ID: 1105021385

View in Genome Browser
Species Human (GRCh38)
Location 12:132818847-132818869
Sequence AGCCTGCTGGGTAAAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105021379_1105021385 3 Left 1105021379 12:132818821-132818843 CCAGAACCGCGCTTCTGCTTGAT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1105021380_1105021385 -3 Left 1105021380 12:132818827-132818849 CCGCGCTTCTGCTTGATGACAGC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1105021377_1105021385 21 Left 1105021377 12:132818803-132818825 CCGTGAAGCAGAGACAGCCCAGA 0: 1
1: 0
2: 2
3: 37
4: 464
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1105021378_1105021385 4 Left 1105021378 12:132818820-132818842 CCCAGAACCGCGCTTCTGCTTGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1105021375_1105021385 25 Left 1105021375 12:132818799-132818821 CCACCCGTGAAGCAGAGACAGCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1105021376_1105021385 22 Left 1105021376 12:132818802-132818824 CCCGTGAAGCAGAGACAGCCCAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105021385 Original CRISPR AGCCTGCTGGGTAAAGGCCT GGG Intronic
900473824 1:2867124-2867146 AGCCTGCTGTGTCCAGGGCTCGG + Intergenic
900897370 1:5493135-5493157 ACCCATCTGGGAAAAGGCCTGGG - Intergenic
901001514 1:6151183-6151205 AGCCTTCTGGGTGAAGCCCTGGG - Intronic
902256966 1:15195828-15195850 ATCCTGCTGGGTCAAGGCCGAGG - Intronic
902714931 1:18266057-18266079 AGCCTGCAGGGTAAATTTCTGGG - Intronic
903663890 1:24995297-24995319 AGCATGCTGGGAAGAGGCCCGGG + Intergenic
908150252 1:61293383-61293405 AACATTATGGGTAAAGGCCTAGG + Intronic
912429530 1:109621643-109621665 AGCCTGCCTGGTAAAGGCACAGG - Intronic
915946049 1:160152583-160152605 ATCCTGCTGGGCAAAGGTCCAGG - Intronic
916482023 1:165222789-165222811 ACCCGGCTGGGTATGGGCCTCGG - Intronic
916868876 1:168890146-168890168 AGCCTGATGACTACAGGCCTTGG - Intergenic
918981112 1:191560553-191560575 AGAGTGCTGGGTAAAGTCATGGG + Intergenic
920163913 1:204021544-204021566 AGCCTGCTGGCCAAAGGCACAGG - Intergenic
921720452 1:218465009-218465031 AGCATGGTGGGTAGAGGCCAGGG + Intergenic
1063657057 10:8001133-8001155 AGACAGCTGTGTAAAGGTCTGGG - Intronic
1065002888 10:21353136-21353158 AGCATGGTGGTTAAAAGCCTGGG - Intergenic
1066563054 10:36691355-36691377 AGCCTGCCAGGTAAAGGCATCGG - Intergenic
1067687660 10:48476809-48476831 GGCCTGCTGGGTGCAGGTCTTGG + Intronic
1067995869 10:51272650-51272672 ACCCAGCTGGGAAAAGGCCAAGG - Intronic
1068490345 10:57715456-57715478 AGCCGGGTGGTTAAAAGCCTGGG - Intergenic
1069082512 10:64103403-64103425 AGCATTCTGATTAAAGGCCTAGG + Intergenic
1069801216 10:71082902-71082924 AGCCTGCAGTCTACAGGCCTGGG - Intergenic
1070790886 10:79188644-79188666 AGCTGGCTGGGTAAAAGACTGGG - Intronic
1072389001 10:94963157-94963179 AGCCTGGTGAGTAAATGCCTTGG + Intronic
