:116609632-116609654 GCTCTTGGGGAGGTGCGCAGAGG + Intergenic
1075389643 10:122083332-122083354 GCTCTTGGGGCTGGATCTTGTGG - Exonic
1075922321 10:126224082-126224104 ACTCCTGGGGAGGGGGCCTGGGG + Intronic
1075974635 10:126684939-126684961 GGTCATGGGGAGGGGTCAAGGGG - Intergenic
1076585503 10:131544795-131544817 CCTCTTTGGAAGGGGCCCTGGGG - Intergenic
1076794397 10:132791604-132791626 GCCCCTGCCGAGGGGTCCTGTGG - Intergenic
1077172913 11:1176374-1176396 GCGCATGGGCAGGGGTCCTCTGG - Intronic
1077185604 11:1234171-1234193 GCTTGGTGGGAGGGGTCCTGGGG - Intronic
1077556808 11:3229944-3229966 GCTCACGGGGACAGGTCCTGCGG + Intronic
1077579654 11:3408591-3408613 GTTGTTGGGTAGGGGACCTGGGG + Intergenic
1079383595 11:19959688-19959710 GGGCTTGGGGAGGAGTCATGCGG - Intronic
1083752794 11:64770392-64770414 GCTCAGGGGAAGGGGACCTGTGG + Exonic
1084274201 11:68043395-68043417 GCTCTAGGGCAGGGGCCTTGTGG - Exonic
1084477656 11:69398191-69398213 GATCCTGAGGAGGGATCCTGAGG - Intergenic
1084856623 11:71992948-71992970 CTTCTTGGGGTGGGGTCTTGGGG - Intronic
1085319484 11:75565191-75565213 GGGCTTGGGGAGGAGGCCTGAGG + Intronic
1085569650 11:77548052-77548074 GCTCTTGGGGAGAAGCCCTTGGG + Intronic
1085829725 11:79886510-79886532 GCTCTGGGGAAGGGGGCCTGAGG + Intergenic
1086278308 11:85158020-85158042 GCTGTTGGGGGTGGCTCCTGAGG - Intronic
1088449025 11:109962899-109962921 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1089492721 11:118893876-118893898 GCTCTGTGGGCTGGGTCCTGGGG + Exonic
1090227821 11:125082202-125082224 GCACATGGGAAGGGGTCCAGAGG - Intronic
1090270087 11:125379974-125379996 GCTCCTGGGGAGAGGTGATGAGG + Intronic
1090425660 11:126605408-126605430 GCTCAGGGGGAGGAGTCCTGCGG + Intronic
1090558596 11:127903790-127903812 GCTCCTGGGGAGGTCTCCAGAGG - Intergenic
1091673310 12:2467993-2468015 CCTCTTGGAGAGGGACCCTGTGG + Intronic
1091788259 12:3256180-3256202 GCTGTGGGGGCGGGGTCCCGAGG + Intronic
1092107248 12:5930604-5930626 GCACTTGAGGAGGGGTCCAGGGG - Intronic
1092243054 12:6847212-6847234 GCTCTGGGGGAGGAATCCTAGGG - Exonic
1092271093 12:7023962-7023984 GCAGGTGGGGAAGGGTCCTGAGG - Intronic
1092384651 12:8026928-8026950 CATCTTGGGGTGGGGTCTTGGGG - Intergenic
1092525399 12:9306570-9306592 CCTCTAGGGCAGGGGTCCTAGGG + Intergenic
1092541873 12:9425247-9425269 CCTCTAGGGCAGGGGTCCTAGGG - Intergenic
1093964227 12:25308497-25308519 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1094511157 12:31097253-31097275 CCTCTAGGGCAGGGGTCCTAGGG + Intronic
1095053319 12:37573564-37573586 GCTCTAGGGGAGGGGTCTATGGG + Intergenic
1096791214 12:54046395-54046417 GCTGTGGGGGAGGGGGCCTGGGG + Intronic
1097076537 12:56399043-56399065 GGTGTTGGGGTGGGATCCTGAGG - Intergenic
1097222707 12:57460237-57460259 GCAGTGGGGGAGGGGGCCTGAGG + Intronic
1099735456 12:86562609-86562631 GGTGTTGGGGATGGGTTCTGAGG - Intronic
1100049903 12:90435482-90435504 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1100433826 12:94553727-94553749 GCATCTGGGGAGGGGTCTTGGGG + Intergenic
1101012161 12:100461944-100461966 GTTCTTGGGGAGGGATCGTATGG + Intergenic
1101709422 12:107250883-107250905 TCTATTGGGGAGGAGTCATGGGG + Intergenic
1101817510 12:108157021-108157043 GCTTATGGGGTGGGGTCCTGGGG - Intronic
