ID: 1105020935

View in Genome Browser
Species Human (GRCh38)
Location 12:132816489-132816511
Sequence CTGAGCGACGCGGACGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105020929_1105020935 -8 Left 1105020929 12:132816474-132816496 CCTGCTCCCAAGGGGCTGAGCGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1105020935 12:132816489-132816511 CTGAGCGACGCGGACGTGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105020935 Original CRISPR CTGAGCGACGCGGACGTGGA GGG Intronic
904237657 1:29124863-29124885 CTGCGCGCCGCGGACAGGGAGGG + Intergenic
912448242 1:109753254-109753276 CTGTGGGACGCGGACAGGGAGGG + Intronic
1067549683 10:47225698-47225720 CTGAGCGCTGGGGATGTGGAGGG - Intergenic
1076567555 10:131409300-131409322 CTGAGAGACGGGCACGTGGTGGG - Intergenic
1085317113 11:75552148-75552170 CTTAGAGAGGCCGACGTGGAAGG + Intergenic
1090119979 11:124015849-124015871 CTGAGCCACGCAGCTGTGGAAGG - Exonic
1090120624 11:124023287-124023309 CTGAGCCACGCAGCTGTGGAAGG - Exonic
1090121889 11:124038705-124038727 CTGAGCCACGCAGCTGTGGAAGG + Exonic
1105020935 12:132816489-132816511 CTGAGCGACGCGGACGTGGAGGG + Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1121055353 14:90847302-90847324 CTGGGAGAAGCTGACGTGGAGGG + Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1137678130 16:50314389-50314411 CTCACCGACGCGGAGGCGGAAGG - Exonic
1141831348 16:86511383-86511405 TTGAGCGCCGCGGACGCCGAGGG - Exonic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1143595070 17:7909231-7909253 CTCGGCGAAGCGGGCGTGGAGGG - Exonic
1143620074 17:8075663-8075685 CCGAGTGACGCAGCCGTGGAGGG - Exonic
1146208288 17:30922702-30922724 CTGCGCGACGTGGAAGTGAAGGG - Intronic
1146956046 17:36936864-36936886 CTGAGGGACGCGCCCGGGGAGGG + Intronic
1148108768 17:45132848-45132870 CGGCGCGACGGGGACGCGGAAGG - Intronic
1150124532 17:62627784-62627806 CTGAGCGCCGCGCTCGGGGATGG + Exonic
1157545088 18:48540978-48541000 CGGGGCGTCGCGGACGCGGAGGG - Intronic
1160500846 18:79400544-79400566 GGGAGCGACGAGGACGCGGAGGG - Intronic
1160750392 19:731316-731338 CTCAGCTACGCTGACATGGAAGG - Intronic
1161241475 19:3225724-3225746 CTGATCCACGCGGAGGTGGTGGG - Intronic
1161289001 19:3482970-3482992 CTGACCGGCGAGGACTTGGAGGG - Intergenic
1161581514 19:5083361-5083383 CCCAGTGACGGGGACGTGGACGG + Intronic
1167941935 19:52954579-52954601 CTTAGGGAGGCCGACGTGGAAGG + Intronic
932388821 2:71365960-71365982 CTTAGGGAAGCTGACGTGGAAGG - Intronic
935270403 2:101429646-101429668 CTGAGTGACGGGGACGTGGGAGG - Intronic
936461009 2:112713811-112713833 CTGAGGATCGCGGAGGTGGAGGG - Intergenic
946522286 2:220479434-220479456 CTGAGGGAGGCTGAGGTGGAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG + Intergenic
966881206 3:184352312-184352334 TAGAGTGACGCGGACCTGGAAGG - Exonic
991649867 5:68840858-68840880 CTGAGCGACACAGAGGTGCAAGG + Intergenic
992445385 5:76828735-76828757 CTTTGCGAGGCTGACGTGGAAGG - Intronic
1015381099 6:132570358-132570380 CTGTGCTACGCGAACGTGAATGG + Exonic
1019564082 7:1671004-1671026 CAGAGGGACGAGGACGAGGATGG - Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1027570225 7:79856914-79856936 CTGAGGGAAGATGACGTGGAAGG - Intergenic
1027931807 7:84546611-84546633 CGGAACGACGCGGACGCCGAGGG - Intergenic
1034680860 7:152926080-152926102 CGGCGCCACGCGGACGTGGGTGG + Intergenic
1043889688 8:85642540-85642562 CAGAGCGATGGGGACATGGACGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1060916908 9:127397333-127397355 GTGAGCGGAGCGGACGCGGAGGG - Intronic
1061666384 9:132162889-132162911 CTGAGCGGCGCGCAGGTGGGGGG + Intronic
1062234344 9:135500823-135500845 TGGAGCGGCGGGGACGTGGAGGG + Intronic
1062600569 9:137317068-137317090 CTGAGCGTGGCGGGCCTGGAGGG + Intronic
1185974131 X:4700044-4700066 CTGAGGGAGGCTGACGTGGGAGG + Intergenic
1186956635 X:14688873-14688895 CTGAGCGACGCAGAAGACGAGGG - Intronic
1195599254 X:106727106-106727128 CTGAGCGAGGAGGGCGTGTACGG + Exonic
1198335919 X:135666633-135666655 CTGAGCGTCGTGCATGTGGAGGG - Intergenic