ID: 1105024993

View in Genome Browser
Species Human (GRCh38)
Location 12:132842250-132842272
Sequence CAGTCTGTGGAGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105024993_1105025002 -1 Left 1105024993 12:132842250-132842272 CCACCTTCCCTCTCCACAGACTG 0: 1
1: 0
2: 5
3: 61
4: 590
Right 1105025002 12:132842272-132842294 GTGGGCAAGGAGGACCAGCATGG 0: 1
1: 0
2: 3
3: 31
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105024993 Original CRISPR CAGTCTGTGGAGAGGGAAGG TGG (reversed) Intronic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900615389 1:3563376-3563398 TGGTCTGTGGACAGGGCAGGTGG - Intronic
900626074 1:3609238-3609260 CACTCTGTGGAGCAGAAAGGAGG - Intronic
900880970 1:5381103-5381125 CAGGCTGTGGAGACTGCAGGGGG - Intergenic
900887120 1:5423049-5423071 CAGTTTGTGGAGAGGGTAAGAGG - Intergenic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901877455 1:12175096-12175118 CGGGCTGTGGACAGGGAGGGGGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902140677 1:14351065-14351087 CACTCTGCGGAGAGGGACTGGGG - Intergenic
903141231 1:21340320-21340342 CAGTCAGTGAAGACAGAAGGAGG - Intronic
903239016 1:21970194-21970216 GAAACTGCGGAGAGGGAAGGTGG - Intergenic
903242925 1:21995870-21995892 GAAACTGCGGAGAGGGAAGGTGG - Intronic
903856096 1:26338258-26338280 CAGTCTGTGGGAAGGGATGGGGG - Intronic
904477608 1:30775111-30775133 CAGCCTGGGGTGAGGGAATGGGG + Intergenic
905261030 1:36719429-36719451 CAGTCTCTTGTGAGGGAATGTGG - Intergenic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906139078 1:43522714-43522736 AAGAATGGGGAGAGGGAAGGGGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906453335 1:45971510-45971532 CAGTCAGTGGTGTGGGAACGTGG - Intronic
906677454 1:47703312-47703334 CTCTCTGTGGAGGGGCAAGGAGG - Intergenic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907572965 1:55500763-55500785 TAGTCTGGGGAGATGGAAGTTGG + Intergenic
907715728 1:56924238-56924260 CAGGAGGTGGTGAGGGAAGGAGG + Intergenic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908251796 1:62271683-62271705 AGGTGTGTGGAGAGGTAAGGAGG + Intronic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909765604 1:79352414-79352436 CGGTCAGTCAAGAGGGAAGGGGG + Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911365655 1:96934529-96934551 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
911631834 1:100192159-100192181 AAGACAGTGTAGAGGGAAGGGGG + Exonic
912408118 1:109459463-109459485 CAGGAAGTGGAAAGGGAAGGAGG - Intergenic
913209295 1:116570158-116570180 CAATGTGTGGAGGGTGAAGGAGG + Intronic
913577994 1:120196845-120196867 CAGTGGGTGGAGAGAGAATGGGG + Intergenic
913630176 1:120701507-120701529 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
914024234 1:143897983-143898005 CAGCCAGTGGAGAGGGTAAGAGG + Intergenic
914559910 1:148808265-148808287 CAGTGGGTGGAGAGAGAATGGGG + Intronic
914612923 1:149321950-149321972 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
914662727 1:149806010-149806032 CAGCCAGTGGAGAGGGTAAGAGG + Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914904770 1:151734834-151734856 CAGTCGTTGGAGGGGGAAGCAGG + Intergenic
915079664 1:153343414-153343436 CAGCCTCTGAAAAGGGAAGGGGG - Intronic
915213520 1:154326210-154326232 CTGTCCTTGGTGAGGGAAGGTGG + Intronic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915804581 1:158831007-158831029 CACTCTGTGAACAGGAAAGGAGG + Intergenic
915819739 1:159009481-159009503 CACTCTGTGCACAGGAAAGGAGG + Intronic
915936289 1:160092052-160092074 CAGGCTGTGGGCAGGGATGGGGG - Intronic
917480362 1:175406566-175406588 CAGTCAGTGGAGGAGGAGGGAGG - Exonic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919565582 1:199181342-199181364 CAGTCTTGTGAGTGGGAAGGTGG - Intergenic
920570905 1:207016555-207016577 CAGAGTGTGGATTGGGAAGGAGG + Intronic
921286957 1:213617395-213617417 CTGGTTGTGGAGATGGAAGGAGG + Intergenic
921939638 1:220826840-220826862 CAGCCTGTGGTGAGCGAATGTGG + Intergenic
922073527 1:222219981-222220003 AAGTGTGTTGAGAGAGAAGGTGG - Intergenic
922085897 1:222346579-222346601 AAGTCAGTGGAGAGTGAATGTGG + Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922484429 1:225962388-225962410 CAGGCTGTAGCGGGGGAAGGAGG + Intergenic
924428348 1:243974429-243974451 CTCGCTTTGGAGAGGGAAGGAGG + Intergenic