1102034380 12:109762496-109762518 GATGGTGGGGAGGGGGCCTGCGG - Intronic
1102418126 12:112782080-112782102 GCAGTTCGGGATGGGTCCTGGGG + Intronic
1102845500 12:116177208-116177230 GTGCCTGGGGAGGGGTCATGAGG - Intronic
1104952156 12:132446029-132446051 GCGGCTGGGGAGGAGTCCTGTGG - Intergenic
1105016026 12:132787400-132787422 GGCCTTGGGGAGGGTTCCTGGGG - Intronic
1105016048 12:132787462-132787484 GCTCTTGGGGAGGGGTCCTGGGG - Intronic
1105016060 12:132787485-132787507 GCTTGTGGGGAGGGTTCCCGGGG - Intronic
1105016098 12:132787572-132787594 GGTTCTGGGGAGGGGTCCCGGGG - Intronic
1105016246 12:132787858-132787880 GGTCTCGGGAAGGGGTCCCGGGG - Intronic
1105296482 13:19091218-19091240 CCTCATGGGCAGGGGTCCTCAGG - Intergenic
1105505935 13:21009844-21009866 GGTGTTGGGGCGGGGGCCTGGGG - Intronic
1108551394 13:51549235-51549257 CCTCTTGGGGAGGGGCGCTCAGG + Intergenic
1109995034 13:70112032-70112054 GCTTCTGGGGAGGAGGCCTGAGG + Intergenic
1111976244 13:94968938-94968960 GATCTCGGGGAGGAGTCTTGGGG + Intergenic
1113795628 13:113056077-113056099 TCTCCATGGGAGGGGTCCTGTGG + Intronic
1113866291 13:113527804-113527826 GCTCTTTGGTTAGGGTCCTGCGG + Intronic
1118839273 14:69499026-69499048 GCTCTTGGGGGAGGGAGCTGAGG + Intronic
1121144272 14:91570159-91570181 GCTCTTGCAAAGGGGGCCTGAGG - Intergenic
1121426280 14:93854418-93854440 GCTCCTGGGGAGGGGCCCCTTGG + Intergenic
1121797324 14:96745941-96745963 GCTCTTGGACTGGGATCCTGTGG + Intergenic
1122781124 14:104143985-104144007 ACTGTTGGGGAGGGAGCCTGGGG + Intronic
1122829113 14:104387117-104387139 GCACTTGGGGAAGGCCCCTGGGG + Intergenic
1122925240 14:104896355-104896377 GCTCTTGGGGCGGGGACCAGGGG - Exonic
1123102621 14:105815730-105815752 GCTTTTGGGGAGGGGCTCAGGGG + Intergenic
1124344283 15:28911390-28911412 GCTTTTGGGGACGGAGCCTGTGG + Intronic
1124884852 15:33675922-33675944 GCTCTGGGTGAGAGGTTCTGAGG + Intronic
1126313152 15:47339329-47339351 TCTGGTGGGGAGGGGTCTTGGGG + Intronic
1129388934 15:75210907-75210929 GCTGCTGGGGAAGAGTCCTGTGG + Exonic
1129906368 15:79190421-79190443 GTTCCTGGGGAGGGGGCTTGAGG + Intergenic
1132055992 15:98650227-98650249 GCGCTTGGAGACGTGTCCTGGGG - Intronic
1132255418 15:100372862-100372884 GATCTTGGGGAGGGGTTGGGGGG + Intergenic
1132414841 15:101612731-101612753 GGTGCTGGGGAGGGGACCTGGGG + Intergenic
1132671722 16:1104704-1104726 GCCTTTGGGGAGGTGCCCTGTGG + Intergenic
1133815617 16:9195237-9195259 GGTCTTGGGGTGAGGGCCTGGGG + Intergenic
1134059192 16:11188736-11188758 CTTCTTGGGGAGGGGACATGCGG - Intergenic
1134242561 16:12516770-12516792 GCTCCTGGGGAGGGGCCCACTGG + Intronic
1134635077 16:15785945-15785967 CCACTTGGGGTGGGGACCTGGGG - Intronic
1135510585 16:23079789-23079811 GCTCTTGGGCAGAGATCCAGAGG + Intronic
1136085865 16:27884628-27884650 TCTGTTGGACAGGGGTCCTGTGG - Exonic
1137676935 16:50308452-50308474 GCTCCTAGGCAGGTGTCCTGAGG - Intronic
1137764336 16:50966606-50966628 CCACTGGGGGAGAGGTCCTGCGG - Intergenic
1140112680 16:72017225-72017247 GCTCTAGGAGAGGTGTCCTGAGG - Intronic
1140409795 16:74734690-74734712 GCCCAGGAGGAGGGGTCCTGGGG - Intronic
1140475638 16:75238166-75238188 GGTGCTGGTGAGGGGTCCTGTGG - Intronic
