ID: 1105024613

View in Genome Browser
Species Human (GRCh38)
Location 12:132839715-132839737
Sequence GAGTTTGCACGTTTGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105024613_1105024623 23 Left 1105024613 12:132839715-132839737 CCCCTGCACAAACGTGCAAACTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1105024623 12:132839761-132839783 AAACTTGGGACCTCCCTTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 122
1105024613_1105024621 9 Left 1105024613 12:132839715-132839737 CCCCTGCACAAACGTGCAAACTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1105024621 12:132839747-132839769 CTTCATCCATGCACAAACTTGGG 0: 1
1: 0
2: 1
3: 13
4: 150
1105024613_1105024620 8 Left 1105024613 12:132839715-132839737 CCCCTGCACAAACGTGCAAACTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1105024620 12:132839746-132839768 GCTTCATCCATGCACAAACTTGG 0: 1
1: 1
2: 0
3: 19
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105024613 Original CRISPR GAGTTTGCACGTTTGTGCAG GGG (reversed) Intronic
900936051 1:5766816-5766838 GAGATAGCAAGTTTGGGCAGAGG - Intergenic
900943894 1:5818631-5818653 GAGTTTGTGAGTTTGTGCAGGGG - Intergenic
902141379 1:14359544-14359566 AATTTGGCACGTTTTTGCAGTGG + Intergenic
903159560 1:21476381-21476403 AATTTGGCACGTTTTTGCAGTGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
907834605 1:58097209-58097231 CAGTTTCCACATTTGTGAAGTGG - Intronic
908726270 1:67180728-67180750 AATTTGGCACGTTTTTGCAGTGG + Intronic
908821470 1:68091702-68091724 CAATTTGCATGTTTTTGCAGTGG + Intergenic
910615558 1:89194208-89194230 GAGTATGCATGTTGGTGAAGTGG + Intronic
910618654 1:89228886-89228908 GATTTGGCAAGTTTTTGCAGTGG + Intergenic
911128810 1:94368377-94368399 AAGTTGGCATGTTTTTGCAGTGG + Intergenic
913360062 1:117970540-117970562 GGGTTTGCATGTTTGAGGAGAGG + Intronic
913467209 1:119155381-119155403 AATTTTGCATGTTTTTGCAGTGG + Intergenic
913721621 1:121602299-121602321 GATTTGGCATGTTTTTGCAGTGG + Intergenic
917914502 1:179688153-179688175 AATTTGGCACGTTTTTGCAGTGG + Intronic
918636260 1:186778298-186778320 GAGTTTCCAAGTTTGTGGAAAGG + Intergenic
1062988794 10:1795760-1795782 GAGTGTGCATGTTTGTGTAGGGG - Intergenic
1064646807 10:17467949-17467971 GATTTTGCACCTGTGTTCAGAGG + Intergenic
1064792270 10:18971273-18971295 AATTTGGCATGTTTGTGCAGTGG - Intergenic
1065856019 10:29830948-29830970 GAGTTTGGTTGTTTGTGCTGGGG - Intergenic
1068576056 10:58685973-58685995 AATTTGGCACGTTTCTGCAGTGG + Intronic
1068955900 10:62818459-62818481 GACTTTGCACATTTTTGCTGGGG - Intronic
1072477415 10:95776247-95776269 GATTTGGCATGTTTTTGCAGTGG + Intronic
1074072021 10:110081107-110081129 GAGTTTGTATGTTTGTGTGGTGG + Intronic
1076516654 10:131049049-131049071 GAGTCTTCACTTTTGAGCAGAGG - Intergenic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1076830082 10:132989703-132989725 GTGGTGGCACGTCTGTGCAGAGG - Intergenic
1078655843 11:13238417-13238439 CAGTTTGCTCATTTGTGAAGTGG - Intergenic
1080816067 11:35758608-35758630 GATTTGGCATGTTTTTGCAGTGG + Intronic
1082137434 11:48565687-48565709 AATTTGGCACGTTTTTGCAGTGG + Intergenic
1082286943 11:50328216-50328238 AATTTTGCATGTTTTTGCAGTGG + Intergenic
1082568739 11:54712675-54712697 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1083501497 11:63113362-63113384 AAGTTAGCATGTTTTTGCAGTGG + Intronic
