ID: 1105021851

View in Genome Browser
Species Human (GRCh38)
Location 12:132822018-132822040
Sequence AGGTGGCACCAGTGGGCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105021840_1105021851 28 Left 1105021840 12:132821967-132821989 CCAGCACACAGAGGAACCTCACG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 201
1105021842_1105021851 12 Left 1105021842 12:132821983-132822005 CCTCACGACTTACACTGGACTTT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105021851 Original CRISPR AGGTGGCACCAGTGGGCCCG GGG Exonic
900171949 1:1273614-1273636 AGGGGGGACGAGCGGGCCCGAGG + Intronic
900173254 1:1280898-1280920 AGGTGGCACCAAGGTGCCCCCGG - Intronic
900539672 1:3196553-3196575 CGGTGGCCCCAGGGTGCCCGTGG + Intronic
901628950 1:10638950-10638972 AGGAGGCTGCAGTGGGCGCGGGG + Exonic
902030203 1:13416645-13416667 AGGTGGCCCAAGTGGGCTGGTGG + Intronic
904028740 1:27520905-27520927 AGGTGGCTCTAGTGGGGCCCAGG + Intergenic
904388722 1:30164870-30164892 AGGTGGCACCAAAGAGCCTGTGG - Intergenic
904481437 1:30796328-30796350 AGGTGGCACAAGTGAGACCCTGG + Intergenic
905318589 1:37099449-37099471 GGGTGGCACCAGTGGCCCCCAGG - Intergenic
905393038 1:37650484-37650506 AGGAGGCCCCAGTTGGCCCAAGG + Intergenic
905643856 1:39610554-39610576 AGCTGGCACCAGTTGGTCCAGGG + Intergenic
906769593 1:48472112-48472134 CGGTGGCAGCAGTGGCCCCCAGG + Exonic
911086337 1:93980483-93980505 TGGCGGCAGCAGTGGGCCCTGGG - Intergenic
912535848 1:110369766-110369788 TGGTGGCTCCAGTGGCCCCAGGG - Intronic
913054863 1:115148555-115148577 AGGTGTCAGCAGTGTGCCCCTGG - Intergenic
916473207 1:165143625-165143647 AGGTGGCAGCAGAGAGCACGGGG - Intergenic
920293335 1:204939684-204939706 AGGTGGCATGACTGGGCCCTAGG + Intronic
922171901 1:223162480-223162502 AGGTGGCAGCCCTGGGCCCTGGG - Intergenic
922216460 1:223523951-223523973 AGATGTCACCAATGGGCCCACGG - Intergenic
1063124011 10:3124316-3124338 AGGTGGGAACAGTGGGCGTGTGG + Intronic
1066057729 10:31697543-31697565 AGGTGGCAGCCGTGGACCCTGGG - Intergenic
1067088475 10:43254921-43254943 AGGGGCCTCCAGTGGGCCCTGGG - Intronic
1067239119 10:44475329-44475351 AGGTGGCACTAGAAGGCCCAAGG + Intergenic
1067430555 10:46240791-46240813 CAGTGGCAGCAGTGGGCCAGGGG - Intergenic
1070611614 10:77937237-77937259 AGGAGGCAGAAGTGGGCCCTGGG - Intergenic
1071727870 10:88218125-88218147 AGGTGGCATCAGTTAGCCCCAGG - Intergenic
1072070296 10:91908828-91908850 AGGAGCCGCCAGTGGGCCCGGGG + Exonic
1073242274 10:102066388-102066410 AGGAGGCACCTGTAGGCCCGTGG + Exonic
1073440846 10:103551840-103551862 AGGTGGCCCGAGTGGCCCCCAGG - Intronic
1076407178 10:130220361-130220383 AGTTGGGACCAGTGGGCGCGAGG + Intergenic
1076688514 10:132208931-132208953 AGCGGGCACCTGTGGGCCTGGGG - Intronic