1140672542 16:77293178-77293200 GCTCTCGGGGAGGGTTTCTGCGG + Exonic
1141614483 16:85202682-85202704 GCCCCTTGGGAGGGGCCCTGGGG + Intergenic
1143598811 17:7930976-7930998 GCTCTGGGGGATGGGTCCCTGGG + Intronic
1143620170 17:8076040-8076062 GGCCTTGGGGAAGGGGCCTGGGG - Intronic
1143881711 17:10035077-10035099 GCTCTTGGGAAGAGGGCGTGTGG - Intronic
1143882879 17:10043219-10043241 AGTCTTGGAGAGGGGCCCTGGGG - Intronic
1144587740 17:16498147-16498169 GCACTGGGGGAGGCTTCCTGAGG - Intergenic
1145962399 17:28894877-28894899 ATTCTTGAGGAGGGGTCCTTAGG - Intronic
1145992453 17:29087194-29087216 GCTCTGGGTGAGGAGGCCTGGGG + Intronic
1147254937 17:39175776-39175798 GCTCTAGAGGAGGGGCCCCGGGG + Intronic
1147302840 17:39543552-39543574 GGTCTAGGGGAGAGGTACTGGGG + Intronic
1147303652 17:39548903-39548925 CCTCCTGGGGAGGGGCCCTCAGG - Intronic
1147473350 17:40685287-40685309 ATTCTTGGGGAGCTGTCCTGTGG - Intergenic
1147660229 17:42113347-42113369 GCTCTTGGGGACCAGGCCTGGGG + Exonic
1147686050 17:42287520-42287542 CCTCTTGGAGAGGGGGACTGAGG + Intergenic
1147954394 17:44124038-44124060 GCGGTCGGGGAGGGGACCTGGGG + Intergenic
1148451228 17:47778969-47778991 GGTCTTGGGGTGGGGGGCTGGGG - Intergenic
1148996461 17:51714485-51714507 GCTCTTTGGGAGGTGGGCTGGGG + Intronic
1149596679 17:57868410-57868432 GCTCCTGGGGTGGCGTCCTCAGG - Intronic
1151780007 17:76239821-76239843 GCTCCTGGGGAGCGGGGCTGCGG - Intronic
1151954700 17:77374473-77374495 GCTCTGGGGCAGGGCTTCTGAGG + Intronic
1151965495 17:77429125-77429147 GCTCCTGGGGTGGGGACTTGGGG + Intronic
1152205236 17:78971171-78971193 GCTCTGGGGGACAGGTCATGAGG - Intergenic
1152637386 17:81435710-81435732 GGTCCTGGGGAGGGCTCCAGGGG - Intronic
1152641923 17:81452812-81452834 GCTCCTGGGGAGCGGCCCCGTGG - Exonic
1152911882 17:83009934-83009956 GCTGTGGGGGAGGGGGGCTGTGG + Intronic
1152911889 17:83009950-83009972 GCTGTGGGGGAGGGGAGCTGTGG + Intronic
1154388765 18:13918753-13918775 GGGCCTGGGGTGGGGTCCTGGGG - Intergenic
1156537460 18:37878077-37878099 GGTCTTGGGGGTGGCTCCTGAGG - Intergenic
1157845635 18:51001332-51001354 GGTGGTGGGGATGGGTCCTGAGG - Intronic
1158548904 18:58418221-58418243 GCTTTGGGGGATGGGGCCTGGGG + Intergenic
1160500893 18:79400665-79400687 GCGCTCGCGGCGGGGTCCTGGGG + Intronic
1160527015 18:79544158-79544180 TGTCTTGGGAAGGGCTCCTGGGG - Intergenic
1160770384 19:828393-828415 GGTCCTGGGGAGGGGGCCTAGGG + Intronic
1161208720 19:3055630-3055652 GGCCTTGGGGAGGGGTTGTGAGG - Intronic
1161251154 19:3281049-3281071 GCTCCTGGGGTGGGGGCCCGTGG + Intronic
1161264964 19:3359834-3359856 GATCGTGGGTAGGGGTCCCGTGG - Intronic
1162013273 19:7830568-7830590 GCTCCTGGGGAGGGGTCCGGAGG - Intronic
1162097099 19:8316804-8316826 ATGCCTGGGGAGGGGTCCTGGGG + Intronic
1162191797 19:8952904-8952926 TCTTATGAGGAGGGGTCCTGAGG - Exonic
1162791369 19:13064720-13064742 GCTCCTGGGGAGGGGAGCTGAGG + Intronic
1163433566 19:17282325-17282347 GATCTTGGGGAGGGAACTTGGGG + Intronic
1163446853 19:17352163-17352185 GCTCTGGGTGAGGGATCGTGAGG + Exonic
1163519107 19:17781395-17781417 GCTTTTGGGCACTGGTCCTGGGG + Intronic
1163550531 19:17964264-17964286 GCACCTGTGGAGGGGTGCTGGGG + Intronic
1165422529 19:35729334-35729356 GCTCTTGGGGAGGCCTCCTCCGG + Intronic
