ID: 1105016929

View in Genome Browser
Species Human (GRCh38)
Location 12:132791932-132791954
Sequence GTTGTTACACTGAGGACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105016927_1105016929 0 Left 1105016927 12:132791909-132791931 CCAGGAAAGGACACATCTGCAGA 0: 4
1: 0
2: 4
3: 26
4: 251
Right 1105016929 12:132791932-132791954 GTTGTTACACTGAGGACTATAGG 0: 2
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105016929 Original CRISPR GTTGTTACACTGAGGACTAT AGG Intronic
902877342 1:19348861-19348883 GCTGTTTTACTGAGGACTAGTGG + Intronic
911285282 1:95983927-95983949 GTTGGTGCACTGTAGACTATAGG + Intergenic
911565626 1:99460386-99460408 TTTGTTTCACAGAGGAGTATTGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
919529210 1:198694857-198694879 GATTTTACACTGAAGACTAGAGG + Intronic
920877733 1:209852966-209852988 GTTATTACATTGAGGATAATGGG - Exonic
921773322 1:219069310-219069332 GTTATTACACTGAATACTTTAGG + Intergenic
921896674 1:220408807-220408829 GTTGTTCATCTGAGGACTCTGGG + Intergenic
922579621 1:226687350-226687372 GTTGTTTCACTGTGGACAGTGGG - Intronic
1068092266 10:52447325-52447347 TTGGTTACTCTGAGGATTATAGG + Intergenic
1068289364 10:54982659-54982681 GTTGTTACAGTGAAGATTTTGGG + Intronic
1068915312 10:62425491-62425513 GTTGTTACTCTGTGAACTGTTGG - Intronic
1069207148 10:65704853-65704875 GTTATTACACAAAGGACTGTAGG + Intergenic
1072931759 10:99670620-99670642 GTTGCTGCACTGAATACTATAGG + Intronic
1073404880 10:103288454-103288476 GTTGTAGCACTGAGGATTCTAGG - Exonic
1073768228 10:106707073-106707095 GGTGTTACACTGATGATTATGGG + Intronic
1073924252 10:108496765-108496787 GTTGTAACAGAGAGGATTATGGG + Intergenic
1078967135 11:16359005-16359027 CTTGCTAGACTGTGGACTATGGG - Intronic
1079869501 11:25780421-25780443 GGTGTTACACTAAGGAATATGGG + Intergenic
1082581929 11:54881561-54881583 GGTAATACACTGAGGACTATGGG - Intergenic
1091105524 11:132915634-132915656 TTTGTGTCACTGAGGACTGTAGG - Intronic
1091919649 12:4294108-4294130 GCAGTTACACTGAGGGCTAATGG + Intronic
1091986443 12:4913009-4913031 GTTGTTGCATTGAGGATTTTGGG + Exonic
1093326916 12:17787041-17787063 GTTGATACACTGGGGAGTTTTGG + Intergenic
1093385807 12:18551860-18551882 GAATTTACACTGAGGAATATTGG - Intronic
1093556377 12:20479703-20479725 GATATTACACTGAGGACACTTGG + Intronic
1097147015 12:56948760-56948782 GTTACTACACTGAGGACCTTGGG - Intergenic
1100211638 12:92404917-92404939 GTTGGTACACTGAGGCTTCTGGG + Intergenic
1101484823 12:105145289-105145311 GTTCTTAAAATGAGGAGTATAGG + Intronic
1105016859 12:132791437-132791459 GATGTTACACTGAGGGCTCCAGG + Intronic
1105016878 12:132791560-132791582 GATGTTACACTGAGGGCTCCAGG + Intronic
1105016882 12:132791601-132791623 GTTGTTACACTGAGGACTATAGG + Intronic
1105016901 12:132791727-132791749 GATGTTACACTGAGGGCTCCAGG + Intronic
1105016925 12:132791891-132791913 GATGTTACACTGAGGGCTCCAGG + Intronic
1105016929 12:132791932-132791954 GTTGTTACACTGAGGACTATAGG + Intronic
1105016948 12:132792058-132792080 GATGTTACACTGAGGGCTCCAGG + Intronic
1105788749 13:23775860-23775882 GTTGTTTCATTCAGGACTGTTGG - Intronic
1107371654 13:39756989-39757011 ATTGTTCCACTGATGTCTATGGG - Intronic
