ID: 1105017714

View in Genome Browser
Species Human (GRCh38)
Location 12:132796220-132796242
Sequence GTGGGCTTCATTCCTTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105017714_1105017723 27 Left 1105017714 12:132796220-132796242 CCTGGAGAAGGAATGAAGCCCAC 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1105017723 12:132796270-132796292 GCGTATGCCCTTTTCCTGTTCGG 0: 1
1: 0
2: 0
3: 8
4: 99
1105017714_1105017724 28 Left 1105017714 12:132796220-132796242 CCTGGAGAAGGAATGAAGCCCAC 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1105017724 12:132796271-132796293 CGTATGCCCTTTTCCTGTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105017714 Original CRISPR GTGGGCTTCATTCCTTCTCC AGG (reversed) Exonic
900896478 1:5486403-5486425 GTGGGCTTCTTGCCATCACCTGG - Intergenic
904396740 1:30227483-30227505 GTGGGCCTGACTCCTCCTCCAGG + Intergenic
904605293 1:31694836-31694858 GGAGGCTTCCTTCATTCTCCTGG - Intronic
904851195 1:33461015-33461037 CCTGGCTTCAGTCCTTCTCCAGG + Intergenic
905528774 1:38660132-38660154 GAGGGCTTGATTCTTTCTCAAGG - Intergenic
906132548 1:43469210-43469232 GTGGGATTCCTGCCTGCTCCTGG + Intergenic
908294035 1:62694994-62695016 TTGGTCTTCATTCCATTTCCTGG - Intergenic
911365643 1:96934433-96934455 CAGGGCTGCATTCCTTCTGCAGG + Intergenic
912881401 1:113419804-113419826 GAGGGCTGCATTCCTTCTGGAGG + Intronic
914813426 1:151046315-151046337 GTGTCCTTCATTTCTTCTCTGGG - Intronic
915584772 1:156838483-156838505 GTGTTCATCCTTCCTTCTCCAGG + Intronic
918574804 1:186044820-186044842 GTGGGCTCCATAACTTCTCAAGG - Intronic
922160669 1:223077495-223077517 GTGGGGTTCCTTCCTTTCCCAGG - Intergenic
923884438 1:238139050-238139072 TTGGTCTTCATTCCTTGTCCTGG - Intergenic
1064325249 10:14344420-14344442 CTGGGCTTATTTCCTTCTCGTGG + Intronic
1066207148 10:33200497-33200519 GTGGATTTAATTTCTTCTCCTGG - Intronic
1066434245 10:35382379-35382401 GGGGGCTTGATGCCTTCTCTTGG + Intronic
1067004126 10:42645449-42645471 GGTGGCTGCATTCTTTCTCCAGG + Intergenic
1067107744 10:43376988-43377010 GTGGTCTCAGTTCCTTCTCCTGG - Intergenic
1067771288 10:49128205-49128227 GTGGGATGCATTCCTTCTGCTGG - Intergenic
1068458235 10:57288489-57288511 GTGGGCTTCATTCCTTCAAAAGG - Intergenic
1068859243 10:61830086-61830108 GTGGGGTTGATTCCTTCTGCAGG - Intergenic
1069535649 10:69250687-69250709 GTGGGCTTCCTTCCTCTTCTGGG + Intronic
1069662093 10:70130488-70130510 CAGTGCTTCATTCCTTTTCCTGG + Intronic
1070790733 10:79187794-79187816 CTTGGGTTCATTCATTCTCCAGG - Intronic
1074453051 10:113575073-113575095 GTGCTTTCCATTCCTTCTCCTGG - Intronic
1075660883 10:124194983-124195005 TTGGACATCATTCCTTATCCAGG - Intergenic
1077122589 11:916976-916998 GTGGGGTTCGTTCCTTCTGGAGG - Intergenic