1165443526 19:35844285-35844307 GGTCATGGGGAGGGGTCCCGGGG - Intronic
1165699503 19:37926597-37926619 AGGCTTGGGGAGGGGGCCTGAGG + Intronic
1166106860 19:40601798-40601820 GCTTTTGGGGTTGGGTCCTGAGG + Intronic
1166566459 19:43768502-43768524 GCTCTTGTGGAGGGGTACTCAGG - Intronic
1167246034 19:48373761-48373783 GCTCTGGGTTGGGGGTCCTGGGG - Intronic
1167261803 19:48462970-48462992 CCTCTAGGTGTGGGGTCCTGCGG + Intronic
1167508575 19:49883888-49883910 GCTGTTGGGGAATGGCCCTGGGG + Intronic
1167798670 19:51726788-51726810 GGTCTGAGGGAGGGGTGCTGGGG - Intergenic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
1168276150 19:55279807-55279829 GACTTTGGGGAAGGGTCCTGTGG - Intronic
1168301383 19:55407188-55407210 GCTTTGGGGGGGGGGTTCTGGGG - Intronic
1168356056 19:55700697-55700719 GCTCCAGGGGAGGGGCCATGAGG - Intronic
925487160 2:4348275-4348297 ATGCTTGGGGAGGGGCCCTGTGG + Intergenic
926907651 2:17821071-17821093 GCTTCCTGGGAGGGGTCCTGTGG + Intergenic
927132666 2:20073626-20073648 ACTTTTGGCGAGGTGTCCTGGGG + Intergenic
927840300 2:26437425-26437447 GCCCTTGCGGAGGGAACCTGGGG - Intronic
929044506 2:37776796-37776818 GCTTTTTGGGAGGTGCCCTGGGG + Intergenic
929270159 2:39963232-39963254 GGTGTTGGAGATGGGTCCTGAGG + Intergenic
929270239 2:39963983-39964005 GGTGTTGGAGATGGGTCCTGAGG - Intergenic
929993725 2:46811996-46812018 TCTCTTGGGGAGGGGAGATGAGG - Intergenic
930479307 2:51926680-51926702 GTTCTTGGGGAGGGGCAGTGAGG - Intergenic
932589888 2:73059011-73059033 GACCTTGGGGAGGGACCCTGTGG - Intronic
932698304 2:73975470-73975492 GCTCTTGAGGAGGGTTACTCTGG + Intergenic
933948591 2:87309013-87309035 GCTCTGGGGAAGGGGTTCTGAGG + Intergenic
934056063 2:88252696-88252718 GCCACTGGGGAAGGGTCCTGGGG - Intergenic
934855260 2:97725292-97725314 GCTCGTTGGCAGGGATCCTGGGG + Intronic
934898807 2:98140951-98140973 GCCATTGGTGAGGGGGCCTGGGG - Intronic
936331608 2:111552583-111552605 GCTCTGGGGAAGGGGTTCTGAGG - Intergenic
936894977 2:117417210-117417232 GCTCTAGGTAAGGGGGCCTGTGG + Intergenic
937086310 2:119174211-119174233 GGACTTGGGGAGGGGTCCGCTGG + Intergenic
937300021 2:120833281-120833303 GCATTTGGGGAGGGTTCCTAAGG + Intronic
937800011 2:126072296-126072318 GGTTTTGGGGGTGGGTCCTGAGG - Intergenic
937873262 2:126801648-126801670 GGTCCTGGGGGGGAGTCCTGTGG - Intergenic
938679468 2:133674758-133674780 GCTATTGAGGAGAGTTCCTGGGG + Intergenic
939805927 2:146776023-146776045 GGTGTTGGGGTTGGGTCCTGAGG - Intergenic
942080572 2:172396214-172396236 ACCCCTGGGGAGGGGTGCTGGGG - Intergenic
942762760 2:179419191-179419213 GCTGGAGGGGAGGGGTACTGGGG + Intergenic
944515599 2:200509526-200509548 GCTTTTGAGGATGGGGCCTGCGG - Intronic
945192391 2:207202916-207202938 GCACTTTGAGAGGAGTCCTGAGG + Intergenic
945839289 2:214868787-214868809 GGTCTTGGGGAGGTGAACTGGGG + Intergenic
946306301 2:218858834-218858856 CCTCGTGGGGAGGGGGCCAGGGG + Intergenic
947618943 2:231576408-231576430 GCTCCAGGGGTGGGTTCCTGTGG - Intergenic
948368338 2:237472958-237472980 GGTGTGGGGGAGGGGACCTGGGG - Intergenic
948485815 2:238280091-238280113 CCTGTTGGGGAGGGCACCTGGGG - Intronic
948710961 2:239825300-239825322 GCCTGTGGGGAGGGGACCTGGGG + Intergenic