1087504154 11:98998460-98998482 CAATTTGCATGTTTTTGCAGTGG - Intergenic
1088320975 11:108554401-108554423 TAGTTTGCACATTTGTAAAGTGG + Intronic
1088790974 11:113225965-113225987 GATTTGGCATGTTTTTGCAGTGG - Intronic
1089101839 11:115968957-115968979 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1089832514 11:121341076-121341098 GAGCTTGTATGTGTGTGCAGTGG - Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092327726 12:7551212-7551234 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1092835448 12:12483731-12483753 GAGTTTGCCCGTTTGTGCTATGG - Intronic
1092976119 12:13746503-13746525 GAGAATGCACATCTGTGCAGGGG - Intronic
1093712471 12:22342751-22342773 AATTTGGCACGTTTTTGCAGTGG - Intronic
1094791315 12:33919009-33919031 CACTTTGCATGTTTTTGCAGTGG + Intergenic
1095424969 12:42064991-42065013 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1096994048 12:55828093-55828115 GATTTTTCACGTGTGTCCAGCGG - Exonic
1099442043 12:82710793-82710815 CAGTTTGCACATCTGTGAAGAGG + Intronic
1099849329 12:88072610-88072632 GAGGTTGGTCGTTTGTACAGAGG - Intronic
1100816663 12:98393412-98393434 GAGATTTCACGTTTCTGCATAGG - Intergenic
1101313908 12:103611795-103611817 GATTTGGCATGTTTTTGCAGTGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1105024530 12:132839392-132839414 GAGGTTGCAAGTTTGTGCAGGGG - Intronic
1105024541 12:132839427-132839449 GAGGTCCCAAGTTTGTGCAGGGG - Intronic
1105024578 12:132839572-132839594 GAGGTTGCAAATTTGTGCAGGGG - Intronic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1105024658 12:132839900-132839922 GAGGTCCCAAGTTTGTGCAGGGG - Intronic
1107606445 13:42062178-42062200 GAGTTTGCATGACTGTACAGAGG - Intronic
1107663014 13:42658780-42658802 GGGTCTGCAAGTTTGAGCAGAGG - Intergenic
1108042766 13:46354820-46354842 GTGTCTGCACTTTTGTACAGTGG - Intronic
1109989059 13:70029636-70029658 GATTTGGCATGTTTTTGCAGTGG - Intronic
1113348594 13:109506388-109506410 AATTTGGCATGTTTGTGCAGTGG + Intergenic
1117243472 14:53859701-53859723 AAATTTGCCCATTTGTGCAGTGG - Intergenic
1118676082 14:68185904-68185926 GAGTTTTTAGATTTGTGCAGGGG - Intronic
1121287449 14:92747594-92747616 GAGTATACACGTGTGTACAGGGG - Intronic
1123127605 14:105960230-105960252 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1125421933 15:39512681-39512703 GAGTTGGCACCTTTCTGCTGTGG - Intergenic
1127017110 15:54700841-54700863 AATTTGGCATGTTTGTGCAGTGG - Intergenic
1127168260 15:56270743-56270765 AATTTGGCACGTTTTTGCAGTGG + Intronic
1127580236 15:60331796-60331818 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1128416580 15:67452333-67452355 GATTTGGCATGTTTTTGCAGTGG + Intronic
1130729517 15:86476113-86476135 AATTTAGCACGTTTTTGCAGTGG - Intronic
1130737319 15:86564239-86564261 AATTTGGCACGTTTTTGCAGTGG + Intronic
1132162437 15:99555767-99555789 GAGTTTGCTGGTGTGTGCAGTGG + Intergenic
1132442654 15:101884331-101884353 GATTTGGTATGTTTGTGCAGTGG + Intergenic
1137907253 16:52335426-52335448 AATTTGGCATGTTTGTGCAGTGG - Intergenic
1141322293 16:83022780-83022802 GAGTTTGCATGTATTTGTAGAGG - Intronic
1141990588 16:87607146-87607168 GGGTTTGCCCGTCTGTGCATGGG - Intronic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142935128 17:3323466-3323488 AATTTGGCACGTTTTTGCAGTGG + Intergenic
1143484556 17:7246513-7246535 GAGTTTGGAGGTTTGGGCTGGGG - Intronic