1110256192 13:73436438-73436460 GTTGTTTCACTTAGGATAATGGG + Intergenic
1110947853 13:81445719-81445741 GTTTTTACTCTGAATACTATAGG + Intergenic
1111316577 13:86569497-86569519 GTTATTACACTGAATACTGTAGG - Intergenic
1112965115 13:105180830-105180852 GTTATTCCACTGAATACTATAGG + Intergenic
1118365284 14:65089878-65089900 GTTGTTCCACTGGGAACAATAGG - Intronic
1122846373 14:104501880-104501902 GTTGGTAAACTGTGGCCTATGGG - Intronic
1129908595 15:79207585-79207607 GTTGTAAAGATGAGGACTATAGG + Intergenic
1130276502 15:82479456-82479478 GTTTTTACACTGTGTACTAAAGG + Intergenic
1130468868 15:84206848-84206870 GTTTTTACACTGTGTACTAAAGG + Intergenic
1130475142 15:84259229-84259251 GTTTTTACACTGTGTACTAAAGG - Intergenic
1130476358 15:84321399-84321421 GTTTTTACACTGTGTACTAAAGG + Intergenic
1130482558 15:84373282-84373304 GTTTTTACACTGTGTACTAAAGG - Intergenic
1130495407 15:84466731-84466753 GTTTTTACACTGTGTACTAAAGG - Intergenic
1130591162 15:85211447-85211469 GTTTTTACACTGTGTACTAAAGG + Intergenic
1131353426 15:91722286-91722308 TTTGTTACCCTGACCACTATTGG - Intergenic
1140583919 16:76265243-76265265 GTTGTTAAACTGACGTCTCTGGG - Intergenic
1140962308 16:79928043-79928065 GCATTTACACTGAGAACTATGGG - Intergenic
1141278764 16:82611658-82611680 CTTGTTTCACTGAGCACTTTTGG - Intergenic
1143717917 17:8788173-8788195 GTTGTTCCTCTGAAGACTATGGG - Intergenic
1151116149 17:71737627-71737649 GCTGTCACACTCAGGAATATTGG - Intergenic
1159177601 18:64858592-64858614 GTTGTTATACTGGGGCCTGTTGG + Intergenic
930700338 2:54454196-54454218 GTTGGTACACTGAGTTCTCTAGG + Intergenic
933387661 2:81631945-81631967 GTTGTTGTACTGAATACTATAGG + Intergenic
941043873 2:160651165-160651187 GTTGGTAAACTGAGGCCCATAGG + Intergenic
941232472 2:162928376-162928398 GTTACTACATTGAGTACTATAGG - Intergenic
942673444 2:178401779-178401801 CTTGTTACAATGAGGATTCTCGG - Intergenic
944001656 2:194846007-194846029 GTTGTTACACTGAAATCCATGGG + Intergenic
947430722 2:230025220-230025242 GATGTTACTCTGATGACTAGTGG + Intergenic
947610603 2:231522791-231522813 GTGGGGACACTGAGGACAATGGG - Intergenic
1171020001 20:21576373-21576395 ATTGTTACAGGGAGGCCTATGGG + Intergenic
1171209819 20:23308770-23308792 GTTGTGACACTGAGGAACACTGG - Intergenic
1172086093 20:32384108-32384130 CTTGTTCCACTGTGTACTATAGG + Intronic
1172427476 20:34864781-34864803 GGTTTTACCCTAAGGACTATGGG + Intronic
1172730436 20:37082643-37082665 GTTGTTACACTGTATACTTTAGG - Intronic
1174283378 20:49455170-49455192 GCTGTTACACTGAGTGATATGGG + Intronic
1177499178 21:21929550-21929572 GTTGTCACACTTAGCACAATTGG + Intergenic
1179132975 21:38655409-38655431 GTTCTTAAAATGAGGACTCTTGG - Intronic
1182233039 22:28853453-28853475 GTTGTTGCACTGAATACTGTAGG - Intergenic
1182676856 22:32045848-32045870 GTTGTTAAACTATGGACCATGGG + Intronic
951076412 3:18398844-18398866 CTTTTTACACTGTGGACTGTGGG - Intronic
951210817 3:19972412-19972434 GTTATTACACAGAGAACTCTGGG + Intronic
952871880 3:37908050-37908072 GCTGCTACACTGAGGGTTATGGG - Intronic
955611384 3:60760885-60760907 GTTGTGCCACTCAGGTCTATTGG - Intronic
957328479 3:78727842-78727864 GTTCTTACACTTAGAAGTATTGG - Intronic