1169342979 20:4810289-4810311 GTTCTTGGAGAGGCCTCCTGTGG - Intronic
1171088807 20:22264844-22264866 GCACCTGTGGAGGGGTGCTGGGG - Intergenic
1171942489 20:31344933-31344955 GCCCATAGGGAGGGATCCTGAGG - Intergenic
1172006263 20:31820563-31820585 GGGAGTGGGGAGGGGTCCTGTGG + Intronic
1172090948 20:32432214-32432236 GCACATGGGGTGGGGTCCAGGGG + Intronic
1173672698 20:44809705-44809727 GGTCTTGGGCAGGGATCCTCTGG + Intronic
1174135688 20:48377423-48377445 GCTCTTCGGTGGGGGTCTTGTGG - Intergenic
1175507153 20:59494112-59494134 GCTCCTGGGGAAGAGGCCTGGGG + Intergenic
1175572446 20:60034344-60034366 GCTCTGGGGGAAGGGTCATGAGG + Intergenic
1175895017 20:62332340-62332362 CCCCTTGGGGTGGGGACCTGAGG + Intronic
1176048489 20:63104616-63104638 GCACATGGTGAGGGCTCCTGGGG - Intergenic
1176286950 21:5023379-5023401 TCTAATGGGGAGGGGACCTGGGG - Intronic
1176383198 21:6123976-6123998 GCCACTGGGGAAGGGTCCTGAGG - Intergenic
1178439111 21:32584234-32584256 GCTCCTGGGCACGGGTCCTCTGG + Exonic
1179551462 21:42146485-42146507 CCTCTTGGGGAGGAGGGCTGTGG + Intergenic
1179551477 21:42146539-42146561 CCTCTTGGGGAGGAGGGCTGTGG + Intergenic
1179571357 21:42280649-42280671 GCTCATGGGCAGGGGTGCGGAGG + Intronic
1179624934 21:42643657-42643679 ACGCTTGGGGAGGGGTGCTTTGG + Intergenic
1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG + Intergenic
1179870231 21:44240096-44240118 TCTAATGGGGAGGGGACCTGGGG + Intronic
1180008639 21:45035078-45035100 GCTCTTTGGATGTGGTCCTGGGG - Intergenic
1180054342 21:45349341-45349363 GGGCTGGGGGAGGGGACCTGGGG + Intergenic
1180820334 22:18822782-18822804 GCTGGTGGGGAGGTTTCCTGAGG - Intergenic
1181031241 22:20149690-20149712 GCTGAGGGGGAGGGGTGCTGGGG - Intronic
1181057341 22:20266429-20266451 CTTCTTGGTGAGGGGTTCTGTGG - Intronic
1181206559 22:21257254-21257276 GCTGGTGGGGAGGTTTCCTGAGG - Intergenic
1181512097 22:23393707-23393729 GCTGAGGGGGAGGGGTGCTGGGG + Intergenic
1182626834 22:31653537-31653559 GTTCTTGGGCAGGGTTCCTGAGG - Intronic
1182826779 22:33272385-33272407 GCTCTTGGGGATGGGGACAGAGG + Intronic
1183464901 22:37974710-37974732 AATCTTAGGGATGGGTCCTGGGG + Intronic
1183723299 22:39574553-39574575 GCTCTGTGGGAGGGGGCCTGGGG + Intronic
1184982009 22:48101662-48101684 GTTGGTGGGGAGGGGTCCAGAGG - Intergenic
1185076844 22:48687740-48687762 GCACTTAGGGAGGTGACCTGAGG - Intronic
1185223176 22:49639374-49639396 GTTCTGGGGTCGGGGTCCTGGGG - Intronic
1203220361 22_KI270731v1_random:38169-38191 GCTGGTGGGGAGGTTTCCTGAGG + Intergenic
1203270464 22_KI270734v1_random:48657-48679 GCTGGTGGGGAGGTTTCCTGAGG - Intergenic
949347460 3:3089898-3089920 GATCTTGGGGATGGGTGCGGTGG - Intronic
949445295 3:4128559-4128581 GCTGTTGTGGATGGCTCCTGAGG - Intronic
950006624 3:9695644-9695666 GCTCTTGGGGAGTGGTTTTGGGG + Intronic
950361426 3:12452169-12452191 GCTCTTGGGGAAAGGGGCTGTGG - Intergenic
950628153 3:14263619-14263641 GCTCTTGGGGGAGGGGACTGAGG - Intergenic
951319582 3:21228078-21228100 GCTGGTGGGGAGGAGTCCAGTGG + Intergenic
953669770 3:44952544-44952566 GCTCCTGGGCAGGGCTCTTGAGG + Intronic
954117419 3:48474875-48474897 GCTCCTGGGGAAGTGACCTGAGG - Intronic
954131783 3:48564706-48564728 GTTCTGGGGGAGGAGTCCTTGGG - Intronic
954140241 3:48601234-48601256 GCAGTTGGGAAGGGGTTCTGTGG - Intronic