1077102504 11:828434-828456 AGGTGGGACCAGGGGGCTGGGGG - Intronic
1077184286 11:1229399-1229421 AGGTCCCACCAGAGGGCCCAGGG + Intronic
1077293797 11:1814669-1814691 AGGCGGCCCCTGTGGGCCCCCGG - Intergenic
1077390737 11:2299681-2299703 AGGTGGCATCATTGAGCCAGGGG + Exonic
1077404062 11:2374942-2374964 AGGTCACACCAGTGGGCCACTGG + Intergenic
1081813898 11:45928175-45928197 AGGTACCACGAGTGGCCCCGAGG + Exonic
1083428734 11:62602715-62602737 GGGTGGGACCGGTGGGCCCGAGG - Intronic
1084705004 11:70810996-70811018 AGGTGGCCCCAGTGTCCCCTGGG + Intronic
1084978306 11:72815100-72815122 AGGGGGCATCAGGGGGCCCCGGG + Intronic
1085294880 11:75425714-75425736 TGGTGGCAGCACTGGGCTCGGGG - Intronic
1087152202 11:94869231-94869253 GGGTGGCAGCAGTGGGGCAGAGG - Exonic
1090827822 11:130400337-130400359 TGGTGGCACCAGTGTGCTCAGGG + Intergenic
1094838343 12:34332652-34332674 GGCTGGCCCCCGTGGGCCCGAGG - Intergenic
1094844111 12:34353986-34354008 GGCTGGCCCCTGTGGGCCCGAGG + Intergenic
1094844716 12:34356393-34356415 GGCTGGCCCCCGTGGGCCCGAGG + Intergenic
1094846043 12:34361848-34361870 CGCTGGCCCCCGTGGGCCCGAGG + Intergenic
1094846327 12:34362981-34363003 GGCTGGCCCCCGTGGGCCCGAGG + Intergenic
1094847197 12:34366519-34366541 GGCTGGCCCCCGTGGGCCCGAGG + Intergenic
1094848010 12:34369876-34369898 GGTTGGCGCCTGTGGGCCCGAGG + Intergenic
1094849011 12:34374013-34374035 GGCTGGCCCCAGTGGGTCCGAGG + Intergenic
1094849309 12:34375300-34375322 GGCTGGCTCCTGTGGGCCCGAGG + Intergenic
1094849728 12:34376992-34377014 GGCTGGCACCCGTGGGCCCAAGG + Intergenic
1094850227 12:34379069-34379091 GGCTGGCACCAGTAGGCCCGAGG + Intergenic
1094850442 12:34380005-34380027 AGCTGGCACCTGTGGGCTCGAGG + Intergenic
1094852727 12:34389458-34389480 GGCTGGCCCCTGTGGGCCCGAGG - Intergenic
1094853641 12:34393377-34393399 GGCTGGCCCCTGTGGGCCCGAGG - Intergenic
1094855089 12:34399300-34399322 GGCTGGCCCCTGTGGGCCCGAGG - Intergenic
1094856204 12:34403967-34403989 GGCTGGCCCCAGTGGGCCTGGGG - Intergenic
1094856901 12:34406900-34406922 AGCTGGCACCCATGGGCCCCAGG - Intergenic
1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG + Intronic
1100439567 12:94603649-94603671 AGGTGGCACCAGGGAGCACTGGG + Intronic
1102967499 12:117139556-117139578 AGGTGGAACCACTGGCCCTGCGG + Intergenic
1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG + Exonic
1113799962 13:113081128-113081150 AGGTGGCACCTGTGAGACTGTGG + Intronic
1114416446 14:22547989-22548011 AGGTGGCAGGAGAGGGCACGTGG + Intergenic
1118001662 14:61528657-61528679 AGGTGGCCACTGTGTGCCCGGGG - Intronic
1118005689 14:61562637-61562659 TGGAGGCACCACAGGGCCCGTGG - Intronic
1119429234 14:74555183-74555205 AGGTGGAACGAGTGGGACCAGGG + Intronic