924688816 1:246325008-246325030 GAGTCGGGGGAGCGGGAAGGAGG + Intronic
1062899759 10:1134261-1134283 GAGTCTGTGGAGTGGGGGGGGGG - Intergenic
1062967927 10:1624456-1624478 CAGCCGGTGGGGAGGCAAGGTGG - Intronic
1063001855 10:1932235-1932257 CTATCTGTAGAGAGGGAGGGAGG + Intergenic
1063565608 10:7170580-7170602 GAGTCGGTGGAGATGGCAGGGGG + Intronic
1064100325 10:12458065-12458087 CAGGTGGTGGAGAGTGAAGGTGG + Intronic
1064425016 10:15222842-15222864 CAGCCTGTGGCGTGGGAAGGGGG - Intronic
1064955626 10:20905553-20905575 CCGTATGTGTTGAGGGAAGGAGG - Intronic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065361613 10:24894470-24894492 CAGGCTCTGGACAGGCAAGGTGG + Intronic
1065591755 10:27269484-27269506 AAGTCGGTGGAGAAGGAATGGGG - Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1067054446 10:43042810-43042832 CAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1067308108 10:45085222-45085244 CAGTCTCTGGAAAGTTAAGGAGG + Intergenic
1067941635 10:50661598-50661620 CCATGTGTGGAGAGGGAATGAGG - Intergenic
1068922967 10:62504361-62504383 AATTTTGTGGAGAGGGAAGAGGG - Intronic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1069942478 10:71964788-71964810 CAGACTTTGGAGGGAGAAGGGGG + Intronic
1069965175 10:72109357-72109379 CAGTCAGTGGAGAGGGGACTTGG - Intronic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070862872 10:79686557-79686579 CCATGTGTGGAGAGGGAATGGGG - Intergenic
1071007106 10:80895434-80895456 CAGTCTGTGGAACGGGAGGTAGG - Intergenic
1071362767 10:84866621-84866643 AGCTCTGTGGAGAGGGAGGGAGG + Intergenic
1073345676 10:102781257-102781279 ATGACTGTGGAGAGGGAAGGGGG + Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074224356 10:111469211-111469233 AAGTCTCTTGAGAGTGAAGGTGG - Intergenic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1074778848 10:116785878-116785900 CAGTCTAAGGTGAGGGGAGGGGG - Intergenic
1075626143 10:123965742-123965764 CTGTCTGTAGATGGGGAAGGAGG + Intergenic
1076076384 10:127537178-127537200 CTGTCTCTGGAGCAGGAAGGAGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076509483 10:131002207-131002229 CAGGCTGTGTTGAGGGTAGGAGG - Intergenic
1076711558 10:132338538-132338560 CAGGCTGAGGAGGGGAAAGGAGG - Intronic
1076769957 10:132657416-132657438 GGGTCTGTGGAGAGTGAAGTGGG + Intronic
1076835874 10:133020789-133020811 CCGTCTCTTGAGGGGGAAGGTGG - Intergenic
1077003009 11:334421-334443 CAGCCTGTGGGGAGGGGAGAGGG - Intergenic
1077015288 11:396589-396611 GTGCCTGTGGAGAGGGACGGTGG - Exonic
1078181811 11:9017959-9017981 CAGCCTGTGGAGAGGCCATGTGG - Intergenic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078427270 11:11261938-11261960 CAGTCAGGGGAGACGGGAGGAGG + Intergenic
1079023587 11:16927975-16927997 TTGTGTGTGGAGGGGGAAGGGGG + Intronic
1079041452 11:17063803-17063825 CAGTCTTTGTAGAGGCAATGCGG + Intergenic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1080954952 11:37082485-37082507 AAGTCTGTCGATATGGAAGGAGG - Intergenic
1082740626 11:56907099-56907121 CTACCTGTGGAAAGGGAAGGTGG + Intergenic
1082767418 11:57180555-57180577 CAGTGTGTGGAAAGGGATGCTGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083470611 11:62881507-62881529 CCGTCTGGGGACAGGGGAGGGGG - Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084490664 11:69476566-69476588 CGGGCTGGGGAGAGGGAAGGGGG - Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084669595 11:70597239-70597261 CAGTGGGTGGAGAGAGAATGAGG - Intronic
1084857671 11:71999308-71999330 CTGGCTGTGAAGAGGGGAGGCGG + Exonic
1085004618 11:73074925-73074947 CAGACAGTGGGGAGGGAGGGAGG + Intronic
1085446173 11:76602612-76602634 AAGGCTGTGGGGAGGGGAGGTGG + Intergenic
1085740906 11:79077700-79077722 CAGACTCTGGGGAGGGAAAGAGG + Intronic
1086570343 11:88276574-88276596 CAATCTGTGGAGAGGGGTAGCGG - Intergenic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1087183302 11:95160147-95160169 CAGTCAGGGGAGTGAGAAGGTGG - Intergenic
1087674696 11:101146878-101146900 CAGTCTGTGGGTAGGGATGAAGG - Intergenic
1087798973 11:102483603-102483625 TAGTCTGTGGTGAAGGAAGAGGG - Intronic
1088245533 11:107814494-107814516 GAGTTTGTGGGGAGGGAGGGAGG + Intronic
1088425492 11:109696994-109697016 CAGTCTCTGCAGAGAAAAGGTGG - Intergenic
1089248208 11:117137766-117137788 CAGCCTGTGGAGAAGAAAAGAGG - Intergenic