1077657987 11:4040646-4040668 GTGTGCTGCATTCCTACTCTGGG - Intronic
1077985208 11:7344190-7344212 CTGGGCTGCATGCCTCCTCCTGG - Intronic
1081621916 11:44623884-44623906 GTGGGCCTCATTCCTACTCAGGG - Intergenic
1083498654 11:63082426-63082448 GTGGGCTCCATGCCTCCTGCTGG - Intronic
1084279981 11:68082206-68082228 TTGGGCTACATTCTTTCTCATGG + Intronic
1084590031 11:70085188-70085210 GGGGCCTGCATTCCTTCTGCAGG - Intronic
1085898916 11:80673719-80673741 GTTGGCTGCATTCCTTCTGAAGG + Intergenic
1088068216 11:105748267-105748289 GTGGGCCTCATTACGTCACCTGG + Intronic
1091010377 11:131995715-131995737 GTTGGCTTCATTCGTTGTCTTGG - Intronic
1091049932 11:132358205-132358227 GTGGGATTCTTTCCTGCTGCAGG + Intergenic
1097979935 12:65727833-65727855 GCTGGCTTTATCCCTTCTCCTGG - Intergenic
1103741242 12:123093040-123093062 CTGAGCTTCATTCCTTCTCATGG - Intronic
1104799936 12:131547579-131547601 GTTGGCTGAACTCCTTCTCCAGG - Intergenic
1105017714 12:132796220-132796242 GTGGGCTTCATTCCTTCTCCAGG - Exonic
1106201235 13:27539009-27539031 GTGGGCTAAACTCCTGCTCCTGG - Intergenic
1108272037 13:48771166-48771188 GAGGTCTTCCTTCCTTTTCCAGG + Intergenic
1108454581 13:50600103-50600125 GTGAACTACATTCCTTCACCTGG - Intronic
1109088527 13:58008690-58008712 TTGCTCTTTATTCCTTCTCCTGG - Intergenic
1109147332 13:58795958-58795980 AAGGGCTGCATTCCTTCTGCAGG - Intergenic
1112323418 13:98427584-98427606 GTGTCCTTCGTGCCTTCTCCAGG + Intronic
1112426260 13:99304119-99304141 CTGAGCTCCATTCCTTCTTCAGG + Intronic
1115962220 14:38848168-38848190 GTGTGCTACATTTCTTCTACTGG + Intergenic
1116357457 14:43947198-43947220 CTGGTCTTCTTTCTTTCTCCAGG + Intergenic
1117024597 14:51607030-51607052 GTGGGCATCATTCAATCTACTGG - Intronic
1119137060 14:72230758-72230780 GTGGGCCTCATCTCTTCACCTGG - Intronic
1119868162 14:77991356-77991378 GTGGGCTCCATTCCTGGTCCAGG + Intergenic
1121100249 14:91245362-91245384 CTGGGCTTGATTCCTTCTCTGGG - Intronic
1121359296 14:93241647-93241669 CTGGGCTTCATTCCTCCAGCGGG - Exonic
1125278016 15:38013874-38013896 CTGGGCTGCATTCCTTCTGCAGG + Intergenic
1127347113 15:58112017-58112039 GAGGGCTTCACTCCTTCTGGAGG - Intronic
1128507021 15:68279968-68279990 CTGTGCTTCACTCCTTCTCTAGG - Intronic
1129849600 15:78785207-78785229 TTGGTTTTCATTGCTTCTCCAGG - Intronic
1130252665 15:82310474-82310496 TTGGTTTTCATTGCTTCTCCAGG + Intergenic
1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG + Intergenic
1134238740 16:12488315-12488337 GTGGCCTTCATACCTCCACCAGG + Intronic
1135105559 16:19646187-19646209 GTGGCCTTGTTCCCTTCTCCAGG + Intronic
1135352548 16:21741212-21741234 TTAGGCTTTATTCCTTCACCTGG + Intronic
1135451036 16:22557334-22557356 TTAGGCTTTATTCCTTCACCTGG + Intergenic