1119509080 14:75197081-75197103 AGGTGGCACCACAGGGACTGTGG - Intergenic
1121563570 14:94892510-94892532 AGGTGGCTTCAGTGAGCCTGAGG + Intergenic
1122736907 14:103848241-103848263 AGGTGGCACAGGTGGGCGCGGGG - Intergenic
1122800489 14:104226990-104227012 AGGTGGCCCCTGTGGGGCCTGGG + Intergenic
1123011534 14:105352163-105352185 AGGTGGAACCTGTGGGCCGAAGG + Intronic
1124249527 15:28097735-28097757 TGGTGGGATCAGTGGGCCCCTGG - Intronic
1124853734 15:33366707-33366729 AGGAGGAACCACTGGGCCCATGG + Intronic
1126574319 15:50182531-50182553 AGGTGGCCGCCGTGGGCCGGAGG + Exonic
1128248383 15:66148506-66148528 AGGTTGCCACAGTGGGCCTGGGG + Intronic
1128538202 15:68506283-68506305 TGGAGGCACCAGGGGGCCCTAGG + Intergenic
1130032636 15:80329363-80329385 AGGCTGCATCAGTGGACCCGTGG - Intergenic
1131658364 15:94485465-94485487 ACGTGTCACCTGTGGGCCTGGGG + Intergenic
1132457712 16:33323-33345 GGGTGGGATCAGAGGGCCCGTGG + Intergenic
1133857004 16:9559161-9559183 GGGTGGCATCAGTGGGGCTGAGG - Intergenic
1133944049 16:10333823-10333845 AAGAGGCACCAGTGGGACAGAGG - Intronic
1134023032 16:10934560-10934582 AGGTGGCAGCATTGGGCTCCTGG - Intronic
1134302028 16:13000559-13000581 AGGTGGCTCCAATGGCCCCAAGG + Intronic
1136016765 16:27405702-27405724 CGGTGGCACCTGTGAGCCAGGGG - Intronic
1136990331 16:35147919-35147941 AAAGGGCACAAGTGGGCCCGTGG - Intergenic
1139901183 16:70329788-70329810 AGGTGGCCCCAGGTGGCCCCGGG - Intronic
1140078597 16:71723823-71723845 CGGGGGCTCCAGCGGGCCCGCGG + Intronic
1140759724 16:78099889-78099911 AGGGGGCCGCAGTGGGGCCGCGG + Intronic
1141140629 16:81494595-81494617 AGGAGGCACCTGTGGGCATGGGG + Intronic
1142586536 17:978500-978522 TGGTGGCCCCTGTGGTCCCGGGG - Intronic
1144806520 17:17971864-17971886 AGGTGGCACCAGTGCCCGGGAGG + Intronic
1145907034 17:28521858-28521880 AGGTGGCCTCATTGGCCCCGTGG - Intronic
1147654438 17:42080796-42080818 AAGCTGCACCAGTGGGCCTGGGG - Intergenic
1147748039 17:42707898-42707920 AGTTGGCTCCAGTGTGCCCTAGG - Intronic
1148228941 17:45919247-45919269 AGGAGGCACCAGGGGCCCGGTGG - Intronic
1150916368 17:69441828-69441850 AGGTGCCAACAGAGGCCCCGTGG - Intronic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1152785547 17:82246140-82246162 AGGTGGCACCTGTCGGTCTGTGG - Intronic
1155130531 18:22930280-22930302 AGGTGGCAGCACTGGGCCTGAGG + Intronic
1156294464 18:35777221-35777243 AGGTGGCACCACTGGCCGCAAGG - Intergenic
1156399713 18:36729316-36729338 AGGTGGCACCTGGGGGCAGGTGG - Intronic
1158496457 18:57959504-57959526 AGCTGGCACCACGGGGCCTGTGG - Intergenic
1159964257 18:74580319-74580341 GGGTGGTACCCGTGGGACCGTGG + Intronic
1160328076 18:77968687-77968709 AAGTGACACCTGTGTGCCCGAGG + Intergenic