1089258503 11:117206795-117206817 CAGCCTGTGGAGAAGAAAAGAGG + Exonic
1089681081 11:120119332-120119354 CAGCCTGTGGGGAGGGCTGGGGG + Intronic
1090075820 11:123579453-123579475 CTGGCTGTGGACAGGGAAGGAGG + Intronic
1090114768 11:123956656-123956678 CAGTCTGTAAAGACTGAAGGAGG + Intergenic
1090940798 11:131386515-131386537 CTGTCTGTGGTGTAGGAAGGAGG + Intronic
1091025081 11:132135047-132135069 CATTCTGTGGGGAGGGGAGGAGG - Intronic
1091303902 11:134524414-134524436 CAGTCCGTGCAGGGGCAAGGTGG - Intergenic
1091596436 12:1882058-1882080 CAGGCTGTGGAAGGGGAAGGGGG - Intronic
1091642631 12:2249070-2249092 CTGTCAGTAGAGAGGTAAGGAGG + Intronic
1092169514 12:6364224-6364246 CAGTCTTTGGAGGAGGGAGGCGG - Intronic
1093356727 12:18176233-18176255 CAGTCTTAGGAGAGTCAAGGGGG - Intronic
1093655277 12:21687602-21687624 CAGCCTGTGCAGAGCCAAGGGGG + Intronic
1096072313 12:48782252-48782274 CAGTCTGTAGAGACAGAATGTGG - Intronic
1096693075 12:53332987-53333009 CCAGCTGTGGGGAGGGAAGGAGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097826993 12:64184424-64184446 CAGCCTGTGTACAGGGAATGTGG - Intergenic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1098603918 12:72366765-72366787 AATTCTGTAAAGAGGGAAGGGGG + Intronic
1098795562 12:74884405-74884427 CAGTATGTGTTGAGGGAAAGGGG - Intergenic
1098939190 12:76515541-76515563 CAGAGTGTTGAGAGGGAACGTGG - Intronic
1099071607 12:78051172-78051194 CATTGTGTGAAGAGGGGAGGTGG + Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100895788 12:99180910-99180932 CAGTCAGTAGGGAGGGGAGGAGG - Intronic
1101081753 12:101193679-101193701 CAGGCTGTGGTGATGCAAGGTGG - Exonic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1101543661 12:105689065-105689087 CACTATCTGGAGAGTGAAGGTGG + Intergenic
1101667328 12:106831182-106831204 CAGCCTGTGGAGAAAGAAGGTGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102541225 12:113620699-113620721 TTGTCAGGGGAGAGGGAAGGAGG - Intergenic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103780627 12:123396454-123396476 CAGTTTGTGGAGGGGCAGGGTGG + Intronic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105707365 13:22976694-22976716 CAGTCCCGGGAGAGGAAAGGTGG - Intergenic
1105890887 13:24681348-24681370 CCGTCCGTGTAGAGGGGAGGCGG - Intronic
1106502800 13:30345659-30345681 CAGTCTATGGAGAGGCCATGGGG - Intergenic
1106610083 13:31270654-31270676 TAGTGTGGGGAGACGGAAGGAGG - Intronic
1106829611 13:33565218-33565240 CAGGAAGTGTAGAGGGAAGGGGG + Intergenic
1107061374 13:36163055-36163077 TAGGCTGCAGAGAGGGAAGGTGG + Intergenic
1108005033 13:45937856-45937878 TAAACTGTGGAGAAGGAAGGTGG + Intergenic
1109032741 13:57214072-57214094 CAGGATGTGGACAGGGAAAGGGG + Intergenic
1109204303 13:59464936-59464958 AAGTCTGTGGACAGGGAAGAGGG + Intergenic
1109326472 13:60873305-60873327 CAGTGTGTGGATAGGGAAAGAGG + Intergenic
1110158112 13:72342649-72342671 CAGCCTGTGGTGCGGGGAGGTGG - Intergenic
1110473521 13:75887273-75887295 AAGTCTGTGGTGAGGGAGGAGGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111823649 13:93243183-93243205 TATTCTGTGGAAAGGGTAGGTGG - Intronic
1111823908 13:93244712-93244734 CAGTCTTTGGAGCGTGAAAGGGG - Intronic
1112433130 13:99370564-99370586 CACTCTGGGGACAGGGAATGGGG - Intronic
1112469658 13:99676141-99676163 CAGTCTGTGGCCAGGGGTGGTGG - Intronic
1113007926 13:105728719-105728741 CAGTCTGGGGTGAGTGAAAGAGG + Intergenic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113248852 13:108428962-108428984 AAGTCTGTAGAGGAGGAAGGCGG - Intergenic
1113376446 13:109768786-109768808 CAGTCTGTAGAGAGAGGATGTGG - Intronic
1113531937 13:111033502-111033524 CAGTGTGTGTACAGGGCAGGGGG + Intergenic
1116005525 14:39286426-39286448 GAGACTGTGGAGAGGGGAGAGGG + Intronic
1116712267 14:48383463-48383485 CTCTCAGTGGAGAGGAAAGGTGG + Intergenic
1117283115 14:54259853-54259875 GAGTCTGGGGAGAAGGATGGTGG - Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1118635744 14:67747535-67747557 GAGTCTGGGGAGAGAAAAGGTGG - Exonic
1119162110 14:72461250-72461272 CAGGCAGTGGAGAGGGTGGGAGG + Intronic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1119862811 14:77948798-77948820 CAGGTAGTGGGGAGGGAAGGAGG - Intergenic
1120146029 14:80979354-80979376 AAGGCTGTGCAGAGGGTAGGGGG + Intronic