1074112715 10:110433842-110433864 ACCTTGCTGGGAATAGGCCTCGG - Intergenic
1074827827 10:117227674-117227696 AGCCTTCTGGGGAAAGGCAAGGG + Intergenic
1076982115 11:210121-210143 AGCCTGTTGGGACAAGGCCAAGG + Intronic
1077315809 11:1918956-1918978 AGTTTGCTGGGTAAGGGTCTGGG - Intergenic
1077350600 11:2091451-2091473 AGCCAGCTGGGAAAAGGGCTTGG - Intergenic
1078545364 11:12243054-12243076 AGCCTGCTTGGAAAATACCTAGG - Intronic
1078664962 11:13316600-13316622 AGCCAGCTGGGCAGGGGCCTTGG + Intronic
1081534081 11:43984871-43984893 AGGCTGCTGGGAAATGGCCAGGG + Intergenic
1084597987 11:70128594-70128616 CGCCTGCTGGGCAGAGGCCTTGG - Intronic
1085111537 11:73894238-73894260 AGAGTGCTGGGTACAGGCATGGG - Intronic
1085952108 11:81344518-81344540 AGGCTGCTGGGTAAGGGACCAGG + Intergenic
1087937491 11:104051601-104051623 AGACAGATGGGTAAAAGCCTAGG + Intronic
1088828443 11:113515376-113515398 AGGCACCTGTGTAAAGGCCTGGG + Intergenic
1090172888 11:124620378-124620400 AGCAAGCTGGGTAAATTCCTAGG - Intergenic
1090228520 11:125085665-125085687 AGCCTGCTTGGTAAGAGTCTTGG + Exonic
1090920390 11:131201499-131201521 CACATGCTGGGTAAAGGGCTGGG - Intergenic
1091345135 11:134847327-134847349 AGCCTCCTGGGGAAGGGCCCTGG + Intergenic
1091399466 12:173503-173525 GGCCAGCTGGGTCTAGGCCTGGG + Intronic
1092515492 12:9207381-9207403 AGGCAGCTGGGTTAAGGCCAGGG + Intronic
1094231945 12:28115696-28115718 AGGCTGCTGGCTTAAGACCTGGG + Intergenic
1095054378 12:37582238-37582260 AGCCTGGTGGGTAGAGGGGTGGG + Intergenic
1101988617 12:109466756-109466778 AGCTTGCTGGTTAAAGGACAGGG - Intronic
1103741457 12:123094384-123094406 AGCCTGCTGGGTGAAGACATGGG - Intronic
1103939821 12:124495611-124495633 TGCCTGCCGGGTGAAGGCCTGGG - Intronic
1104080171 12:125423064-125423086 AGCCTACTGGGGTAAGGGCTAGG - Intronic
1104809268 12:131610782-131610804 AGCCTGCTGGATAGAGTCCTGGG + Intergenic
1104984587 12:132589491-132589513 GGCCTGCTGGCTAAGGGCCCAGG + Intergenic
1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG + Intronic
1105476261 13:20730360-20730382 ACCCTGCTGGGAACAGGGCTGGG - Intronic
1107976514 13:45693609-45693631 AACCTGCTGGGGATAGGCCAGGG + Intergenic
1111972666 13:94933396-94933418 AGCCTGCTGGATAATGAGCTGGG - Intergenic
1112320198 13:98399428-98399450 TGCAGGCTGGGTAAAGACCTGGG - Intronic
1117295386 14:54374463-54374485 AATCTGGTGGGTAAAGGCCAGGG + Intergenic
1119325727 14:73758867-73758889 AGGCCTCTGGGTAAAGGTCTAGG - Intronic
1122268263 14:100556775-100556797 GGCCTGCAGGGTGAAGGCCTGGG + Intronic
1123450299 15:20355698-20355720 GGGCTGCTGGGTGAATGCCTTGG + Intergenic
1123919220 15:25058766-25058788 ATCCTGCTGATTGAAGGCCTTGG + Intergenic
1123983486 15:25623933-25623955 ACCCTGCTTTGTAAAGGCTTGGG + Intergenic
1128211716 15:65908120-65908142 AGCCTCCTGAGTATAGGCCCAGG + Intronic