1148285188 17:46383355-46383377 GAGTTAGCATGTGTGTCCAGAGG + Intergenic
1148307351 17:46600951-46600973 GAGTTAGCATGTGTGTCCAGAGG + Intronic
1149901764 17:60486802-60486824 AATTTTGCATGTTTTTGCAGTGG + Intronic
1150593002 17:66579536-66579558 CAGTTTTCACATGTGTGCAGTGG - Intronic
1151283953 17:73096443-73096465 CAGTTTGCATGTTTGCGGAGTGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859975 17:82690869-82690891 GAGTGTGCACGTTTGCCCCGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154405550 18:14086658-14086680 GGGTTTGCACGTTTCTGCCTGGG - Intronic
1156725108 18:40118169-40118191 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1158026854 18:52909019-52909041 GAGTTTGCAAGTTGGTTTAGAGG + Intronic
1159523650 18:69559736-69559758 GAGTTTGCAAGTTTGAGATGAGG + Intronic
1159570047 18:70102680-70102702 AAGTTGGCATGTTTTTGCAGTGG + Intronic
1164429497 19:28174847-28174869 AAGTTTCCTTGTTTGTGCAGAGG - Intergenic
1164835558 19:31353016-31353038 GATTTTACCCGTTTGTGTAGTGG - Intergenic
925461881 2:4070312-4070334 GAGTGTGCACATTTGTGCTTGGG + Intergenic
925480334 2:4263511-4263533 GATTCTGCAGGTTTGTCCAGGGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928765221 2:34637344-34637366 CAGTTGGCATGTTTTTGCAGTGG - Intergenic
928915360 2:36464681-36464703 GAGAGTGTACATTTGTGCAGAGG + Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
930863070 2:56094576-56094598 AAGTTGGCATGTTTTTGCAGTGG - Intergenic
931477827 2:62607254-62607276 GATTTGGCATGTTTTTGCAGTGG - Intergenic
931542677 2:63346727-63346749 GAATTTGCAGGTTTGTGTACTGG - Intronic
932301736 2:70672299-70672321 GAGTTTTCACGTCTCTCCAGGGG - Intronic
933074878 2:77911098-77911120 GAGTGTGCACTTCTTTGCAGAGG + Intergenic
933897434 2:86824548-86824570 TGGGTTGCAGGTTTGTGCAGGGG - Intronic
934948294 2:98558034-98558056 GAATTTGCATGTGTGTACAGAGG + Intronic
935540393 2:104341128-104341150 GAGGTTGCAGGTTAGTTCAGAGG + Intergenic
935843833 2:107143380-107143402 AATTTGGCATGTTTGTGCAGTGG + Intergenic
939074696 2:137586444-137586466 AATTTGGCATGTTTGTGCAGTGG + Intronic
940702975 2:157069637-157069659 AAGTTGGCATGTTTTTGCAGTGG - Intergenic
940849712 2:158676516-158676538 GACTTTGCTGATTTGTGCAGTGG + Intronic
942107790 2:172650366-172650388 AAGTTGGCATGTTTTTGCAGTGG - Intergenic
945715114 2:213348486-213348508 AAGTTGGCATGTTTTTGCAGTGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
1169331051 20:4716867-4716889 GAGTTTTCTCATCTGTGCAGGGG - Intergenic
1173865761 20:46311768-46311790 GAGCCTGCAGGTTTGAGCAGGGG + Intergenic
1175026454 20:55907644-55907666 GAGTTTCCTCGTTTGTAGAGTGG - Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1177321285 21:19524387-19524409 GAGTTTGCATGTGTGGGGAGTGG + Intergenic
1180983920 22:19893038-19893060 GAGGCTTCACTTTTGTGCAGTGG - Intronic
1181445425 22:22969046-22969068 CAGTTGGCATGTTTTTGCAGTGG - Intergenic
951479894 3:23148967-23148989 GAGTGTGCATGTCTGTGCACAGG + Intergenic
951526530 3:23658009-23658031 GAATTTGCCCATTTCTGCAGAGG + Intergenic
955269138 3:57478957-57478979 AATTTGGCACGTTTTTGCAGTGG - Intronic
956268973 3:67429482-67429504 AACTTGGCACGTTTTTGCAGTGG - Intronic
957108551 3:75923804-75923826 GAGTTTGCACATGTGTGCACTGG + Intronic
958081292 3:88748933-88748955 AATTTTGCACGTTTTTGCAGTGG - Intergenic