1138197352 16:55061340-55061362 GTGGGCTCCATACCAGCTCCTGG + Intergenic
1141286907 16:82681178-82681200 GAGTACTTCATTCCTTCTTCTGG - Intronic
1143652985 17:8275788-8275810 GTGGGAGACATTCCTTCACCAGG - Intergenic
1144558453 17:16302195-16302217 GTTGGTTTTATTCCTTTTCCTGG + Intronic
1145368520 17:22286817-22286839 GTGGGGCTCCTGCCTTCTCCTGG - Intergenic
1147257033 17:39187546-39187568 GTTGGCTACAATCCGTCTCCAGG - Exonic
1147391140 17:40110055-40110077 TGGGACTTCATTCCTTCTCTTGG - Intergenic
1151526128 17:74669818-74669840 ATGGGATTCATTTCTTCTTCTGG + Intergenic
1151786178 17:76276107-76276129 GCGGTCTTCATTCATTCTCGTGG + Intronic
1152530222 17:80914342-80914364 GTGGGGTTCCTGCCTGCTCCCGG - Intronic
1153419393 18:4886784-4886806 GTGGACTTCATTCATTCAGCTGG + Intergenic
1154328923 18:13413854-13413876 ATGGGCTGCACTCCTACTCCTGG - Intronic
1155183558 18:23368485-23368507 GAGGGCCACATCCCTTCTCCGGG - Intronic
1155702308 18:28762043-28762065 GTGGGCCCCATTCATTCTCTAGG - Intergenic
1157280993 18:46346208-46346230 GTGGGGTTCTCTCCGTCTCCTGG - Intronic
1157416610 18:47508693-47508715 GTGGGCTTCACTTCCTCTCTGGG + Intergenic
1157538178 18:48476636-48476658 CTGGTCTTCATTCCTTCTCAGGG - Intergenic
1158472696 18:57751774-57751796 GGCAGCTTCATTCCTTTTCCAGG + Intronic
1159034132 18:63261009-63261031 AAGGGCTCCATTCCTTCTCGAGG + Intronic
1160006578 18:75073101-75073123 GTGGGCCACATGCCGTCTCCTGG + Intergenic
1160044223 18:75371858-75371880 GTGGGCTTCCCACCTTGTCCAGG + Intergenic
1160782440 19:883837-883859 TTGGGCCTCATTCCTTCCCCTGG - Intronic
1161639516 19:5412427-5412449 CAGGGCTTCATTCCTTTTCATGG - Intergenic
1161984506 19:7646276-7646298 GTGGGCTCCATGCGTTCTCTCGG - Exonic
1163674038 19:18646463-18646485 GTGGACTCAAGTCCTTCTCCTGG + Intronic
1164413698 19:28027552-28027574 ATGAGCTGCTTTCCTTCTCCAGG - Intergenic
1168146931 19:54424795-54424817 TTGGGCTTCACTCCTTACCCTGG - Intronic
925348484 2:3186191-3186213 GGGTGCCTCAGTCCTTCTCCCGG + Intergenic
927031485 2:19124687-19124709 CTGGGCTGCATTCCTTCTGGAGG + Intergenic
927520039 2:23693090-23693112 GGAGGCTTCGATCCTTCTCCTGG - Intronic
929860074 2:45669353-45669375 ATGGGCCTAATTCATTCTCCAGG - Intronic
930323019 2:49879273-49879295 GTGGCCTTCATTCCATCTCATGG - Intergenic
930685690 2:54305938-54305960 GAGGCCTGCATTCGTTCTCCAGG - Intergenic
930710198 2:54543541-54543563 GTGACCCTCAGTCCTTCTCCTGG + Intronic
932445392 2:71777826-71777848 GTGGGCATTAATCCTTCTCCAGG - Intergenic
935430785 2:102973522-102973544 GAAAGCCTCATTCCTTCTCCTGG - Intergenic
935535004 2:104283788-104283810 GTGTTTTTCATTTCTTCTCCTGG - Intergenic
935797509 2:106659101-106659123 GAGAGCTTCCTTCCTTCTGCTGG + Intergenic
936866532 2:117081257-117081279 GTGGGCTCCAATCCTTGTCAAGG + Intergenic
