ID: 1105024569

View in Genome Browser
Species Human (GRCh38)
Location 12:132839536-132839558
Sequence GGAGGTCCTGAGTTAGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105024569_1105024581 22 Left 1105024569 12:132839536-132839558 CCCCGCACTAACTCAGGACCTCC 0: 2
1: 0
2: 3
3: 20
4: 84
Right 1105024581 12:132839581-132839603 AAATTTGCAACCTCCCCTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105024569 Original CRISPR GGAGGTCCTGAGTTAGTGCG GGG (reversed) Intronic
904568917 1:31445969-31445991 GGGGGTTCTGAGTTAGAGCCAGG + Intergenic
905592180 1:39173690-39173712 GAAGGTCCAGAGTTACTGAGGGG + Intronic
906677979 1:47707521-47707543 GGAGGTCCTGTCTTGGTGAGGGG + Intergenic
911969001 1:104406823-104406845 GGGGGGCCTGAGTGAGTGCTTGG + Intergenic
912488316 1:110046759-110046781 GGAGGTCCTCAGTCCGGGCGCGG + Intronic
917978259 1:180253887-180253909 GGAGCTCCTCAGTTAGTGGGGGG + Intronic
918405597 1:184208841-184208863 GGAGGTCCCGAGGTACTGAGGGG - Intergenic
920242328 1:204562309-204562331 GGAGGTCCTGGGCTACCGCGGGG + Intergenic
922449448 1:225725048-225725070 AGATGTCCTGAGTTAGGGTGAGG - Intergenic
923261132 1:232269080-232269102 GGAGGTCCTGAAGTAGTGAATGG - Intergenic
1062830665 10:603408-603430 AGAGGTCCTGAGTCAGTGTTAGG - Intronic
1063155554 10:3375999-3376021 TGAGGACCTGAGTTCCTGCGAGG - Intergenic
1065579016 10:27153093-27153115 GGAGGTCCTGAGTTAGGAAAGGG - Intronic
1070840804 10:79486705-79486727 GGCGGTACTGAGTGAGTGAGTGG + Intergenic
1071717657 10:88113527-88113549 GGAGGTCCTGAGTGGGTGAGAGG + Intergenic
1075621252 10:123929759-123929781 GCAGGTCCTGTCTTAGAGCGGGG + Intronic
1078266491 11:9759093-9759115 GGAGGTGCTGACAGAGTGCGGGG - Intergenic
1079071918 11:17354355-17354377 GGAGGTCCTGGGTGAGCGCTTGG + Intronic
1085453659 11:76654105-76654127 GGAGGTCCAGATTTTGTGCTCGG - Intergenic
1090334510 11:125953680-125953702 GGAGGTCCTGAGTGAGTGAGGGG + Intergenic
1096366125 12:51029794-51029816 TGAGGTCCGGAGGTAGTGGGTGG + Intergenic
1100382953 12:94078776-94078798 GGATTTCCTGAATTAGTGAGTGG - Intergenic
1102297668 12:111749365-111749387 GGTGGTTCTGAGTCAGTGCTGGG - Intronic
1103845093 12:123896302-123896324 GCTGGTCCTGAGTTACTCCGGGG - Intronic
1105024521 12:132839356-132839378 GGAGGTCCTGAGTTAGTGCGGGG - Intronic
1105024542 12:132839428-132839450 GGAGGTCCCAAGTTTGTGCAGGG - Intronic
1105024569 12:132839536-132839558 GGAGGTCCTGAGTTAGTGCGGGG - Intronic
1105024606 12:132839679-132839701 GGAAGTCTTGAGTTGGTGCAGGG - Intronic
1105024622 12:132839753-132839775 GGAGGTCCCAAGTTTGTGCATGG - Intronic
1105024631 12:132839790-132839812 GGAGGTCCCTAGTTAGTGCAGGG - Intronic
1105024641 12:132839827-132839849 GGAGATCCCGAGTTTGTGCAGGG - Intronic