1129456088 15:75676853-75676875 AGCCTGGTGGGTGGTGGCCTGGG - Exonic
1129822914 15:78616916-78616938 AGCCTTCTTGGAAAAGGCCAAGG + Intronic
1132001799 15:98188012-98188034 ACCCTGCTGGATAAATGCCATGG + Intergenic
1132100792 15:99021582-99021604 AGCCTGCTGACTACTGGCCTAGG - Intergenic
1132175133 15:99707794-99707816 AGCCTTCAGGGTAAATGCTTTGG + Intronic
1132810187 16:1793558-1793580 AGCCCGCTGGGGAGAGGCCGGGG - Intronic
1133716783 16:8457733-8457755 AGTCTGGGGGGTAAAGGCCAGGG + Intergenic
1134055477 16:11167262-11167284 ATCCTGCTGGCTCAAGGCCATGG - Intronic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1136670742 16:31854848-31854870 AGCATGCTGTCTAAAGGTCTAGG + Intergenic
1141497503 16:84420128-84420150 AGGTGGCTGGGGAAAGGCCTGGG - Intronic
1142905939 17:3041853-3041875 AGCCTGGTGGGTACAGATCTTGG + Intergenic
1144081846 17:11770212-11770234 AGTCTGCTGGCCTAAGGCCTGGG - Intronic
1144215130 17:13048746-13048768 AGCCTGCTGGGTAAGAGCACGGG - Intergenic
1144788147 17:17843174-17843196 GGCCTGCTTGCTCAAGGCCTGGG + Intergenic
1145776264 17:27531284-27531306 TGCCTGCTGGGTCATGGCCTTGG + Intronic
1146572626 17:33966003-33966025 AGCCTGCATAGTGAAGGCCTTGG - Intronic
1148107675 17:45128069-45128091 TGCCTGCTGGCTAAAGGATTAGG - Intronic
1148195688 17:45710978-45711000 TGCCTGCTGGGCAATGGCCAGGG + Intergenic
1148638711 17:49168966-49168988 AGCCAGCCGGGTACAGCCCTTGG - Intronic
1149444204 17:56701033-56701055 CTCCTGCTGGGTACAGGCCCAGG - Intergenic
1150619437 17:66798215-66798237 AGCTTGATGGGCAATGGCCTCGG - Intronic
1150834475 17:68552090-68552112 AGCCTGCAGGGTAAACGCCATGG + Intronic
1151763813 17:76122043-76122065 GGCCTGCTGGGGGAACGCCTGGG - Intergenic
1152387139 17:79981371-79981393 GCCCTGCTGGGAGAAGGCCTCGG + Intronic
1152848504 17:82617260-82617282 TGCCTGCTGGGGAAAAGCCGGGG - Intronic
1157204473 18:45687054-45687076 AGCCTGCTGAGTGAGCGCCTTGG + Intergenic
1157452975 18:47801797-47801819 AGATTGCAGGGTACAGGCCTTGG - Intergenic
1158634562 18:59145472-59145494 AGCCTTCTGGGTAAAGGCCCTGG + Intronic
1158833827 18:61309181-61309203 AGCCTGCTCGGTTAGGGGCTGGG - Intergenic
1160975866 19:1792118-1792140 GGTCTCCTGGGCAAAGGCCTGGG + Exonic
1161851207 19:6739052-6739074 AGGCAGCTGGGGAAAGGCCTGGG + Intronic
1162155728 19:8677076-8677098 AGCCTGCAGGGGCAAGGCCCGGG - Intergenic
1162544663 19:11321565-11321587 AACATTCTGGGCAAAGGCCTTGG + Intronic
1163554430 19:17984189-17984211 CACTTGCTGGGTAAAGGCCCAGG - Intronic
1164051210 19:21586821-21586843 AGCCAGCGGGGTTGAGGCCTGGG - Intergenic
1164684932 19:30160355-30160377 AGCATGCAGGGTGAAGTCCTGGG - Intergenic
1166660651 19:44644562-44644584 ACGCTGCTGGGTTATGGCCTGGG - Intronic
1166853770 19:45772330-45772352 AGCCTCCAGGGCAAAGGCCTTGG - Intronic