937095739 2:119234198-119234220 ATGGGCCTCATCCCTGCTCCTGG - Intronic
937142144 2:119611093-119611115 TGGGGATTCCTTCCTTCTCCTGG - Intronic
937244942 2:120486602-120486624 GTGGGCTTCCTTCCTCCTTCGGG + Intergenic
937828183 2:126390388-126390410 CTGGTCTTCTTTCCCTCTCCTGG - Intergenic
941279541 2:163533065-163533087 GTGGGCTTCTTCCCTTGTTCAGG - Intergenic
942017886 2:171835534-171835556 GTGGCCTTCATTACCTCTGCAGG + Intronic
943375925 2:187076430-187076452 CAGGGCTGCATTCCTTCTGCAGG - Intergenic
943964059 2:194308259-194308281 GTGTGCTTAATTCCATCTCTTGG + Intergenic
944122933 2:196260596-196260618 TTAGGCTTTATACCTTCTCCCGG + Intronic
945659447 2:212667459-212667481 GAGGGCTTCATTTCTTCACAAGG - Intergenic
947230208 2:227876897-227876919 GTTGACTTAATTCCTTCTCCTGG - Intronic
947998626 2:234548984-234549006 GTGGCCTCCATGGCTTCTCCAGG + Intergenic
948908238 2:240989962-240989984 GTGGGCTCCAGACCTGCTCCGGG + Intronic
1169296926 20:4408036-4408058 TTGGGCTTCTTTTCTTCTCATGG + Intergenic
1169882756 20:10365396-10365418 GGGGCTTTCATGCCTTCTCCAGG + Intergenic
1170644458 20:18184846-18184868 CTCAGCTTCATTCCTCCTCCAGG - Intronic
1170711078 20:18791628-18791650 GTGGCCTGTATTCCTTCTCTTGG + Intergenic
1170768229 20:19310087-19310109 GTGGAGTTCATTCCATCTTCTGG + Intronic
1172346925 20:34209415-34209437 GTGGGGTTCCTGCCTGCTCCTGG - Intronic
1173105553 20:40130081-40130103 TGGGGCTACATTCCTTCTCCAGG - Intergenic
1173356928 20:42302338-42302360 CTGGGCTTCATTCCATATCCCGG + Intronic
1173368832 20:42416316-42416338 GCGGGCTTGATTTCTTCTGCAGG - Intronic
1175319615 20:58076116-58076138 GTGTCCTTCGTCCCTTCTCCTGG + Intergenic
1175570976 20:60021450-60021472 GTGTGCTTGACTCCTTCTCTGGG + Intronic
1175636979 20:60592935-60592957 GTGGGCATCATCCCATCTGCTGG + Intergenic
1176229517 20:64024857-64024879 GTGGGCTGCTTTCCTGCTCTCGG - Intronic
1178471672 21:32899135-32899157 GTGGGCTTCAGTCCTTTTCAGGG - Intergenic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182551846 22:31104907-31104929 GAGCGCTTCATTCTGTCTCCAGG + Exonic
1182941829 22:34284163-34284185 AAGGCCTTCTTTCCTTCTCCCGG + Intergenic
1183667433 22:39253839-39253861 GGGGGCTGCCTTCCTTCCCCAGG + Intergenic
1184912439 22:47545112-47545134 GGGTGCTTGATTCCTTGTCCAGG - Intergenic
1185011182 22:48315612-48315634 GTGGGCATCCTGCCTACTCCAGG - Intergenic
950765963 3:15273136-15273158 GTGGGATTCATCCTGTCTCCTGG - Intronic
952835732 3:37600493-37600515 GTGGAGCCCATTCCTTCTCCGGG - Intronic
953899654 3:46832868-46832890 GTGGCCTTCATGTCTACTCCAGG + Intronic
953932136 3:47010709-47010731 GTCTCCTCCATTCCTTCTCCAGG + Intergenic
954844171 3:53540709-53540731 GTCGGCTTCATTCTTTGTCATGG + Intronic
955220679 3:57020516-57020538 GTGGGCTTCGTGCTCTCTCCTGG - Intronic