957347532 3:78981671-78981693 TTTGTCACACTGAGCACTTTTGG + Intronic
957735746 3:84200350-84200372 GTTGTTACACAAAAGACTTTTGG - Intergenic
958098735 3:88981440-88981462 GCTGTTATACTGAGGATTAAAGG - Intergenic
958825464 3:99025035-99025057 GTTGTTATCCTGATGACTATAGG - Intergenic
959976612 3:112467848-112467870 GTTGATATATTGAGGACTAAAGG - Intronic
970058172 4:11999396-11999418 GTTATAACTCTGGGGACTATTGG - Intergenic
973589932 4:52430818-52430840 GATGTTACACTGAAAACTTTGGG + Intergenic
974646422 4:64699175-64699197 GTTGATTGACTGAGGACTACAGG - Intergenic
975049611 4:69843859-69843881 GTTGTAACACTGAGGCACATAGG + Intronic
980319169 4:131245713-131245735 GTTGTTAGAGTGAGGTATATAGG + Intergenic
980582918 4:134775743-134775765 GTTCTTACAGTGAGGGCAATTGG - Intergenic
981230294 4:142345694-142345716 GTTTTTACTCTGAAGACTGTTGG - Intronic
982207358 4:153006542-153006564 GGTCTTATTCTGAGGACTATGGG + Intergenic
982985983 4:162206726-162206748 ATTGTTAAACTGATGAATATGGG + Intergenic
991961137 5:72045546-72045568 GTTTTTAAACTGAGGACACTAGG + Intergenic
999400940 5:151263779-151263801 CTTGTTACACTGAGGCCCAGAGG + Intronic
1013760110 6:113508401-113508423 GATGTTGCACTCAGGAGTATGGG + Intergenic
1017037300 6:150278400-150278422 GTTCTTACACTGAGGTGTATAGG + Intergenic
1018484963 6:164231800-164231822 GTTATTACACTGTTGAATATAGG - Intergenic
1021509978 7:21425077-21425099 GGTATCACACTGAGGACTTTTGG + Intergenic
1022671413 7:32459676-32459698 TTTGTATCACTGAGGACTTTTGG + Intergenic
1023093007 7:36633670-36633692 CATGTTACCCTGAGGACTGTGGG + Intronic
1031789766 7:126087345-126087367 GTTGTCCCTCTGAGGACTTTTGG + Intergenic
1033899668 7:146120778-146120800 GTTATTACACTGAATACTATAGG - Intronic
1036188736 8:6649886-6649908 GTAGTTACCCTGAAGTCTATGGG - Intergenic
1038600715 8:28939410-28939432 GATGTTTCACTCAGGACTAGAGG - Intronic
1040759421 8:50821021-50821043 GGTGCTACACTGAATACTATAGG + Intergenic
1041957777 8:63575422-63575444 TTTGTTAGACTGAGGATTAGAGG + Intergenic
1045492911 8:102683946-102683968 TTTGTTTCACTGAGGACATTTGG + Intergenic
1050955315 9:11650277-11650299 GTTGCTACACCGATGAATATGGG + Intergenic
1051554832 9:18371481-18371503 GTTGTTACACTTAGGTTTACTGG + Intergenic
1051591731 9:18782963-18782985 GGTTTTACACTGAGTACTACAGG + Intronic
1051943719 9:22540194-22540216 GTTATTATACTGAATACTATAGG + Intergenic
1056557202 9:87699511-87699533 TTTGTTTCACTGATGAGTATGGG + Intronic
1056635915 9:88331125-88331147 GTGGTTACGCTGAGGTCTAAAGG + Intergenic
1059066150 9:111086759-111086781 GTTATTGTACTGAGTACTATAGG + Intergenic
1061177237 9:129005057-129005079 GGTGTTACATGGAGGGCTATTGG + Intronic
1188697479 X:33213531-33213553 GTAGTTATTCTGAGGACTAAAGG - Intronic
1189699275 X:43700184-43700206 CTTTTTACTCTGAGGACCATTGG - Intronic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1193349088 X:80436792-80436814 ATTGATACAATAAGGACTATTGG + Intronic
1197945457 X:131834111-131834133 GTTGTTATACTGAATACTGTAGG + Intergenic
1198513804 X:137383321-137383343 GTTACTGCACTGAAGACTATAGG + Intergenic
1198790738 X:140342753-140342775 GCTGTTACTCTGAGGAAAATTGG + Intergenic
1199535740 X:148900880-148900902 GTTATTCCAATGAGGATTATAGG - Intronic