1167262172 19:48464885-48464907 GGCCTGCTGGGTAAATGACTAGG + Exonic
1167431801 19:49459468-49459490 AGGATGCTGTGTAAAGGTCTTGG - Intronic
926015276 2:9446071-9446093 TGCTTGCTGGGGAAGGGCCTGGG - Intronic
928024457 2:27728502-27728524 AGCCTGCTGAGGTGAGGCCTGGG + Intergenic
929122778 2:38497023-38497045 AGTCTGCTTGGTAAAGGGCCGGG + Intergenic
929812713 2:45205330-45205352 AACATCCTGGGGAAAGGCCTTGG + Intergenic
935083577 2:99823103-99823125 AGCCTGGTGAGTCAAAGCCTGGG - Intronic
936010396 2:108921743-108921765 AGCCCTCTGGGTTAGGGCCTCGG - Intronic
937350087 2:121155195-121155217 AGCCAGCTGGGGAGGGGCCTGGG - Intergenic
938748501 2:134304903-134304925 AGCCTGCTAGGTAATGTCCTTGG - Intronic
940498618 2:154465996-154466018 TGCCTGCCGGATAAGGGCCTGGG + Intergenic
945406128 2:209451281-209451303 AGCCTGATGGGCAGACGCCTAGG - Intronic
946433102 2:219635882-219635904 GGGCTGCTGGGTAAGGGACTGGG + Exonic
947820908 2:233068848-233068870 AGGCTGCTGGGGACAGGGCTGGG + Intronic
1169263522 20:4154135-4154157 AGCCAGGTTGGGAAAGGCCTTGG + Intronic
1170600854 20:17840434-17840456 AGACTTCTGGATAAAGACCTTGG - Intergenic
1172811215 20:37649686-37649708 ATCTTTCTGGGTAAGGGCCTGGG - Intergenic
1174276662 20:49409153-49409175 GGACTGCTGGTTAAAGGCTTGGG - Intronic
1174377859 20:50138443-50138465 GGGCTGCTGGGTAAAGGGCCCGG + Intronic
1175312447 20:58021029-58021051 AGCTTGCAGGGGAAAGGCCTGGG + Intergenic
1175910490 20:62403025-62403047 ATGCTTCTGGGGAAAGGCCTGGG - Intronic
1176242727 20:64082592-64082614 AGCCTGCTGGGCAGGGGGCTGGG + Intronic
1179775097 21:43657238-43657260 AGCCTGCTGCGTACAGGCGCCGG - Intronic
1182455957 22:30450725-30450747 GCCCTGCTGGCTCAAGGCCTGGG + Intronic
1183838029 22:40473235-40473257 AGCCTGGTGGGTCAAGGCTGCGG - Intronic
1184249723 22:43253238-43253260 AGCCTGTGGGGTAAAGACATAGG - Intronic
1184474494 22:44713165-44713187 TGCCTGCTGGGCAAAGCCCTGGG + Intronic
1185077409 22:48690783-48690805 AGCCTCCTGGGCAGAGGCCAAGG - Intronic
950114059 3:10439040-10439062 GGACTGCTGGGCCAAGGCCTGGG + Intronic
950151564 3:10691511-10691533 AGACTGCTGAGTGAAGCCCTAGG - Intronic
954452632 3:50579959-50579981 AGCCTGCTGGGGACAGACCTAGG - Intronic
954699891 3:52445663-52445685 AGCCAGATGGGGACAGGCCTGGG - Intergenic
956948360 3:74251408-74251430 AGCCTGCTGGATAAAGCACGAGG - Intergenic
959604912 3:108232204-108232226 AGCTTGCTGTGTAAACGCCAGGG + Intergenic
961415276 3:126752443-126752465 GGCGTGCTGGGAGAAGGCCTTGG + Intronic
961509218 3:127390933-127390955 CTCGTGCTGGGTAAAGGCCAGGG + Intergenic
963703095 3:148651002-148651024 AGCCCACTGGGCAGAGGCCTGGG - Intergenic
964564386 3:158033798-158033820 AGCCTGATGACTAAATGCCTTGG - Intergenic
965634029 3:170763051-170763073 AGCCTGGTGGTTAAAGACATGGG - Intronic
966007385 3:175032601-175032623 AGCCTGCCAGGTAAAGGCAAAGG - Intronic