1105024650 12:132839864-132839886 GGAGGTCCCAAGTTAGTGCAGGG - Intronic
1105024659 12:132839901-132839923 GGAGGTCCCAAGTTTGTGCAGGG - Intronic
1105024670 12:132839937-132839959 GGAGGTCCCGAGTTAGTGCAGGG - Intronic
1105024677 12:132839974-132839996 GGAGGTTCTGAGTTAGTGCAGGG - Intronic
1105024686 12:132840011-132840033 GGAGGTCCCGAGTTTGTGTAGGG - Intronic
1105024699 12:132840048-132840070 GGAGGTCCCGTGTTAGTGCAGGG - Intronic
1107580310 13:41776656-41776678 GGATGTCATGAGATAATGCGTGG - Intronic
1107812624 13:44215061-44215083 GGAGGTACTGAGCCAGTGTGGGG + Intergenic
1121485705 14:94312817-94312839 GGAGGTCCTGAGAGAGAGCTGGG + Intronic
1122871508 14:104641012-104641034 GGTGGTGCTGAGTGAGTGCAGGG - Intergenic
1132356363 15:101174132-101174154 GGAAGTCCTGAGCTGGTGCTGGG + Intergenic
1132850874 16:2024359-2024381 GGAGGTGCAGAGTCAGTGAGAGG - Intergenic
1132951080 16:2562832-2562854 GGAAGTCCAGAGTCAGTGCCAGG - Intronic
1132963269 16:2637338-2637360 GGAAGTCCAGAGTCAGTGCCAGG + Intergenic
1137743611 16:50804507-50804529 GCTGCTCCTGGGTTAGTGCGTGG + Intergenic
1137767580 16:50990059-50990081 GGAGATACTGAGTTAGTGCCAGG + Intergenic
1139589178 16:67923931-67923953 GGAGGTGCTGAGTTGATGTGAGG + Intronic
1149288428 17:55191744-55191766 GGATATCTTGAGTTAGTGCCTGG - Intergenic
1149837870 17:59930273-59930295 TGAGGTCCTGAGTGAGTGACTGG - Intronic
1150081416 17:62242954-62242976 TGAGGTCCTGAGTCAGTGACAGG + Intergenic
1152921191 17:83067406-83067428 GAAGGTCCTGAGGAACTGCGGGG + Intergenic
1155174420 18:23290169-23290191 GGAGGTGCTGAGGAAGTGCCAGG - Intronic
1156968716 18:43129226-43129248 GGAGGCCCTCAGTTACTGCCAGG + Intergenic
1159863296 18:73674471-73674493 GGAGGTGCTGGGTTGGTGGGAGG + Intergenic
1159995436 18:74960244-74960266 GAAGGTCCTGAGTGAGTGCTTGG + Intronic
1159995443 18:74960280-74960302 GAAGGTCCTGAGTGAGTGCTTGG + Intronic
1159995450 18:74960316-74960338 GAAGGTCCTGAGTGAGTGCTTGG + Intronic
1159995457 18:74960352-74960374 GAAGGTCCTGAGTGAGTGCTTGG + Intronic
1159995481 18:74960460-74960482 GAAGGTCCTGAGTCAGTGCTTGG + Intronic
1159995487 18:74960496-74960518 GAAGGTCCTGAGTCAGTGCTTGG + Intronic
1159995494 18:74960532-74960554 GAAGGTCCTGAGTCAGTGCTTGG + Intronic
1159995511 18:74960604-74960626 GAAGGTCTTGAGTCAGTGCTGGG + Intronic
1159995518 18:74960640-74960662 GAAGGTCCTGAGTCAGTGCTGGG + Intronic
1159995526 18:74960676-74960698 GAAGGTCCTGAGTCAGTGCTGGG + Intronic
1159995549 18:74960784-74960806 GAAGGTCCTGAGTGAGTGCTTGG + Intronic
1159995557 18:74960820-74960842 GAAGGTCCTGAGTCAGTGCTGGG + Intronic
1159995564 18:74960856-74960878 GAAAGTCCTGAGTCAGTGCTGGG + Intronic
1165353712 19:35291304-35291326 AGAGCTCCTGGGTTAGTGGGAGG + Intergenic