954511945 3:51133029-51133051 GGTGTTGGGGGTGGGTCCTGAGG - Intronic
954524390 3:51256880-51256902 GCTCTTGGGGATGGGTGCAATGG - Intronic
954782971 3:53074054-53074076 GCTCTGGGGGATGGGCCCTGGGG + Intronic
954846847 3:53566730-53566752 GCTCTCGGGGAGGGCTGGTGGGG - Intronic
956718414 3:72098295-72098317 GGTCTTGGGGAGGAGCCCTCGGG - Intergenic
957897801 3:86446297-86446319 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
959227090 3:103599747-103599769 GGTCTTGGGGATGGCTTCTGAGG + Intergenic
961252087 3:125515758-125515780 GTTCTTGGGGCTGGGTGCTGTGG + Intronic
961389260 3:126542655-126542677 GCTCTTGAAGAGGGGTCCTGGGG - Exonic
963661070 3:148129681-148129703 GGTGTTGGGGATGGGTCCTGAGG - Intergenic
963956664 3:151261656-151261678 GCCTCTGGGGAGGGGTCCAGTGG + Intronic
967172047 3:186829297-186829319 ACTCTTAGGGAGGGGTCCTTGGG + Intergenic
968597417 4:1492615-1492637 CCTCCTGGGGAGGGTTCCAGGGG - Intergenic
968743202 4:2341548-2341570 TCTCTGGGGGCGCGGTCCTGGGG + Exonic
969410069 4:7022227-7022249 GCTCTTGGAGTGGAGTCCAGGGG + Intronic
969606617 4:8205233-8205255 CCCCATGGGGAGGGGTCCTGTGG + Exonic
970290689 4:14568498-14568520 GCTCTTGCGGCCGGGTGCTGTGG + Intergenic
970629209 4:17923008-17923030 GGTGTTGGGGTTGGGTCCTGAGG - Intronic
973092681 4:46157873-46157895 GGTGTTGGGGATGGCTCCTGAGG - Intergenic
973734850 4:53861529-53861551 CCTCCTGGAGAGGAGTCCTGGGG - Intronic
977430441 4:96925778-96925800 GGTGTTGGGGATGGCTCCTGAGG - Intergenic
977988538 4:103414951-103414973 GCTGTAGGGGTGGGGTCCTCAGG + Intergenic
978389845 4:108213907-108213929 CCTCCTGGGGAGGGCTGCTGCGG - Intergenic
979306959 4:119156872-119156894 GCCCTTGGGGAGGGGCTGTGTGG + Intronic
979888911 4:126065192-126065214 GGTCCTGGGGATGGGTCCTGAGG + Intergenic
981114014 4:140968772-140968794 CCTCTTGGTGAGGAGTTCTGGGG + Intronic
985659799 5:1151418-1151440 GCACTAGGGGAGGGTTCCTTTGG + Intergenic
986155118 5:5166509-5166531 GCTCCTGGGAAGGCTTCCTGCGG + Intronic
986174573 5:5341071-5341093 TTTCTTGGGGACGGGTGCTGGGG + Intergenic
986233603 5:5887367-5887389 GCCCTCGAGGACGGGTCCTGTGG + Intergenic
988107446 5:26770033-26770055 GGTGTTAGGGATGGGTCCTGAGG - Intergenic
990528515 5:56651848-56651870 GTTCTTGGGGATGGTTCTTGAGG - Intergenic
991945813 5:71897687-71897709 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
992925812 5:81585805-81585827 GCTGGTGGGGAGGGATACTGGGG - Intronic
994300613 5:98142687-98142709 GAGCATGGGGAGGGGTCCTAAGG - Intergenic
994359317 5:98832097-98832119 CTTCTTGGGGCGGGGTCCAGTGG + Intergenic
998049723 5:139022280-139022302 GCAGTTGGGAAGGGGCCCTGTGG - Intronic
999648928 5:153746656-153746678 GCTCTGGGGGTGGGGGCCTCTGG + Intronic
999687917 5:154118808-154118830 GCTCTTGGGAAGGAGGCCTTGGG - Intronic
1001922039 5:175608504-175608526 GCTCTGGGAGAGGGGGCCTGGGG - Intergenic
1002640355 5:180627849-180627871 GCCCTTGGGGCAGAGTCCTGAGG - Intronic
1003062806 6:2875997-2876019 GCTTCTGGGGAGGCGGCCTGGGG - Intergenic
1004314536 6:14574358-14574380 TCTCTTGGGGAGACATCCTGTGG - Intergenic
1004650099 6:17600335-17600357 GCTGTTGGGGAGGGGCCATTGGG + Exonic
1005987754 6:30884752-30884774 GCTCTTGGGGTGGGGGCGCGCGG + Intronic