1120880392 14:89411223-89411245 CATTTTGTGGAGAGCCAAGGGGG - Intronic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1122182834 14:99968291-99968313 CAGCCTGTGGTGGGGGAGGGTGG + Intergenic
1122293735 14:100693610-100693632 CCGTCCATGGAGAGGGAAGGAGG - Intergenic
1122631361 14:103109145-103109167 CAGGTGGTGGAGAGGGAGGGAGG - Intronic
1123039682 14:105485398-105485420 CACTCAGTGGAGATGGCAGGTGG + Intergenic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123790194 15:23711933-23711955 CAGTCTCTGAGGAGGTAAGGAGG + Intergenic
1124025987 15:25966383-25966405 GAGTCTGTGGAGAGAGAAGGAGG - Intergenic
1124475856 15:30034026-30034048 CTGGCTGTGGGGAGGAAAGGGGG - Intergenic
1125407372 15:39367457-39367479 CAGTCTTTGGAGATTGAGGGTGG + Intergenic
1126020027 15:44391103-44391125 CAGTCTCTTTTGAGGGAAGGGGG - Intronic
1126202065 15:45997781-45997803 TTGTGTGTGGAGAGGGATGGGGG - Intergenic
1126348283 15:47718500-47718522 CAGTAAGGGGAGAGGGACGGTGG - Exonic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126928738 15:53622618-53622640 CAGTCTGAGGAGGGAGCAGGGGG + Intronic
1127512651 15:59657624-59657646 AAGGGCGTGGAGAGGGAAGGAGG + Intergenic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127656156 15:61058102-61058124 CAGACTGTGATGAGGGCAGGGGG + Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129002733 15:72347602-72347624 CAGTCTCTGTAGAGGCAGGGAGG + Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129182931 15:73888282-73888304 CAGGCTGGGGAGAGGTCAGGTGG + Intronic
1129234567 15:74216248-74216270 CATTTTGGGGAGAGGGTAGGTGG - Intergenic
1129617866 15:77114250-77114272 AAGTCCCTGGACAGGGAAGGTGG - Exonic
1129717404 15:77860302-77860324 CAGTCTGAGGTGGGGGGAGGGGG - Intergenic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1130731195 15:86493853-86493875 CAGTCAGGGGAGGGGGAAGTGGG - Intronic
1130828378 15:87573101-87573123 GAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1131377522 15:91937752-91937774 AAATCTGTGGAAAGGGAAGAAGG + Intronic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1132702580 16:1228435-1228457 CAGGCTTAGGACAGGGAAGGGGG + Exonic
1132705746 16:1242433-1242455 CAGGCTTAGGACAGGGAAGGGGG - Exonic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132889030 16:2195355-2195377 CAGTCTGTGGGGGTGGAGGGAGG + Intronic
1132942650 16:2515593-2515615 GAGTCTGTGGAAAGAGCAGGCGG - Intronic
1133688480 16:8189789-8189811 GAGGCTGTGGAGAGGGATGGAGG - Intergenic
1134756556 16:16672517-16672539 CAGTCTTTGGAATGGAAAGGAGG + Intergenic
1134989513 16:18686646-18686668 CAGTCTTTGGAATGGAAAGGAGG - Intergenic
1135146724 16:19969128-19969150 CAGTCAGTGGAGATGGGAGGGGG + Intergenic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1136248577 16:28989288-28989310 AGGGCTGTGGAGAGGGAGGGAGG - Intronic
1136597302 16:31260182-31260204 CAGTCTGGGGAGAGGCAAAGGGG + Intronic
1138083744 16:54115535-54115557 CAGGCTGTGGGGAAGGGAGGTGG + Exonic
1139710287 16:68770772-68770794 CAGTGTGTGGAGTGGGCAAGAGG + Intronic
1139781720 16:69357085-69357107 AAGTAAGTGGAGAGGAAAGGTGG - Intronic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1140638135 16:76940676-76940698 CATTCTGTTGGGAGGGCAGGTGG - Intergenic
1140792802 16:78408423-78408445 CTCTCAGTGGAGAGGGAATGTGG - Intronic
1140913400 16:79473634-79473656 CAGGCTGTGGAAAGGGCACGGGG + Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141717422 16:85734902-85734924 CAGGCTGTGGAGAGTGAGGGAGG - Intronic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142024448 16:87804943-87804965 CAGCATGTGGAGAGAGAGGGCGG + Intergenic
1142126322 16:88412300-88412322 CAGGCTGTGGAGAGGGCACTGGG - Intergenic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1142903845 17:3029483-3029505 GAGTCTGGGGAGAGGCAGGGTGG + Intronic
1142950946 17:3479625-3479647 GAGTCGGTGCAGGGGGAAGGTGG - Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144676402 17:17165071-17165093 CACTCTGCTGAGAGAGAAGGAGG + Intronic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1146175478 17:30663654-30663676 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146348929 17:32079700-32079722 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146622073 17:34406496-34406518 CAGCCTGTGGAGTGGAAAAGAGG - Intergenic