1161684405 19:5695859-5695881 AGGTGGCGCGAGTGGGCGCAGGG - Intronic
1161708329 19:5832840-5832862 AGGTGGGACCTGAGGGCCCTTGG - Intronic
1161725977 19:5929316-5929338 AGGCGGCCCCAGTGGGGCTGGGG - Intronic
1161775835 19:6261572-6261594 AGGTGTCACCACAGGGCCAGCGG - Intronic
1161794966 19:6381240-6381262 TGGAGGCACCAGTGGGCACCGGG - Intronic
1162774311 19:12969800-12969822 AGCTGGCACCAGTGGGGGCAGGG - Exonic
1163266118 19:16223546-16223568 AGCTGGCACCACAGGGCCTGGGG + Intronic
1163297414 19:16421265-16421287 GGGTGGCTCCAGGGGGCCTGTGG - Intronic
1163428944 19:17255399-17255421 AGGTGGCAGCAGCGGGGACGAGG - Exonic
1163836422 19:19577490-19577512 AGGTGACACCACAGGGCCCGAGG - Intronic
1164921123 19:32089369-32089391 AGATGGCTCCAGTGAGCCCAGGG + Intergenic
1165133233 19:33646402-33646424 AGGTGGCACCAGCTGGTCCATGG + Intronic
1166393877 19:42424863-42424885 AGGGGGCAGCACTGGGCCCCGGG + Intronic
1166686075 19:44797060-44797082 AGGTGTCACCATCAGGCCCGAGG - Intronic
1166766026 19:45252310-45252332 AGGTGGCATCTGGGGGCCCCGGG - Intronic
1166903634 19:46087283-46087305 AGGTGCCACCTGTGAGCCTGAGG - Intergenic
926299132 2:11589739-11589761 AGGTGGCAGCAGTGAGCTGGAGG + Intronic
927506809 2:23620225-23620247 AGGGGGCACCAGGAGGCCAGCGG + Intronic
930055548 2:47249475-47249497 AGGTGGCACCAATGGGCAGGAGG - Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
935254785 2:101300145-101300167 ATGTGGCTCCAGTGTGCCTGGGG - Intronic
938400664 2:130988236-130988258 AGGTGGCTCCTGTGAGCCTGGGG - Intronic
938405816 2:131032569-131032591 AAGTGGCAGCAGTGGCCCCAAGG - Intronic
938489846 2:131755698-131755720 AGGTACCACTAGCGGGCCCGAGG - Intronic
941421512 2:165287705-165287727 AGGTGTCCCCAGTGGGCAAGGGG - Intronic
944920341 2:204406137-204406159 AGGCTGCCCCAGTGGGCCTGGGG + Intergenic
945440059 2:209867651-209867673 AGTTGGCACAAGTGGGTCGGTGG - Intronic
946225726 2:218263165-218263187 AGTTGGCACCAGGGGTCCAGTGG - Exonic
947632587 2:231663603-231663625 AGGTGTCAACAGTGGGCACACGG - Intergenic
947987801 2:234463780-234463802 AGGTGGCATAAGTAGGCCCGTGG - Intergenic
948123233 2:235546267-235546289 AGGTGGCACCCGAGGGCCTGCGG - Intronic
948179537 2:235968762-235968784 AGGTGGCACGAGAGGGCCCTTGG + Intronic
948436630 2:237958141-237958163 AGGTGGCCCCAGTAGGACCCCGG + Intergenic
948975274 2:241459886-241459908 AGGTGCCACCAGTGGGTCACAGG - Intronic
948992643 2:241562582-241562604 AGATGGCACCGGTGGGCACTGGG - Intronic
1169226678 20:3861347-3861369 CGGTGGCTCCAGTGGGTCTGGGG - Exonic
1169662744 20:7998429-7998451 AGGTGGCAGCAGTGGGGATGTGG - Intronic
1171351489 20:24506443-24506465 TGGTGGCACCAGGGGGACTGTGG - Intronic
1173709820 20:45145005-45145027 AAGTGGCTCCAGTGTGCCTGAGG + Intergenic
1173908931 20:46649876-46649898 AGGTGACACCAGTGGTTCCAAGG - Intronic
1174637664 20:52016006-52016028 AGGTGGCCCTTGTGGGCCCTGGG - Intergenic
1175324571 20:58113954-58113976 AGCTGGCACATGTGAGCCCGTGG - Intergenic
1176053431 20:63132803-63132825 AGGTGGCACCTGGGGGCCTGTGG - Intergenic
1176075785 20:63247674-63247696 AGGTGCCAGCAGTGGGCCTCGGG - Exonic
1176169088 20:63689087-63689109 AGGTGGCGCCGGTGGACCCAGGG - Exonic
1180023147 21:45142027-45142049 AGGTGGCTACAGTGGCCCAGGGG - Intronic
1181593335 22:23897598-23897620 TGGTGGCACCAGGGGCCCCTCGG + Intronic
1183678225 22:39311699-39311721 AGGGTGCACCTGTGGGCTCGGGG - Intergenic
1183736635 22:39648259-39648281 AGGAGGCCCCAGGTGGCCCGTGG + Intronic
1185341783 22:50294220-50294242 GGAAGGCACCAGAGGGCCCGAGG - Intronic
1185418166 22:50721088-50721110 AGGTGGAACCCGAGGGCCCCAGG - Intergenic
951988768 3:28651778-28651800 AGGTGGCACAAGGTGGCCAGAGG + Intergenic
952255015 3:31687628-31687650 AGGTGGCACCTGGGAGCCTGAGG - Intronic
954371054 3:50169783-50169805 AGGTGGCATCAGTGGGGGCCAGG - Intronic
957096945 3:75785468-75785490 AAGAGGAACCCGTGGGCCCGGGG - Intronic
960974252 3:123159788-123159810 AGGTGGCACCTGGTGGCCAGGGG + Intronic
968817058 4:2827677-2827699 AGGTGGGGCGGGTGGGCCCGGGG + Intronic
969308592 4:6339477-6339499 GGGTGGCCCCTGTGTGCCCGTGG + Intronic
969604623 4:8196362-8196384 AGGTGGCACTGGTGGGGACGTGG + Intronic
972978275 4:44663889-44663911 AGGTGGCACCAGTAGTGCTGAGG - Intronic
977805888 4:101297478-101297500 AGGTGACAGAAGTGGGCCCAAGG + Intronic
980240417 4:130166743-130166765 AGGTGCCATCACTGGCCCCGAGG + Intergenic
980383518 4:132058141-132058163 AGGCTGCACCAGTGGGGCCCTGG - Intergenic
994043418 5:95283989-95284011 TGGTGGCACAAGTGCGCCCCGGG + Exonic
998039964 5:138945629-138945651 TGGGGGCAGCAGTGGGCCTGCGG - Intergenic
999251545 5:150185344-150185366 AGCTGGCACCAGAGCCCCCGGGG - Intergenic
1001234633 5:170019403-170019425 AGGTGGGACGGGTGGGCCCTGGG - Intronic
1001883861 5:175270817-175270839 AGATGGCTCCAGGGGGCCAGTGG + Intergenic
1002401360 5:178993223-178993245 AGCTGGCAGCAGCGGGCCCTGGG + Intronic
1002581483 5:180211799-180211821 AGGTGCCACCACTGGGCCCTGGG + Intergenic
1004936953 6:20517224-20517246 GACTGGCACCAGTGGGCCAGAGG - Intergenic
1006096461 6:31659560-31659582 AGGTGGCACCAGGAGACCAGGGG - Exonic
1006830486 6:36965014-36965036 AGGAGTCACCAGTGGGGCCTAGG + Intergenic
1008539808 6:52536846-52536868 AGGTGTCTCCAGAGGGCCCTTGG - Intronic
1009332859 6:62445623-62445645 TGGTGGCACCATGGGGCCAGGGG + Intergenic
1010044081 6:71420446-71420468 CGGTGGCACCGGCGGGCGCGGGG + Intergenic
1012450903 6:99351331-99351353 AGGAAGCAGCAGTGGGCCCCTGG - Intergenic