955356823 3:58238304-58238326 GCGAGCTGCAGTCCTTCTCCAGG - Intronic
955946832 3:64203592-64203614 GTTATCTTTATTCCTTCTCCTGG - Intronic
956692915 3:71894162-71894184 ATGGGCTTCCTTCCTTTTCTGGG + Intergenic
956743948 3:72296720-72296742 GATGGCTTCATTCCCTTTCCCGG - Intergenic
956919992 3:73918153-73918175 GAATGCTTAATTCCTTCTCCAGG + Intergenic
959164208 3:102756898-102756920 GTGGACTTAATTGCTTCTCATGG + Intergenic
963913998 3:150841152-150841174 GTGGGCTACATTCCCTCACCTGG + Intergenic
964167303 3:153724268-153724290 GTGGGCCTCATTTCTACTCAGGG + Intergenic
965671943 3:171156677-171156699 GTTGGCTGCATGCCTTGTCCTGG - Intronic
967512783 3:190331869-190331891 GGAGGCTCCATTCCTTGTCCTGG + Intronic
968044141 3:195614283-195614305 CTGGGTTTCATTCCTGGTCCTGG - Intergenic
968578667 4:1379564-1379586 ACGGCCTTCACTCCTTCTCCTGG + Intronic
971422052 4:26482216-26482238 GGGGGCTCCATGCCTTCTACCGG - Intronic
971732663 4:30406288-30406310 GTGAGCTTCATTCTCACTCCCGG + Intergenic
971789327 4:31148244-31148266 TAGGGCTTTATTCCATCTCCAGG + Intergenic
973028781 4:45309511-45309533 GTGGGCTGCATTCCTTCTCAAGG - Intergenic
975684793 4:76909014-76909036 GTGGCCTTCTTCTCTTCTCCTGG + Intergenic
976650078 4:87424664-87424686 GTGGCATTTATTCCTTCTCCTGG + Intronic
984786002 4:183567764-183567786 GTGGGCATCATCCCATCTGCTGG - Intergenic
988117867 5:26920126-26920148 GTGGGCTTCCTTCTGTCCCCAGG - Intronic
989269072 5:39510742-39510764 GCAGGTTTCATTGCTTCTCCTGG + Intergenic
989368083 5:40679058-40679080 GTGAGCTTCATGCCTTCGGCCGG - Intergenic
997368457 5:133340606-133340628 ATGGCCTTCCTGCCTTCTCCTGG - Intronic
997413047 5:133704701-133704723 GTGGGCTTCACTCCACCCCCTGG + Intergenic
1001612541 5:173014973-173014995 GGGGTCTTCATTCTTTCTTCTGG + Intronic
1001765233 5:174240577-174240599 GTGTCCTTCCTGCCTTCTCCAGG + Intronic
1002923860 6:1593662-1593684 GAGGGTTTCCTTCCTTCTTCTGG + Intergenic
1002946800 6:1769578-1769600 TTGGGCTTCAGTCTTCCTCCTGG - Intronic
1005367339 6:25091975-25091997 GAGGACTTCAATCCTTTTCCTGG - Intergenic
1007171596 6:39867956-39867978 GTGGTCTGCATGCCTGCTCCTGG + Intronic
1009386878 6:63095666-63095688 GTGGTCTTCATTGCTTCTGTGGG - Intergenic
1013959087 6:115876315-115876337 GTGGTCTTCATTTCTTCACAGGG - Intergenic
1014005595 6:116414201-116414223 ATAGGCTTCATTCCTTCTGGAGG + Intronic
1016440512 6:144078603-144078625 GTGGGCTTGAGTACTTCTGCAGG + Intergenic
1017054365 6:150424363-150424385 GTGGGGTTCCTGCCTGCTCCTGG - Intergenic
1017260322 6:152378348-152378370 CTGTGCTTCATTCCTCGTCCTGG + Intronic
1018470913 6:164097098-164097120 GTGGGCTGAAATCCTTCTGCAGG + Intergenic
1018660198 6:166078963-166078985 TTGCTCTTAATTCCTTCTCCTGG + Intergenic
1019303313 7:320420-320442 CTGTGCTTCATTCCTTTTCATGG - Intergenic