958423219 3:93951628-93951650 GATTTGGCATGTTTTTGCAGTGG - Intronic
963659805 3:148111191-148111213 GTGTTTGCAAGGTTGTGAAGAGG + Intergenic
964842927 3:161014131-161014153 AATTTTGCATGTTTTTGCAGTGG + Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
973679347 4:53299981-53300003 AATTTTGCATGTTTTTGCAGTGG - Intronic
976837446 4:89391227-89391249 GATTTGGCATGTTTTTGCAGTGG - Intergenic
977713055 4:100149359-100149381 GAGTGTGCATGTTTGTGCATAGG + Intergenic
979406957 4:120324806-120324828 CAGTTTGCACGTTTGTAAAATGG + Intergenic
982036565 4:151352033-151352055 GAGTTTACAGCTTAGTGCAGAGG + Intergenic
983231614 4:165134780-165134802 GACTTTGCATGTGTGTGCATGGG + Intronic
990141303 5:52707255-52707277 GAGGATGCATGTTTGTGTAGAGG - Intergenic
990163933 5:52974718-52974740 AAGTTGGCATGTTTTTGCAGTGG + Intergenic
990678819 5:58217917-58217939 AATTTGGCACGTTTTTGCAGTGG - Intergenic
991148050 5:63330579-63330601 GATTTGGCACGTTTTTGCAGTGG - Intergenic
991454570 5:66788715-66788737 GAGGTTGGACGTCTCTGCAGAGG - Exonic
992051435 5:72944380-72944402 CAGTTTGCACGTCTGTAAAGTGG - Intergenic
993124951 5:83822499-83822521 GAGATTGAACCTCTGTGCAGTGG + Intergenic
994137749 5:96307560-96307582 AATTTGGCATGTTTGTGCAGTGG + Intergenic
995500971 5:112806624-112806646 GAGATTGCACCACTGTGCAGTGG - Intronic
1001944890 5:175770693-175770715 CAGGGTGCACGTTTGTGCACAGG - Intergenic
1005182666 6:23124158-23124180 AATTTTGCATGTTTTTGCAGTGG + Intergenic
1005193713 6:23258391-23258413 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007740369 6:44006114-44006136 GAGTTCATACGTTTGTGAAGTGG - Intergenic
1008566603 6:52775339-52775361 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1009263127 6:61521268-61521290 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1009282630 6:61771219-61771241 GATTTGGCATGTTTTTGCAGTGG - Intronic
1009322955 6:62314067-62314089 AATTTGGCACGTTTTTGCAGAGG - Intergenic
1014423127 6:121269145-121269167 AAGTTGGCATGTTTTTGCAGTGG - Intronic
1014461816 6:121704946-121704968 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1015430146 6:133121763-133121785 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1016255292 6:142097281-142097303 AATTTTGCATGTTTTTGCAGTGG + Intergenic
1016552899 6:145301689-145301711 CAATTTGCATGTTTTTGCAGTGG + Intergenic
1017226735 6:152030174-152030196 CAATTTGCATGTTTTTGCAGTGG - Intronic
1017701313 6:157075143-157075165 GAGTTTTCATTTTTGTACAGGGG - Intronic
1018114144 6:160566524-160566546 AATTTGGCATGTTTGTGCAGTGG - Intronic
1018167379 6:161110930-161110952 GTGTTTGCACGTTTGTTCCGTGG + Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1019015684 6:168878230-168878252 GAGTTTGCAGCTTAGTGGAGAGG - Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1021187878 7:17586324-17586346 AAGCTTGCACATTTGTCCAGAGG + Intergenic
1021306447 7:19038332-19038354 CAATTTGCATGTTTTTGCAGTGG + Intronic
1022453779 7:30539508-30539530 AATTTTGCATGTTTTTGCAGTGG - Intronic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1025594974 7:62912982-62913004 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1027540613 7:79459516-79459538 GATTTTTCATGTTTATGCAGTGG + Intergenic
1028050241 7:86175948-86175970 GATTTGGCAAGTTTTTGCAGTGG - Intergenic
1028229497 7:88289474-88289496 GAGTTTGCACCTTTTTCCTGGGG + Intronic