1147144408 17:38476988-38477010 TAGGGTCTGGAGAGGGAAGGAGG + Intronic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1148899954 17:50867599-50867621 AAGTCTGGGGGGAGCGAAGGAGG + Intronic
1149553416 17:57556509-57556531 CAGTCTTTGGGGTGGGAGGGAGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1151544639 17:74785351-74785373 CACACTGTAGACAGGGAAGGAGG - Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152123250 17:78431697-78431719 GAGTCTGTGGAGGGGGAGGGAGG + Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152496637 17:80677515-80677537 GAGTCTGGTGGGAGGGAAGGTGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152498240 17:80690212-80690234 CAGCCAGGGGAGTGGGAAGGGGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1152784096 17:82239114-82239136 CAGTGTTTTGAGGGGGAAGGTGG + Exonic
1153467629 18:5406713-5406735 CACCCTGTAGAGAAGGAAGGCGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155494465 18:26429092-26429114 TAGTCTTTGGAGAGGCAAGGAGG + Intergenic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157584428 18:48792092-48792114 AAGGCTGTGGAGAAGGAAGCAGG + Intronic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1159031386 18:63236174-63236196 CAATCTGTGGAAGGTGAAGGAGG - Intronic
1159424904 18:68272518-68272540 CACTCTTGGGAGGGGGAAGGGGG - Intergenic
1159942476 18:74418895-74418917 CAGCATGTGAAGAGGCAAGGAGG + Intergenic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1160628379 18:80228664-80228686 CAGTCTGTGGGCAGGGGATGGGG - Intronic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161243290 19:3234883-3234905 CAGACTGTGGGGCGCGAAGGTGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161791352 19:6362006-6362028 AAGTCTGGGGCCAGGGAAGGAGG - Intronic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162550278 19:11354854-11354876 CAAGCTGTGGAGAGAGAGGGTGG - Exonic
1162983488 19:14254257-14254279 CAGACTGTGGATAAGGATGGAGG + Intergenic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1163571614 19:18085372-18085394 CAGTCCAGGGAAAGGGAAGGAGG - Intronic
1163688524 19:18725764-18725786 CAGGCTGTGTTGGGGGAAGGTGG - Intronic
1163867105 19:19782665-19782687 CAGTCTGAGGAGAGTCAGGGGGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165407510 19:35639786-35639808 GAGACTGTGCAGTGGGAAGGGGG + Intergenic
1165717638 19:38056600-38056622 TAGTCAGTGGACAGAGAAGGGGG + Intronic
1165928328 19:39341351-39341373 GGGACTGTGGGGAGGGAAGGAGG - Intronic
1166395075 19:42433650-42433672 CAGGCTGTGGAGAGGGGAATGGG + Intronic
1167037163 19:47001318-47001340 AAGGCTGTGGAGTGGGACGGTGG - Exonic
1167379500 19:49130359-49130381 GAGTCTGGAGTGAGGGAAGGAGG - Exonic
1167408488 19:49330514-49330536 CAGCCAGTGAAGAAGGAAGGAGG + Intergenic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167696903 19:51020090-51020112 CAGACTGTGGAAGAGGAAGGAGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167792208 19:51689585-51689607 GAGTCTGCGGAAAGGGAGGGTGG + Intergenic
1168686864 19:58354144-58354166 CAGGCTGTGGTGAGGAGAGGGGG - Intergenic
925013215 2:501753-501775 CCGTCTGTGGAGAAGGGACGTGG - Intergenic
925080062 2:1056494-1056516 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925080085 2:1056566-1056588 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925080126 2:1056702-1056724 CACGCTGTGGGGAGGGAGGGAGG + Intronic
925239719 2:2313387-2313409 CAGTCTCTGGAGAGGAACTGGGG + Intronic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926498612 2:13622788-13622810 CAGTGAGTGGAGTGGGAAGGTGG + Intergenic
926504234 2:13691307-13691329 CATTCTGTGGAAAGTGAAAGTGG - Intergenic
926635234 2:15171330-15171352 CAGTTACTGGAGAGGAAAGGAGG - Intronic
927494633 2:23544173-23544195 CCGTCTGTGGGGAGAGAAGACGG + Intronic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
927639418 2:24837281-24837303 CAGGTTATGGAGTGGGAAGGAGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927875849 2:26654720-26654742 CAGTCTGGGGTGGGGGATGGGGG + Intergenic
928682909 2:33720969-33720991 AAGTCGTTGGAGAGGGAATGAGG + Intergenic
928830130 2:35471804-35471826 CAGGATTTGGAGCGGGAAGGGGG + Intergenic
929862313 2:45689947-45689969 TAGTCTCTAGAGAGGGAAGTGGG - Intronic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930261814 2:49155479-49155501 AAGGCAGGGGAGAGGGAAGGAGG - Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930884969 2:56314951-56314973 CAGGCTCTGGGAAGGGAAGGAGG - Intronic