1167353979 19:48992362-48992384 GGAAGTCCTAAGTTAGTCAGAGG - Intronic
926097414 2:10091230-10091252 GAAGGTACTGAGGTAGTGAGAGG + Intergenic
928296281 2:30086937-30086959 GGAGCTACTGAGTCAGTGCTGGG + Intergenic
937483644 2:122290959-122290981 GGAAGACCTGAGTTAGTGAGGGG + Intergenic
937836181 2:126472179-126472201 GGAGCTCCTGAGTCAGAGCCTGG - Intergenic
939607035 2:144265739-144265761 GGAGGTCCTCAGTTAGAGAAGGG - Intronic
946064346 2:216973913-216973935 GGAAGTCCTGAGTAAGTGAGTGG - Intergenic
1170150564 20:13221969-13221991 GGGGGTGCTGAGCTAGTGCCGGG + Intronic
1175317490 20:58059230-58059252 GGAGAGCCTGAGTGAGTGTGGGG - Intergenic
1185136854 22:49078240-49078262 GGAGGTCCTGAGTGGGCGAGTGG + Intergenic
950419849 3:12892473-12892495 GGAGGTCCTGGGTGGGTGCCAGG - Intergenic
952883199 3:37998135-37998157 GCAGGTCCTGGGTCAGTGGGGGG - Exonic
955710331 3:61772156-61772178 GGAAGTCCTGAGTTTGTCCCTGG - Intronic
966739763 3:183221696-183221718 TGAGGCCCTGAGTGAGTGCTGGG + Intronic
969090679 4:4691868-4691890 GGAGGTCCTGAGGCACTGCTGGG - Intergenic
975584125 4:75933375-75933397 GGAGGTCCTCAGTAAGTCTGAGG - Intronic
982475929 4:155850431-155850453 GGAAGTCCTGAGGTAGTCCGGGG - Intronic
983807114 4:172008490-172008512 GGAGGTACTGAGTTGGGGCAAGG - Intronic
998135647 5:139673018-139673040 GGAGGTCCTGAGGGGGTACGTGG + Intronic
1004431573 6:15549630-15549652 GGAGGCCCAGAGTTGCTGCGGGG - Intronic
1006921046 6:37627369-37627391 GGAGGTCCTGAGTGGGGGCTGGG - Intergenic
1016877408 6:148878145-148878167 GGGGGTCGTGTGTGAGTGCGGGG + Intronic
1016986813 6:149901344-149901366 GGAGGTGCAGGGTTAGTGCAGGG + Intergenic
1018394765 6:163369835-163369857 GGAGGCCTTGAGAGAGTGCGTGG - Intergenic
1020102364 7:5401351-5401373 GGAGGACCTGATTCAGGGCGAGG - Intronic
1021080433 7:16357877-16357899 GGTGGGCCAGAGTTGGTGCGTGG + Intronic
1023025018 7:36042329-36042351 GGAAGTCCTGAGATGGTGAGGGG + Intergenic
1034284228 7:149873880-149873902 GCAGGTCCTGAGTGACAGCGCGG + Exonic
1042750693 8:72154495-72154517 CGACGTCCTCAGTCAGTGCGAGG - Intergenic
1042750696 8:72154531-72154553 CGAGATCCTCAGTCAGTGCGAGG - Intergenic
1042750702 8:72154603-72154625 AGAGATCCTCAGTCAGTGCGAGG - Intergenic
1042750705 8:72154639-72154661 CGAGATCCTCAGTCAGTGCGAGG - Intergenic
1044738378 8:95301682-95301704 GGAGGCCCTGAGTTTGGGGGTGG - Intergenic
1048107028 8:131422116-131422138 GCATGTCCTGAGTGAGTGCAGGG + Intergenic
1050195093 9:3074625-3074647 GGTGATCCTGAGCTAGTGTGTGG - Intergenic
1060496781 9:124125222-124125244 TGAGGTCGTGAGTGACTGCGTGG - Intergenic
1186025785 X:5309554-5309576 GGAGGCCCTGAGTTAGGGAATGG + Intergenic
1189645435 X:43124202-43124224 GAAGGTCTTGACTTAGTGCTGGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic