ID: 1105024008

View in Genome Browser
Species Human (GRCh38)
Location 12:132836769-132836791
Sequence CGGGAAAGATTTCAAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105023998_1105024008 21 Left 1105023998 12:132836725-132836747 CCGTGAAAAGTGAGCGACAGAGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1105024008 12:132836769-132836791 CGGGAAAGATTTCAAGCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 122
1105024005_1105024008 -10 Left 1105024005 12:132836756-132836778 CCTGTTTGTGCCGCGGGAAAGAT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1105024008 12:132836769-132836791 CGGGAAAGATTTCAAGCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105024008 Original CRISPR CGGGAAAGATTTCAAGCCCA GGG Intronic