931134616 2:59383671-59383693 CAGACAATTGAGAGGGAAGGAGG + Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931254153 2:60555472-60555494 CGCTCCGAGGAGAGGGAAGGAGG - Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931996222 2:67841816-67841838 GTGTCTGTGGAGAGTGAGGGTGG - Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932447752 2:71791180-71791202 CAGCCTGTGGAGATGGCTGGGGG + Intergenic
932518106 2:72374551-72374573 CACAGTGTTGAGAGGGAAGGTGG + Intronic
932621059 2:73265193-73265215 AAGTCTGGGGAAAGGGGAGGGGG + Intronic
932708661 2:74046788-74046810 AAGTCTGTGGTCATGGAAGGAGG + Exonic
932837405 2:75050457-75050479 CAGCCTCTGGATGGGGAAGGAGG - Intronic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934711825 2:96520884-96520906 CAGTCTGTGTAAACTGAAGGAGG + Intergenic
935180900 2:100690553-100690575 CAGTCTGATGAAAGAGAAGGAGG - Intergenic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
935681014 2:105636996-105637018 CAGTCTGTGGTGGGGGATGGTGG - Intergenic
936060617 2:109293474-109293496 CTGGCAGTGGAGAGAGAAGGGGG - Intronic
937369488 2:121287384-121287406 CAATCTGTGGAGATGGAGGGAGG + Intergenic
937924947 2:127160867-127160889 CAGTCTGAGGACAGGAGAGGAGG - Intergenic
938287018 2:130127576-130127598 AAGTCTGGGGACTGGGAAGGGGG - Intronic
938428575 2:131211294-131211316 AAGTCTGGGGACTGGGAAGGGGG + Intronic
938661920 2:133495684-133495706 ATGTCTGTGGAGGGGGAAGGTGG + Intronic
939296978 2:140279073-140279095 GAGAGAGTGGAGAGGGAAGGAGG - Intronic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
939956700 2:148533379-148533401 CAGTCTGTGGAGGGGAACAGAGG - Intergenic
940069079 2:149664860-149664882 CAGACGGGGGAGAGGGAAAGGGG - Intergenic
941494993 2:166189095-166189117 CAGTCTATGGTGGGGGGAGGGGG - Intergenic
942276724 2:174328536-174328558 CAGACTTTGGGCAGGGAAGGCGG + Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943560873 2:189460428-189460450 GAGGGTGTGGAGTGGGAAGGAGG - Intronic
943733709 2:191330736-191330758 GAGTCTGTGGAGGAGGAAGATGG + Intronic
944235240 2:197436290-197436312 GAGTCTGGTGAGAGGGAAAGAGG - Intergenic
944342389 2:198617372-198617394 CAGTGGGTGGAGATGGGAGGAGG + Intergenic
945096944 2:206229260-206229282 GATTCTATAGAGAGGGAAGGGGG + Intergenic
945152098 2:206802590-206802612 CAGTGTATGGAGAGGAAGGGTGG + Intergenic
945696046 2:213105573-213105595 TAGTGTGTGGGGGGGGAAGGGGG + Intronic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
946164618 2:217856420-217856442 CTGTCTGTGGGAAGGGAAGCTGG - Intronic
946189445 2:218000485-218000507 GAGACTGTGGAGTGGGAAAGGGG + Intronic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946425110 2:219590483-219590505 CTGGCTTTGGAGATGGAAGGGGG + Intergenic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
946873631 2:224107221-224107243 CAGCCTGTGGAGAGGACAGCTGG - Intergenic
946919696 2:224566069-224566091 CAGCCTGTAGATGGGGAAGGTGG - Intronic
947866193 2:233399518-233399540 CTGCCTGTGGTGGGGGAAGGGGG + Intronic
948012036 2:234656647-234656669 CAGTTTGTGGGAAGGGATGGGGG - Intergenic
948288856 2:236809125-236809147 GAGGCTGTGGAGAGGCAGGGTGG + Intergenic
948811380 2:240480211-240480233 CATTTTATGGAGGGGGAAGGAGG + Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1169636143 20:7693951-7693973 CTCTCTGTGGTGAGGGGAGGGGG + Intergenic
1169935985 20:10883849-10883871 CATTCTCTGAAAAGGGAAGGGGG - Intergenic
1170168962 20:13390391-13390413 CAGTCTGTGGCAATCGAAGGTGG - Exonic
1171483063 20:25468452-25468474 CAGTCGGGGGACAGGGCAGGGGG - Intronic
1172238433 20:33394773-33394795 TTGGCTGTGGAGAGGGAAGTTGG - Intronic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172573001 20:35984916-35984938 GAGTCTGCAGAGAGAGAAGGTGG - Intronic
1173638658 20:44583435-44583457 TACTCTGTAGAGAGGGAAAGAGG + Intronic
1173985585 20:47259203-47259225 CAGGGTGTGGAGGTGGAAGGAGG + Intronic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174457722 20:50661588-50661610 CATTCTGAGGAGAGGCAAAGAGG + Intronic
1175134896 20:56815806-56815828 CAGTCTGCGGAGGGGCATGGAGG + Intergenic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1175313084 20:58025288-58025310 AGGACTGTGGTGAGGGAAGGGGG + Intergenic
1175825927 20:61936485-61936507 CAGTCTGTGGGCAGGGGAGGCGG - Intronic