966865965 3:184259442-184259464 AGCCTCCTGGGGTCAGGCCTGGG + Exonic
966977489 3:185098100-185098122 AGCCTGCAGGGGAAAGGCTGTGG + Intronic
977624722 4:99177886-99177908 AGCCTGATGAGTATATGCCTTGG + Intergenic
977666113 4:99649372-99649394 ATGCAGCTGGGCAAAGGCCTTGG + Exonic
977745999 4:100548293-100548315 AGGCTGCTGCTTGAAGGCCTTGG - Intronic
978614067 4:110576101-110576123 TGCCTGTAGGATAAAGGCCTTGG - Intergenic
986177668 5:5365581-5365603 TTCCTGCTGGGGAGAGGCCTTGG + Intergenic
986607036 5:9532768-9532790 AGCCTGGTGGAGAAAGGGCTTGG - Intronic
992090472 5:73312000-73312022 CCTCTGCCGGGTAAAGGCCTGGG - Intergenic
993968147 5:94383174-94383196 AGCTTGCTGGGGAAAGGCTCTGG + Intronic
998963987 5:147518436-147518458 AGTCTGGTGGATATAGGCCTTGG + Intergenic
999321206 5:150616195-150616217 AGCAGGCTGGGTCAAGGTCTTGG - Intronic
1001668700 5:173455633-173455655 AGCGTGCATGGCAAAGGCCTTGG - Intergenic
1007495693 6:42259284-42259306 TGGGTGCTGGGTAAAGTCCTGGG - Intronic
1008535225 6:52502324-52502346 GGACTGCTGGAGAAAGGCCTAGG + Exonic
1008564965 6:52758504-52758526 AGCCAGCTGGGTGAAGGCCCTGG + Intronic
1008569288 6:52799822-52799844 AGCCAGCTGGGTGAAGGCCCTGG + Intronic
1011322242 6:86108419-86108441 AGACTGCTGGTTAGAGTCCTTGG + Intergenic
1016031901 6:139346392-139346414 AGCCTGATGACTATAGGCCTTGG - Intergenic
1016321774 6:142854259-142854281 ACCCTGGTGGGTAGAGGCCAGGG + Intronic
1019653085 7:2171308-2171330 AGCCTACTGGGTAAGAGCCTAGG - Intronic
1019914476 7:4123940-4123962 AACCTGCAGAGCAAAGGCCTGGG - Intronic
1021821836 7:24506162-24506184 CACCTGGTGGGTAAAGGCCAGGG + Intergenic
1022262651 7:28721215-28721237 CACCTGCTGGGTAGAGGCCAGGG + Intronic
1022976257 7:35559130-35559152 AGTCAGTGGGGTAAAGGCCTTGG - Intergenic
1024043985 7:45575084-45575106 AGCCTGCTGGCCATAGGCTTTGG + Exonic
1024049396 7:45609299-45609321 AGCCTGCCGGGCACAGCCCTGGG - Intronic
1024115873 7:46192516-46192538 AGCCTGCTGGGATAATGCCTTGG + Intergenic
1028226120 7:88254821-88254843 TGCCTGGTGAGTAAAGGGCTTGG + Intergenic
1031968782 7:128048575-128048597 AGCCTGTTTGGTAACAGCCTTGG + Intronic
1033399335 7:141007023-141007045 AGGCTGCTGGGGAAAGGCTCAGG + Intronic
1033665001 7:143432400-143432422 TGCCTGTAGGGTAAAAGCCTGGG + Intergenic
1033671902 7:143501085-143501107 AGCCTGGTGGCTAAAGGTGTAGG + Intergenic
1036201717 8:6775965-6775987 AGCCTGCCTGGTAAGGGCTTTGG - Intergenic
1036601375 8:10263699-10263721 AGCCTGCTGGGGACAGGAATAGG + Intronic
1037677800 8:21066867-21066889 AGTGTGCTGGCTAAGGGCCTGGG - Intergenic
1038219447 8:25593541-25593563 AGCCCGCTGGGAAGATGCCTAGG + Intergenic
1040291376 8:46127327-46127349 AGCCTGCTAGGGACAGTCCTGGG + Intergenic
1040302270 8:46194240-46194262 AGCCTGCTGGGGATAGGTTTGGG - Intergenic
1040309457 8:46229219-46229241 AGCCTGCCTGGGAAAGTCCTGGG - Intergenic