1022387601 7:29916111-29916133 TTGGGCTTGATTCATTCCCCTGG - Exonic
1023136545 7:37058627-37058649 GAGGGCTCCATTCCTTCTGTGGG + Intronic
1024211757 7:47212284-47212306 CTGTGCTTCCTTCCTCCTCCAGG + Intergenic
1029087619 7:98023564-98023586 CTGAGCTTCACTCCTTCTCATGG + Intergenic
1029113052 7:98223245-98223267 GTTGGCTGCTTTCCTCCTCCTGG - Intronic
1035471020 7:159108786-159108808 TTGGGCTGCATCCATTCTCCTGG - Intronic
1035977972 8:4334374-4334396 GTGGGCTTCATTCAATCTGAGGG + Intronic
1036575464 8:10023818-10023840 TTGGGCTTCATTTCGTCCCCAGG + Intergenic
1036654964 8:10671989-10672011 GAGGGGTTCGCTCCTTCTCCGGG - Intronic
1036766889 8:11555051-11555073 GTGGCCCTAATTCCCTCTCCTGG + Intronic
1037001811 8:13729014-13729036 GTGGCCTTTATTCCTTCCCTAGG - Intergenic
1039888534 8:41669319-41669341 CAGGGCTTCATTCTGTCTCCCGG + Intronic
1040768166 8:50941551-50941573 GGGTACTTCTTTCCTTCTCCTGG + Intergenic
1040873030 8:52120547-52120569 CTGGGCTTCCTTCCTCCTCTTGG - Intronic
1044469057 8:92544163-92544185 GTGGGCATCCTTCCTTGTACTGG - Intergenic
1045683401 8:104686785-104686807 CTGAGCTTCATTCCTTCTCTTGG + Intronic
1047288342 8:123507370-123507392 TTGGGCTTCATTCATTCCACAGG - Intronic
1047389469 8:124438418-124438440 GTGGGCTACATGCCTGCTCCGGG - Intergenic
1049452825 8:142671377-142671399 GCAGGCTGCATTCCTTCTGCTGG - Intronic
1049994696 9:1024098-1024120 ATGGGCTTCATCCCTTCCTCTGG - Intergenic
1050651726 9:7784162-7784184 GTCTGCTTCATTCATCCTCCTGG + Intergenic
1053308552 9:37001037-37001059 ATGGGCTGCAGTCCTCCTCCGGG + Intronic
1054154355 9:61629641-61629663 GTGGGCTTCCCTCCACCTCCTGG - Intergenic
1056635288 9:88326553-88326575 GAGGGCTCCATGCTTTCTCCAGG - Intergenic
1058717472 9:107735934-107735956 GTGTGCTTGATTCCTTGCCCTGG + Intergenic
1059281219 9:113135820-113135842 CGGGGCTTCATTCCTTTGCCAGG + Intergenic
1059747231 9:117214742-117214764 GTGTCCTTCCTTCCTGCTCCAGG - Exonic
1060052773 9:120388940-120388962 GTGGGCTTCACGTCTTCCCCTGG - Exonic
1060245357 9:121941474-121941496 CTGGACTTCTTTTCTTCTCCTGG + Intronic
1185555932 X:1021127-1021149 GTGACCCTCATTCCTTTTCCTGG + Intergenic
1185555969 X:1021442-1021464 CTGACCTTCATTCCTTTTCCTGG + Intergenic
1185555980 X:1021543-1021565 CTGACCTTCATTCCTTTTCCTGG + Intergenic
1185555991 X:1021642-1021664 GTGACCCTCATTCCTTTTCCTGG + Intergenic
1186237716 X:7531550-7531572 GTGGGCTTCTCTCTTTATCCTGG + Intergenic
1189244871 X:39555621-39555643 GTGGGGTTCTTTTCTTCTCCAGG + Intergenic
1191932357 X:66388056-66388078 TTGGGCTTCATTTCTTCCCAAGG + Intergenic
1195516139 X:105778400-105778422 GTGAGTTTCATTCATTATCCTGG - Intergenic
1198111033 X:133502753-133502775 ATTTGCTTCATTCCTTCTGCTGG - Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic