ID: 1105017387

View in Genome Browser
Species Human (GRCh38)
Location 12:132793998-132794020
Sequence AATATGGAGGGCGGTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105017381_1105017387 -10 Left 1105017381 12:132793985-132794007 CCTTTTTCCCTACAATATGGAGG 0: 1
1: 0
2: 1
3: 33
4: 166
Right 1105017387 12:132793998-132794020 AATATGGAGGGCGGTCCCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
1105017379_1105017387 24 Left 1105017379 12:132793951-132793973 CCTAGTTATCACTAGAGCATGAC 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1105017387 12:132793998-132794020 AATATGGAGGGCGGTCCCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105017387 Original CRISPR AATATGGAGGGCGGTCCCTC AGG Intronic
901734477 1:11303857-11303879 AATGTGGAGGGAGGTACCTATGG - Intergenic
901947890 1:12718466-12718488 AATAAAGAGGGCTCTCCCTCTGG - Intronic
903270160 1:22183128-22183150 AATAAGGAGGGCCGTACCCCTGG - Intergenic
904461288 1:30681654-30681676 AATATGGAGGAGGGTAGCTCAGG + Intergenic
911157394 1:94651000-94651022 AATATGGCGGGCTTTCCCTAAGG - Intergenic
911796934 1:102087932-102087954 AATATGGAGGGTGGACAATCAGG - Intergenic
924711470 1:246533179-246533201 AACATGGATGGTGGTGCCTCAGG + Intergenic
1069529813 10:69208733-69208755 AATTTGGAGGGCTTTCCATCAGG + Exonic
1069881473 10:71596402-71596424 AATGAGGAGGGTGGTCCCTGAGG - Intronic
1077037618 11:502936-502958 AATATGGAAGGAGGTTCCTGAGG + Exonic
1079369183 11:19835948-19835970 ATGATAGAGGGAGGTCCCTCTGG - Intronic
1083476535 11:62919076-62919098 AATGAGGAGGGCGCTCCTTCTGG + Intronic
1088763536 11:112954980-112955002 AAGATGGAGTGCAGTCCCTGTGG + Intergenic
1093342239 12:17992238-17992260 AATATGGAGGTCGGCCACTAGGG - Intergenic
1105017387 12:132793998-132794020 AATATGGAGGGCGGTCCCTCAGG + Intronic
1120728440 14:87973824-87973846 AATAGGTAGGGCGGTGCCACTGG - Intronic
1122836227 14:104432338-104432360 GATGTGGAGGGTGGTCCCTGGGG + Intergenic
1127262740 15:57337891-57337913 ACTGTGGAGGGCGGCCCCTCAGG - Intergenic
1129795787 15:78374979-78375001 ACTCTGGAGGACGGTCACTCTGG + Intergenic
1131830997 15:96354436-96354458 AGCAAGGAGGGCGTTCCCTCGGG - Intergenic
1136530838 16:30867896-30867918 AAGATGGAGGGAGGGGCCTCTGG + Intronic
1161014763 19:1978188-1978210 CATTTGGAGGGTGGTCCTTCAGG + Intronic
1163855490 19:19698464-19698486 AATATGGAGGGCTGACTCTATGG - Intergenic
1167505094 19:49867137-49867159 AAGATGGGGGGCGCTCCCCCAGG + Exonic
925294535 2:2768521-2768543 AATATGGAGGGCTGACCCTGGGG + Intergenic
929228445 2:39534571-39534593 AAGAAGGAGGGCAATCCCTCTGG + Intergenic
933888139 2:86739447-86739469 AATTTGGAGGGAGGTAGCTCAGG + Intronic
933922039 2:87057259-87057281 AATTTGGAGGGAGGTAGCTCAGG - Intergenic
936588266 2:113777954-113777976 AATACAGAGGACGGTCCCTATGG + Intergenic
937926668 2:127173129-127173151 AATGTGGAGGACCGTCTCTCAGG - Intergenic
1168838246 20:892045-892067 AAGAAGGAGGGGGGTCTCTCTGG - Intronic
1170321048 20:15098431-15098453 GATATGGAGGACAGACCCTCTGG + Intronic
1175109155 20:56634161-56634183 AAAATGGAGGCCGGTCCTTGCGG + Exonic
1178270272 21:31183098-31183120 AAAATGCAGGGCGTTCACTCTGG + Intronic
1180825280 22:18857103-18857125 AATATGGATGGGGACCCCTCTGG + Intronic
1181187449 22:21117444-21117466 AATATGGATGGGGAGCCCTCTGG - Intergenic
1181211749 22:21293049-21293071 AATATGGATGGGGAGCCCTCTGG + Intergenic
1181759593 22:25049059-25049081 AACATGTAGGGCGGTAGCTCTGG - Intronic
1184751915 22:46491140-46491162 AGTATGGAGGGCGGTGCTACTGG - Intronic
1185371975 22:50465138-50465160 CAGAAGGAGGTCGGTCCCTCAGG + Intronic
1203215204 22_KI270731v1_random:2383-2405 AATATGGATGGGGACCCCTCTGG - Intergenic
1203275429 22_KI270734v1_random:83006-83028 AATATGGATGGGGACCCCTCTGG + Intergenic
951388205 3:22068904-22068926 AATATGGAGGAAGGTGTCTCAGG + Intronic
964684477 3:159379823-159379845 AATATGGAGAGAGGACTCTCTGG + Intronic
965586729 3:170325506-170325528 AATATACAGGGCAGACCCTCTGG - Intergenic
967201387 3:187075449-187075471 AATTTGGAGAGCTTTCCCTCTGG - Intronic
969732394 4:8964611-8964633 GATATGGGGGGCGGGGCCTCAGG - Intergenic
999926773 5:156387394-156387416 AATTGGGAGGGGGGTGCCTCAGG + Intronic
1011175608 6:84556714-84556736 AGTGAGGAGGGCGGGCCCTCAGG - Intergenic
1016949512 6:149566412-149566434 AAGATGGAGGGCGCTCCACCGGG + Exonic
1028440868 7:90859174-90859196 AATAAGAAGGGTGTTCCCTCCGG - Intronic
1038137846 8:24808527-24808549 AATATTGAAGGGAGTCCCTCAGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1047288268 8:123506790-123506812 GAAATGTAGGGCGATCCCTCTGG - Intronic
1054804192 9:69382138-69382160 AAGATGGAAGGCTGGCCCTCTGG + Intronic
1056135223 9:83623763-83623785 AATATGGAGGGTGGCTCCTGAGG + Intronic
1060889636 9:127179764-127179786 AATGTGCCGGGCGGTCTCTCTGG + Intronic
1198812595 X:140550763-140550785 GATGTGGAGGCAGGTCCCTCAGG + Intergenic