1040309899 8:46231494-46231516 AGCCTGCTTGATACAGCCCTGGG - Intergenic
1040325834 8:46341069-46341091 AGCCTGCCGGGGACAGCCCTGGG - Intergenic
1040325928 8:46341489-46341511 AGCCTGCTTGGGACAGCCCTAGG - Intergenic
1040330022 8:46381140-46381162 AGCCTACTTGGTGAAGCCCTGGG - Intergenic
1040330299 8:46382434-46382456 AGCCTGCTTGAGAAAGCCCTGGG - Intergenic
1040331110 8:46386253-46386275 AGCCTGCTTGGGACAGCCCTTGG - Intergenic
1040335546 8:46414184-46414206 AGCTTGCTTGGGAAAGCCCTGGG - Intergenic
1041154227 8:54967794-54967816 AACCTGCTGAATAAAGTCCTAGG - Intergenic
1041182031 8:55259045-55259067 TGCCTGCAGGGAAAATGCCTGGG + Intronic
1046528082 8:115407265-115407287 AGCCAGCTGGGTAGAGACTTTGG - Intergenic
1047319346 8:123765017-123765039 AACCTGCTGTGCAAAGGTCTGGG + Intergenic
1048267947 8:133004236-133004258 AGCATGGTGGTTAAAGGTCTTGG - Intronic
1048424033 8:134306130-134306152 AGCCCTCTGGGCCAAGGCCTGGG - Intergenic
1048809155 8:138269479-138269501 AGCCAGCTGGCTTCAGGCCTGGG - Intronic
1048897053 8:139001529-139001551 TGTCTGCTGGGAAAAGGACTTGG + Intergenic
1049462312 8:142735835-142735857 AGCATCCTGGGTACAGGCCTGGG + Exonic
1050212649 9:3280202-3280224 TGCCTCCTGGGAAAAGGTCTAGG + Intronic
1050247396 9:3704992-3705014 AACCTGCTGGGCAAGTGCCTTGG - Intergenic
1052339517 9:27351539-27351561 AGCCTTCTGGCTGAAGGCCAAGG + Intronic
1052701499 9:31942595-31942617 AGCTTGTTGGGTAACTGCCTTGG + Intergenic
1055822505 9:80284132-80284154 AGCCTGCTGGGTCAAGGTGCTGG + Intergenic
1057087209 9:92222251-92222273 CGCCTCCTGGGTTCAGGCCTGGG - Intronic
1059430304 9:114245968-114245990 AGGGTGCTGGGCAAAGGGCTTGG - Intronic
1059562667 9:115350430-115350452 CGTCTACTGGGTAAAGGCCAAGG + Intronic
1059768117 9:117403130-117403152 AGGCTCCTGGGGAGAGGCCTGGG - Intronic
1060497654 9:124130165-124130187 AGCCTCCTGGGTAGACCCCTTGG + Intergenic
1060980775 9:127790422-127790444 AGACTGCTGGGTAGAGGGCCTGG + Exonic
1060992659 9:127857704-127857726 TCCCTGCTGGGCACAGGCCTTGG + Intergenic
1061012363 9:127963253-127963275 AGCCACCTGGTTCAAGGCCTGGG + Intronic
1061012530 9:127963988-127964010 AGTCAGCTGGGTGAAGACCTGGG + Intronic
1061326056 9:129865411-129865433 GGCCTGGTGGGTCATGGCCTTGG - Intronic
1062266372 9:135688224-135688246 TGCCTCCTGGGTCAAGGGCTGGG + Intergenic
1062724298 9:138062705-138062727 AGGATACTGGGTAAAGTCCTGGG - Intronic
1190258157 X:48780152-48780174 AGCCTGGGGGGTCAAGGCCTCGG + Intergenic
1192547716 X:72027598-72027620 AGGCTGCTGGGGAAAGCCCTGGG - Intergenic
1196009044 X:110866678-110866700 AATCTACTGGGTAAAGGCCAGGG + Intergenic
1198679851 X:139169870-139169892 AGCATGGAGGGCAAAGGCCTGGG + Intronic
1199680374 X:150220316-150220338 AGCCTGCTGGGAAACGTCCAAGG - Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1201982366 Y:19921967-19921989 AGCCTGCTTCCTAAATGCCTTGG + Intergenic