ID: 1105018501

View in Genome Browser
Species Human (GRCh38)
Location 12:132801122-132801144
Sequence GTCCGTCCAGGCCTGTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 56, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105018501_1105018508 14 Left 1105018501 12:132801122-132801144 CCGAGGCACAGGCCTGGACGGAC 0: 1
1: 0
2: 0
3: 56
4: 198
Right 1105018508 12:132801159-132801181 ATGCGGGACCAAGCTGGACATGG 0: 1
1: 0
2: 0
3: 6
4: 105
1105018501_1105018504 -2 Left 1105018501 12:132801122-132801144 CCGAGGCACAGGCCTGGACGGAC 0: 1
1: 0
2: 0
3: 56
4: 198
Right 1105018504 12:132801143-132801165 ACACACACTCCCACATATGCGGG 0: 1
1: 0
2: 12
3: 115
4: 868
1105018501_1105018503 -3 Left 1105018501 12:132801122-132801144 CCGAGGCACAGGCCTGGACGGAC 0: 1
1: 0
2: 0
3: 56
4: 198
Right 1105018503 12:132801142-132801164 GACACACACTCCCACATATGCGG 0: 1
1: 0
2: 2
3: 37
4: 381
1105018501_1105018509 15 Left 1105018501 12:132801122-132801144 CCGAGGCACAGGCCTGGACGGAC 0: 1
1: 0
2: 0
3: 56
4: 198
Right 1105018509 12:132801160-132801182 TGCGGGACCAAGCTGGACATGGG 0: 1
1: 0
2: 1
3: 9
4: 171
1105018501_1105018507 8 Left 1105018501 12:132801122-132801144 CCGAGGCACAGGCCTGGACGGAC 0: 1
1: 0
2: 0
3: 56
4: 198
Right 1105018507 12:132801153-132801175 CCACATATGCGGGACCAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105018501 Original CRISPR GTCCGTCCAGGCCTGTGCCT CGG (reversed) Intronic