ID: 1105019795

View in Genome Browser
Species Human (GRCh38)
Location 12:132808409-132808431
Sequence TGCGCACCAGTGTCCCTCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105019795_1105019803 13 Left 1105019795 12:132808409-132808431 CCCCCGAGGGACACTGGTGCGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1105019803 12:132808445-132808467 TTTTGTCATAGCCAGGGTACTGG 0: 1
1: 0
2: 0
3: 5
4: 182
1105019795_1105019802 7 Left 1105019795 12:132808409-132808431 CCCCCGAGGGACACTGGTGCGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1105019802 12:132808439-132808461 ATATTCTTTTGTCATAGCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 208
1105019795_1105019801 6 Left 1105019795 12:132808409-132808431 CCCCCGAGGGACACTGGTGCGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1105019801 12:132808438-132808460 AATATTCTTTTGTCATAGCCAGG 0: 1
1: 0
2: 2
3: 17
4: 199
1105019795_1105019804 20 Left 1105019795 12:132808409-132808431 CCCCCGAGGGACACTGGTGCGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1105019804 12:132808452-132808474 ATAGCCAGGGTACTGGCCCTTGG 0: 1
1: 0
2: 2
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105019795 Original CRISPR TGCGCACCAGTGTCCCTCGG GGG (reversed) Exonic
900437958 1:2640469-2640491 TGCTCATCAGGGCCCCTCGGTGG + Intronic
913963165 1:143354366-143354388 TGCGCGCCAGCGTCCCACAGAGG + Intergenic
914057521 1:144179952-144179974 TGCGCGCCAGCGTCCCACAGAGG + Intergenic
914121625 1:144786414-144786436 TGCGCGCCAGCGTCCCACAGAGG - Intergenic
917470228 1:175320152-175320174 TGCACACCAGTTTCCCTCAAGGG - Exonic
920180211 1:204127811-204127833 TGGGCACCACTGTCCCCTGGTGG + Intergenic
1067831762 10:49614602-49614624 TGCGCAGCAGCGGCCGTCGGGGG + Intronic
1069756496 10:70777055-70777077 TAGGCACCAGTATCCCTGGGAGG + Intronic
1070679552 10:78439005-78439027 TGCTCACCAGTGGTCCTAGGAGG - Intergenic
1072970010 10:100009635-100009657 TGCGCCCCACTGTCCCTCGCGGG + Intronic
1074866353 10:117546386-117546408 TGCACAGCAGGGTCCCTGGGCGG + Intronic
1076847495 10:133076416-133076438 GGTGCCCCCGTGTCCCTCGGAGG - Intronic
1077283299 11:1755014-1755036 TGCGCATCTGGGTCCCTAGGAGG + Exonic
1104672168 12:130688475-130688497 TACACACCACTGTCCCTCCGTGG + Intronic
1105019795 12:132808409-132808431 TGCGCACCAGTGTCCCTCGGGGG - Exonic
1105864999 13:24451470-24451492 TGGCCCCCAGTGTCCCTCTGTGG - Intronic
1120228984 14:81822439-81822461 TGCACACCTGTGTCCCTGGCTGG + Intergenic
1122130951 14:99604309-99604331 TGCTCCCCAGTCGCCCTCGGGGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1139020691 16:62745135-62745157 TGCTCACCTGTGTTCCTCAGAGG - Intergenic
1141598460 16:85111507-85111529 TGTGCACCAGAATCCCTGGGAGG + Intronic
1142205558 16:88781346-88781368 TGGGCACCAGTGACCCGCTGCGG + Intronic
1142218163 16:88839972-88839994 CGCGCTCCAGTGGCCCTCGGGGG + Intronic
1142814236 17:2412747-2412769 TGCTCACCAGTGTCCCAGGAGGG + Intronic
1146142614 17:30380288-30380310 TGGGCTCCAGTGTCCCTCCGTGG - Intronic
1166010080 19:39935278-39935300 TGAGCACCTGGGTCCCTGGGTGG + Intergenic
1202697005 1_KI270712v1_random:132625-132647 TGCGCGCCAGCGTCCCACAGAGG + Intergenic
927708353 2:25310790-25310812 TGCGCAACAGTATCCCCTGGAGG + Intronic
1170157061 20:13278624-13278646 TGTGCACCAGTTTTCCTTGGTGG + Intronic
1170704354 20:18731922-18731944 TTCGCTCCAGTGCCCCTCTGTGG + Intronic
1171209136 20:23303555-23303577 TGTGCACCAGGGTCCCCCCGCGG + Intergenic
1171483096 20:25468539-25468561 TGCGCACCAGTGAGAGTCGGGGG - Intronic
1172768044 20:37361500-37361522 TGCCCACCAGTGTCCCTGGAGGG + Intronic
1172992287 20:39045518-39045540 TGCTCACCAGTGGCCCCGGGAGG + Intergenic
1174066249 20:47867893-47867915 TGAGCACCAGTGGCCCACCGTGG - Intergenic
1175149875 20:56925320-56925342 TGCGCTCCCGTGCCCCACGGGGG + Intergenic
1175830037 20:61959098-61959120 AGCGCAGCAGTGTCCCACTGTGG + Intronic
1181699538 22:24612464-24612486 TGGGCAACAGTGTTCCTTGGGGG - Intronic
953886781 3:46718458-46718480 TAAGCACCAGTGTTCCTCTGTGG - Intronic
968543019 4:1177913-1177935 TGCGCAGCAGGGTCCCTTGGGGG - Intronic
981670162 4:147277431-147277453 TGTTTACCAGTGTCCCTTGGTGG - Intergenic
988960817 5:36369618-36369640 TGCTCACCAGTGTCCTTGGAAGG - Intergenic
997965578 5:138353176-138353198 TGCGCCCCGGTTTCCCCCGGGGG + Intronic
1007374802 6:41449243-41449265 TGCACACCTGTATCCCTCAGAGG + Intergenic
1018619352 6:165715101-165715123 TGCACTGCAGCGTCCCTCGGGGG - Intronic
1019305901 7:335633-335655 TGTGCACCTGTGACCCTTGGTGG - Intergenic
1019505211 7:1387040-1387062 TGAGCACCCCTGTCCCTTGGAGG - Intergenic
1020212880 7:6168853-6168875 TGCCCACCAGTGTCCCCTCGAGG - Intronic
1023342103 7:39231779-39231801 TGCGCCCCACTGGCCCTCGCTGG + Intronic
1028624953 7:92867460-92867482 TGAGCACCTGTATCCCTTGGTGG + Intergenic
1035852574 8:2935298-2935320 TGCGCACCTGAGTCCCTTGCAGG - Intergenic
1040858820 8:51978084-51978106 TGCGTTCCAGAGTCCCTCTGGGG - Intergenic
1047255393 8:123209887-123209909 TGCCCAGAAGTGACCCTCGGCGG - Intronic
1049094906 8:140542767-140542789 TGGGCACCAGTGTGCCCAGGAGG - Intronic
1057042183 9:91855830-91855852 TGTGCAGCAGTGTCTCTTGGGGG - Intronic
1061395165 9:130339861-130339883 TGCACCTCAGTGTCCCTCGAGGG + Intronic
1061536329 9:131252464-131252486 TGCGCGACAGTGACCCTGGGTGG + Intergenic
1195134112 X:101886465-101886487 TGCATACTAGTGTCCCTCAGGGG - Intronic
1199679814 X:150216712-150216734 TGGGGACCAGTGTTCCTCTGGGG - Intergenic
1199695414 X:150340337-150340359 TGGGGACCAGTGTTCCTCTGGGG + Intergenic