1017717805 6:157224437-157224459 AGGTGGCTCCGGTGGCCCCTGGG + Intergenic
1019345762 7:529985-530007 AGGAGCCACCAGTGTGGCCGCGG + Intergenic
1031718195 7:125134805-125134827 GTGTGGCTCCAGTGGGCCCAAGG + Intergenic
1032018731 7:128395057-128395079 GGGTGGCACTAGTGGGCTGGAGG - Intronic
1034359485 7:150481525-150481547 AGGCTGGACCAGTGGGCCCATGG - Intergenic
1035630700 8:1104715-1104737 AGGTGGCAGCCCTGGGCCCCGGG - Intergenic
1040286546 8:46103433-46103455 AGGTGGCACGGGTGGGCCAAAGG - Intergenic
1042416751 8:68528660-68528682 GGGTAGCACCAGTGTGCCCCTGG - Intronic
1045111591 8:98942209-98942231 AGGTGGCCCAGGAGGGCCCGCGG + Intronic
1047499856 8:125432188-125432210 AGGTGGCAGCAGCGAGCCCCGGG - Intronic
1048266981 8:132996028-132996050 AGGTGGCAGCTGTGGGGCAGTGG + Intronic
1049202137 8:141345655-141345677 AGGTGGCAGCAGGTGGCCTGCGG + Intergenic
1049249282 8:141579606-141579628 ACCTGGCACTAGTGGGCCCTCGG - Intergenic
1049444311 8:142623026-142623048 AGGTGGCAGCAGAGGTCCTGTGG + Intergenic
1049732571 8:144185963-144185985 AGGTGGCTGCACTGGGCACGCGG - Intronic
1051164945 9:14251663-14251685 AGGAGGCTCCAGTGGCCCCTCGG - Intronic
1053003251 9:34589441-34589463 AGGGGACACCCGTGGGCCCACGG - Intronic
1056488288 9:87081013-87081035 AGGTGGCCCCAGTGGGGCAGTGG - Intergenic
1056685757 9:88758076-88758098 AGGTGGAAGCAGTGGGGCAGAGG + Intergenic
1056773764 9:89497581-89497603 AGGTGGCTCCTCTGGGCGCGGGG - Intronic
1056937433 9:90927003-90927025 AGGTGGTAGCAGTCGGCCCTAGG + Intergenic
1057023350 9:91718168-91718190 AGCTGGCACCAATGGGCAGGAGG + Intronic
1057031084 9:91775622-91775644 AGGGGGCACCAAGGGGCCAGAGG + Intronic
1057806758 9:98225117-98225139 AGGTGGCCCCAGAGGGCCGCAGG + Intronic
1058705148 9:107631714-107631736 AGGTCTCACCAGGGGGCCCTTGG - Intergenic
1061214937 9:129216314-129216336 AGCGGGCACCAGTGCGCCCCGGG - Intergenic
1061402822 9:130377802-130377824 GCGTGGCGCCAGTGGGCCAGGGG + Intronic
1061430854 9:130529955-130529977 ACGTGGCACCAGGGGGCCACTGG - Intergenic
1061445333 9:130634224-130634246 AGGCAGCACCAGTGGGCTCCTGG - Intronic
1061934666 9:133850687-133850709 AGGTGACCCCAGTGGGCTCACGG - Intronic
1062170824 9:135133729-135133751 AGGTGGGAGCAGTGTGCACGGGG + Intergenic
1062502601 9:136857812-136857834 AGGGGGCCCCAGTGGGCTCAGGG + Intronic
1062541519 9:137043719-137043741 AGGTGGCACCCGAGGGCCTCAGG + Intronic
1062717958 9:138020646-138020668 AGGTGGAACCAGTGGGGCTGCGG + Intronic
1192795188 X:74420610-74420632 AGGTGGCACCAGTGGGGGCCGGG - Intergenic
1194467746 X:94254943-94254965 AGCTGGCACCAGGGTGCCCAGGG - Intergenic
1197702598 X:129610463-129610485 AGGTGGCCCCAGTGAGTCCTGGG - Intergenic
1200959787 Y:8986071-8986093 AGGTGGCAGCAGTGGGATCTTGG + Intergenic