1176381876 21:6117785-6117807 CAGTCTGTGGAGGGGCCAGGAGG - Exonic
1177688019 21:24465483-24465505 GAGTGTGTGAAGAGCGAAGGGGG - Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1178773589 21:35528184-35528206 GACACTGTGGGGAGGGAAGGAGG + Intronic
1179006837 21:37522777-37522799 CAGGCTTTTGAGAAGGAAGGAGG - Intergenic
1179272926 21:39865662-39865684 CAGGCTGTGCAGAGGGCATGTGG - Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179741596 21:43420454-43420476 CAGTCTGTGGAGGGGCCAGGAGG + Exonic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
1181461894 22:23090576-23090598 CAGTCTGAGGGGCAGGAAGGAGG - Intronic
1181728789 22:24830006-24830028 CAGACTGTGGACAGGGGAAGAGG - Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182446719 22:30393959-30393981 AAGTGTGTGGAGAGGGCAAGTGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1183105768 22:35613983-35614005 CAGCCTGTGGAAATGGACGGAGG + Intronic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1183789607 22:40055378-40055400 CAGCCTGTGTAGAGGCATGGGGG + Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1185136481 22:49076252-49076274 CAGGAGGTGGTGAGGGAAGGTGG + Intergenic
949569119 3:5274662-5274684 CAGTCTTTGGGGAGGCAAGAGGG + Intergenic
950822484 3:15775900-15775922 CAGTCTCTGGAGAAAGAAGAGGG - Intronic
951652038 3:24961611-24961633 CACACTGTGGGGAGGGAGGGCGG + Intergenic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954411015 3:50371111-50371133 AAGTCTGAGGAGCTGGAAGGAGG + Intronic
954631059 3:52047800-52047822 CAGCCTGTGGAGAGGGGTAGAGG - Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954859877 3:53678709-53678731 GAGAATGTGAAGAGGGAAGGTGG + Intronic
955870227 3:63430902-63430924 CACTCTGTGAAGAGGAAAAGAGG - Intronic
956219332 3:66884809-66884831 GAGAGTGGGGAGAGGGAAGGAGG + Intergenic
956641284 3:71417930-71417952 CAGACTGTGGATAGGAAATGTGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
963273642 3:143309222-143309244 CAGTCTGAGGCTTGGGAAGGTGG + Intronic
963956566 3:151260932-151260954 CAGTCTGGGGAGATGGAAACTGG - Intronic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964846596 3:161051110-161051132 CAGTCTGAGGAGATGGCGGGTGG - Intronic
966818724 3:183908888-183908910 GGTTCTGGGGAGAGGGAAGGAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968670940 4:1851207-1851229 CAGGCTGTGCAGAGGCTAGGCGG + Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969542417 4:7801255-7801277 CAGTTTGAGGAGCAGGAAGGCGG - Intronic
970183655 4:13426526-13426548 CAGTTTATGGACATGGAAGGTGG - Intronic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
974146634 4:57955963-57955985 AAATTTGTGGTGAGGGAAGGGGG + Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975545881 4:75560105-75560127 TGGTTTTTGGAGAGGGAAGGAGG + Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
977771969 4:100870537-100870559 AAGTCTGTGGAAAGGGCAGATGG - Intronic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
978327413 4:107575153-107575175 AGGTGTGTGGAGTGGGAAGGTGG - Intergenic
978368333 4:108005880-108005902 TAGCCTGTGGAGAAGAAAGGAGG + Intronic
978538990 4:109795388-109795410 CAGTCTGTGAAGACTGAAAGAGG + Intronic
982587773 4:157264380-157264402 CAGGATTTGGAGATGGAAGGAGG - Intronic
983228427 4:165106794-165106816 CAAGCTGGGGAAAGGGAAGGTGG - Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
984863122 4:184257326-184257348 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984863145 4:184257402-184257424 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985328325 4:188797620-188797642 GGGCCTGTGGAGAGGGAGGGAGG - Intergenic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
986445399 5:7816505-7816527 CCGGCTGTGGAGGGGAAAGGAGG + Intronic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
988415300 5:30939747-30939769 GGGTATGTGGAGTGGGAAGGAGG - Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
988653411 5:33179447-33179469 CAGCCTTTGGAGAGGGAATTTGG - Intergenic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
988819457 5:34866894-34866916 CAGTCTGTGGATGGCCAAGGAGG - Exonic
989773378 5:45171866-45171888 AAGCCTGTGGGGAGGGAGGGAGG - Intergenic
990925228 5:61014159-61014181 CAATCTCTGGAGAGGGGAGAGGG + Intronic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