1006133881 6:31884243-31884265 CCTAGTGGGGAGGGGGCCTGTGG + Intronic
1006296332 6:33171679-33171701 GGTATTGGGGAGGGGTACTGGGG - Intronic
1007370338 6:41422665-41422687 TCTCTTGGGGGGGGGTCCCAGGG - Intergenic
1007486104 6:42181804-42181826 GCACTTTGGGATGGGTGCTGAGG + Intergenic
1007728714 6:43932872-43932894 GCTGCAGGGGAGGGGTCCTGTGG - Intergenic
1008920987 6:56843864-56843886 GGGCCTGGGGAGGGGGCCTGGGG - Intronic
1009806159 6:68604359-68604381 GCTGTTGGGGGTGGGTCCTGTGG - Intergenic
1010938474 6:81888160-81888182 GGTATTGGGGGTGGGTCCTGAGG + Intergenic
1012344257 6:98167876-98167898 GGTGTTGGGGGTGGGTCCTGAGG - Intergenic
1013173039 6:107654730-107654752 GCTCTGGGGGAGGGTGGCTGAGG + Intronic
1013173070 6:107654858-107654880 GCTCTGGGGGAGGGTGACTGAGG + Intronic
1013426795 6:110019428-110019450 GCACTTGGGGAATGGTCGTGGGG + Intergenic
1014558367 6:122860942-122860964 GGTTTTGGGGAGTGGTTCTGTGG - Intergenic
1015403229 6:132810359-132810381 CCTCTTGGGGCCGGGTGCTGTGG - Intergenic
1016098421 6:140066828-140066850 ACTCTTGGGGACTGTTCCTGAGG + Intergenic
1017034611 6:150255990-150256012 GCTGCTGGGGCGGTGTCCTGGGG - Intergenic
1019075337 6:169382846-169382868 CTTCCTGGGGAGGGGTTCTGTGG - Intergenic
1019370486 7:660479-660501 TCTGTTGGGGTGGGGACCTGTGG - Intronic
1019371129 7:662496-662518 TCTGTTGGGGTGGGGACCTGTGG - Intronic
1019645898 7:2128813-2128835 GCTCCTGGGGAGGCGTGGTGTGG - Intronic
1019846617 7:3509241-3509263 ATGCTTGGGGAGGGGTCCTCTGG + Intronic
1020229487 7:6306737-6306759 GCTCTGGGGGAGGGGGAATGGGG + Intergenic
1021521600 7:21543737-21543759 GCACGTGGGGAGGAGTCCTGCGG - Intronic
1022485132 7:30771828-30771850 GCAGCTGGGGAGGGGGCCTGGGG + Intronic
1022508468 7:30921202-30921224 CTTCCTGGGGAGGGGTCCTCCGG + Intronic
1024985874 7:55192631-55192653 GGCCTGGGGGACGGGTCCTGGGG + Intronic
1025035400 7:55590191-55590213 GTTCTTGGGGAGGGGTCTGTGGG + Intergenic
1029025532 7:97413244-97413266 GAACTTGGGGAAGGGTCCAGAGG + Intergenic
1029126950 7:98301109-98301131 GCTGTGGGGGAGGGGTTTTGTGG - Intronic
1029460978 7:100693873-100693895 GCTCTGGGGGAGGGTCCCGGCGG + Intergenic
1029495774 7:100895020-100895042 GAACTTGGGGAGGGGGCCTGGGG + Intronic
1029626372 7:101722564-101722586 CCTCTTGGGGAGGGGACCGCAGG + Intergenic
1030049019 7:105521966-105521988 CCTCTTGGGGCGGGGCCCTGGGG + Intronic
1031488163 7:122354848-122354870 TATCTTGGGGAGGAGTTCTGTGG - Intronic
1031676249 7:124615885-124615907 GGCCTTGGGGGTGGGTCCTGAGG - Intergenic
1031968045 7:128042308-128042330 CCTCTTGGGGAGGGATCCCCAGG - Intronic
1033137306 7:138796208-138796230 GCTCTCGGTGTGGGGACCTGGGG - Intronic
1034089940 7:148354545-148354567 GCTCCTGAGGACAGGTCCTGGGG - Intronic
1034225458 7:149477617-149477639 GATATTGGGGAGGAGCCCTGGGG - Exonic
1034825106 7:154255185-154255207 GCTGTGGTGGAGGGGTGCTGGGG + Intronic
1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG + Intergenic
1038381320 8:27097164-27097186 CCTGTTGGAGAGGGGGCCTGGGG - Intergenic
1042001381 8:64126427-64126449 GCTGTTGGGGGTGGCTCCTGAGG + Intergenic
1046197246 8:110881792-110881814 GGTGTTGGGGATGGCTCCTGAGG - Intergenic
1046918163 8:119699366-119699388 GTCCCTGTGGAGGGGTCCTGGGG - Intergenic