1028420057 7:90622587-90622609 GAGATTGCACATTAGTGCATTGG + Intronic
1029006341 7:97214147-97214169 AATTTTGCATGTTTTTGCAGTGG + Intergenic
1032459559 7:132100480-132100502 GAGTTTATATGTGTGTGCAGGGG + Intergenic
1033106893 7:138535324-138535346 GATTTGGCATGTTTTTGCAGTGG + Intronic
1033887722 7:145968573-145968595 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1034642601 7:152616318-152616340 TATTTTGCAACTTTGTGCAGAGG + Intergenic
1035882044 8:3253983-3254005 AATTTTGCATGTTTTTGCAGTGG + Intronic
1036711323 8:11080895-11080917 CAGTTTTCACGTGTGTACAGTGG - Intronic
1039103475 8:33965827-33965849 AATTTGGCACGTTTTTGCAGTGG + Intergenic
1039154280 8:34537434-34537456 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1041087640 8:54271586-54271608 AAGTTTGCAGGGATGTGCAGTGG - Intergenic
1041842852 8:62292344-62292366 AATTTTGCATGTTTTTGCAGTGG + Intronic
1043140530 8:76583360-76583382 CATTTTGCACCTTTGTGCTGGGG - Intergenic
1044146723 8:88725125-88725147 GAATGTGCATGTTTTTGCAGGGG + Intergenic
1044195903 8:89375934-89375956 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1045097003 8:98808423-98808445 CAGTTTGCAAGTTTGTGGACAGG + Intronic
1046654669 8:116880319-116880341 GAGTTTTAACGTTTGAGCTGAGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1050407866 9:5328965-5328987 CATTTGGCACGTTTTTGCAGTGG - Intergenic
1050509163 9:6376207-6376229 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1050954089 9:11633089-11633111 TAGTTTACACATTTTTGCAGTGG + Intergenic
1052098246 9:24410473-24410495 AAGTTGGCATGTTTTTGCAGTGG - Intergenic
1052328383 9:27241390-27241412 GATTTGGCATGTTTTTGCAGTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053041835 9:34880233-34880255 AATTTGGCACGTTTTTGCAGTGG - Intergenic
1055873535 9:80915536-80915558 GATTTAGCATGTTTTTGCAGTGG + Intergenic
1057175742 9:92997582-92997604 AATTTGGCACGTTTTTGCAGTGG + Intronic
1058215605 9:102229830-102229852 GAGCTTGCAAGATTCTGCAGCGG - Intergenic
1059601137 9:115780633-115780655 GAGATTGAATGTTTTTGCAGGGG - Intergenic
1062205970 9:135337559-135337581 GTGTATGCACATGTGTGCAGGGG + Intergenic
1186678698 X:11848544-11848566 GAGTCTGCATGTATGTGCAAAGG - Intergenic
1187038904 X:15572231-15572253 GAGATGTCACATTTGTGCAGAGG + Exonic
1188334253 X:28909802-28909824 GAGTTTGCAAATTTGCGAAGGGG - Intronic
1188868360 X:35342828-35342850 GAGTTTGAACGTTTCTTCAAAGG + Intergenic
1189176721 X:38964729-38964751 GAGTTTGCAGCTCTGTGCTGTGG - Intergenic
1189502758 X:41579068-41579090 GAGTTGGCAAATTTGTGCTGGGG + Intronic
1192532488 X:71901180-71901202 AATTTGGCACGTTTTTGCAGTGG + Intergenic
1193082822 X:77422613-77422635 GAGTTTGCAGGTGTGGGCAGAGG - Intergenic
1193419710 X:81269325-81269347 AATTTGGCACGTTTTTGCAGTGG + Intronic
1194978578 X:100417037-100417059 GAGTTTGCATATTGGTGCACTGG + Intergenic
1195000854 X:100641940-100641962 GAGTGAACACGTCTGTGCAGAGG + Intergenic
1198651211 X:138865583-138865605 GAGTATGTACTCTTGTGCAGTGG + Intronic
1199636922 X:149822935-149822957 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1201778613 Y:17694181-17694203 TAATTTGCATGTTTTTGCAGTGG + Intergenic
1201822943 Y:18211811-18211833 TAATTTGCATGTTTTTGCAGTGG - Intergenic
1201988107 Y:19991972-19991994 GATTTGGCATGTTTTTGCAGTGG + Intergenic
1202026603 Y:20530213-20530235 AATTTTGCATGTTTTTGCAGTGG - Intergenic