1048461386 8:134624353-134624375 CTTCTTTAGGAGGGGTCCTGTGG + Intronic
1049298156 8:141854842-141854864 GGGCTGGGGGAGGTGTCCTGGGG + Intergenic
1049306787 8:141908205-141908227 GCTGTGGGGGAGGGGCCTTGGGG + Intergenic
1049379113 8:142303262-142303284 GCTCCTGGGGAGGCCTCCCGGGG + Intronic
1049503880 8:142984592-142984614 CCTCTTGGAGAGAGGTCTTGTGG - Intergenic
1049551670 8:143262848-143262870 GCTAATGGGGAGTGGTCTTGTGG - Intronic
1049631158 8:143658382-143658404 GAGCTTGTGGAGGGCTCCTGGGG + Intergenic
1049656842 8:143802765-143802787 GCTGGTGGGGAGGACTCCTGGGG + Intronic
1049694329 8:143976250-143976272 GCTCTTGGGGACGGGGGCTGGGG - Intronic
1049714915 8:144085251-144085273 GCTCTTGGAGATGGACCCTGGGG - Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1053391327 9:37738727-37738749 GCTGTTGTGGAGGGGTTGTGGGG + Intronic
1053429785 9:38034442-38034464 GCTCTTTGGGAGGTCCCCTGTGG + Intronic
1055528230 9:77156670-77156692 GCTCCTGGGGAGGGGGCATTTGG + Intergenic
1056111699 9:83402805-83402827 GCTTTTGGGGAGTGTTACTGTGG - Intronic
1056753390 9:89367608-89367630 GATCTAGGGTAGAGGTCCTGAGG + Intronic
1057197030 9:93121000-93121022 CCACTGGGTGAGGGGTCCTGTGG + Intergenic
1057786104 9:98088156-98088178 GCCCCTGGGGCGGGGTCTTGGGG + Intronic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1060480469 9:124014186-124014208 GATTGGGGGGAGGGGTCCTGAGG - Intronic
1060946801 9:127574517-127574539 GGTCTTGGGCTGGGCTCCTGCGG - Intronic
1061052620 9:128205176-128205198 GCCCTTGGGGAAGGGGCCCGTGG - Intronic
1061378374 9:130239555-130239577 GCTCAGGGGCAGGGCTCCTGGGG - Intergenic
1061406958 9:130397648-130397670 GGTCTTGGGTAGGTGGCCTGGGG + Intronic
1061425049 9:130493523-130493545 GCTTCTGGGATGGGGTCCTGGGG - Intronic
1061659532 9:132119727-132119749 GAGCTTGGGGAGGGGTGCTTGGG - Intergenic
1061857414 9:133449815-133449837 GCTGTGGGAGAGGGGTCGTGCGG + Exonic
1061959116 9:133979076-133979098 GCACATGGGGAGGGGCACTGAGG + Intronic
1062267344 9:135693247-135693269 GCCCTGGGGTAGGGGTGCTGTGG - Intergenic
1062279589 9:135746003-135746025 GCACCTGGGGAGGGAGCCTGTGG - Intronic
1062324589 9:136005993-136006015 GCTCTGGGGCTGGTGTCCTGGGG - Intergenic
1062526069 9:136978562-136978584 GCTCCTGGGGCGGGGACGTGAGG + Intronic
1062526105 9:136978665-136978687 GCTCTTGGGGCGGGGTCGTGAGG + Intronic
1062643430 9:137533831-137533853 GCTGTTGGGGAGGAGTCTGGGGG - Intronic
1185764530 X:2714995-2715017 GTCCTTGGGGAGGGGTCTAGAGG + Intronic
1187034009 X:15518668-15518690 GCTTTTGGGGAGGGATTTTGGGG + Intronic
1188194717 X:27218968-27218990 AGTCTTGGAGAGGGGTCCTCAGG + Intergenic
1194960346 X:100228128-100228150 GCTGTTTTGGAGGGTTCCTGGGG - Intergenic
1195214295 X:102683266-102683288 GCTCTTGGGGAAGGAGCATGTGG + Intergenic
1197097152 X:122610380-122610402 GCTGTTGGGGGTGGCTCCTGAGG - Intergenic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1199717158 X:150515116-150515138 GCTCTTGGAGAGGTTTCCTGAGG - Intergenic
1199999676 X:153052441-153052463 GCTCTGGGGGAGGGATGCAGTGG + Intergenic
1200101666 X:153691615-153691637 GCTCCAGGGGAGTGGCCCTGAGG + Intronic
1200212392 X:154352516-154352538 AAGCCTGGGGAGGGGTCCTGGGG - Intronic
1200793978 Y:7323886-7323908 GCCCTTGGTGAAGGGGCCTGAGG + Intergenic