991245591 5:64505904-64505926 TAAACTGTGGAGGGGGAAGGGGG + Intergenic
991666651 5:69006144-69006166 CAGGCTGGGATGAGGGAAGGAGG + Intergenic
992754510 5:79891602-79891624 AGGACTTTGGAGAGGGAAGGGGG - Intergenic
992879167 5:81088137-81088159 CAGTCTGTGCAGAGGAATAGAGG - Intronic
993936374 5:94009309-94009331 CAGTCTTTGGAGAAAGCAGGTGG - Intronic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995175230 5:109168411-109168433 CAATCTCTGGGGAGTGAAGGAGG + Intronic
995687907 5:114791208-114791230 CAGGCTGTGGAGATGGAGAGAGG - Intergenic
995968895 5:117942855-117942877 CATTCTGTGGAGAAGGGAAGTGG - Intergenic
996571402 5:124935985-124936007 CAGCCTCTGGGGAGGGAAGGGGG - Intergenic
996699395 5:126435168-126435190 CAGTCTGGGGAGAGGGGAATGGG + Intronic
997356224 5:133264790-133264812 GAGTCTTTGGAGAGGAAACGAGG - Intronic
998220636 5:140275780-140275802 CAGTTTGTGTAGATGGCAGGAGG - Intronic
999171208 5:149596859-149596881 CAGTCTGTGAAGGGGAAATGAGG + Intronic
999303358 5:150504547-150504569 CAGTCAGTGGAGGGGACAGGAGG - Intronic
999385405 5:151150719-151150741 CAGTGTGTGGTGGGGGGAGGAGG + Intronic
999465897 5:151804051-151804073 CAGGATTTGGAGTGGGAAGGGGG + Exonic
1000373846 5:160561197-160561219 CATTCTCTTGAGAGGCAAGGTGG - Intergenic
1001288221 5:170438802-170438824 CAGTCCTTGGAGGGGGAATGGGG - Intronic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002307661 5:178293326-178293348 CCATCTGTGGAGATGGCAGGAGG + Intronic
1002415695 5:179119799-179119821 GAGCCTGTGGAGTGGGAATGTGG - Intronic
1003528968 6:6921743-6921765 CAGTTTGGGGATATGGAAGGAGG + Intergenic
1003590263 6:7431537-7431559 CAGCCCGTGGAGGAGGAAGGAGG + Intergenic
1005716380 6:28553345-28553367 GAGTTTGTGGGGAGGGGAGGAGG + Intergenic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1006084800 6:31587969-31587991 GAGTCTGGGGACAGGGAAGGGGG + Intronic
1006404481 6:33836490-33836512 CTACCTTTGGAGAGGGAAGGAGG + Intergenic
1006407945 6:33856063-33856085 CAGTCTGGGGCCAGGGAGGGAGG - Intergenic
1006427609 6:33976099-33976121 CAGGCTGGGGAGGGGGAACGTGG + Intergenic
1006716305 6:36122950-36122972 AAGCCTGTGGAGGGGGAAGCGGG + Intergenic
1007487898 6:42194966-42194988 CAGTCGGTGCAGGGGGCAGGTGG + Intergenic
1007565196 6:42844694-42844716 CAGACTGAGGAGAGAGCAGGAGG + Intronic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1008759164 6:54833457-54833479 CAGTCACTGGAGAGAGGAGGGGG + Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010060744 6:71620035-71620057 AAGGCTGTGGAGATGGCAGGAGG - Intergenic
1010189929 6:73184877-73184899 GAGTATTTGGAGAGAGAAGGGGG + Intronic
1010505921 6:76659203-76659225 CAATATTTGGAGAGGGAAGTGGG + Intergenic
1010807997 6:80261382-80261404 CAGTCTGTGGCCAGGGGAGGAGG + Intronic
1010863170 6:80938437-80938459 CAGACAGTGGAGAGGGAATGAGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1015274195 6:131367393-131367415 GAGTCGGTGGAGAAAGAAGGGGG + Intergenic
1018070972 6:160164126-160164148 CCGTCTGTAGAGAGGAAGGGTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018151006 6:160939810-160939832 CAGTCTGAGGACATGGCAGGGGG - Intergenic
1019006674 6:168803582-168803604 CAGCCTGTGGACTGGAAAGGCGG + Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1019844159 7:3480237-3480259 CTGGCTGTGAAGATGGAAGGGGG + Intronic
1019860448 7:3653585-3653607 CAGGAAATGGAGAGGGAAGGAGG + Intronic
1020016833 7:4836200-4836222 GAGGCTGTGGAGTGGGATGGCGG - Intronic
1020109906 7:5442119-5442141 CTGTCTGTGGGGAGGAAATGGGG - Intronic
1022026060 7:26448911-26448933 CAGTCTGTGAAAAGGCAAGACGG + Intergenic
1022671841 7:32463082-32463104 GTTGCTGTGGAGAGGGAAGGAGG - Intergenic
1023522813 7:41065841-41065863 CAGGCTGTGGGTGGGGAAGGCGG + Intergenic
1023882086 7:44326298-44326320 CAGTCTTTGGAGAAGTGAGGGGG - Intronic
1026185784 7:68081860-68081882 ATGTCTGTGAAGAGAGAAGGTGG + Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1026891447 7:73985194-73985216 CAGCTCGTGAAGAGGGAAGGTGG + Intergenic
1027954204 7:84858931-84858953 TAATGTTTGGAGAGGGAAGGGGG - Intergenic
1028308424 7:89296760-89296782 CAGTTTAGGGAGAGGAAAGGTGG - Intronic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1028885355 7:95926821-95926843 GAGTCTCAGGAGAGGGCAGGTGG - Intronic
1030070462 7:105693606-105693628 AAACCTGTGGAGTGGGAAGGGGG - Intronic
1030341502 7:108385892-108385914 CTGTCTATGGAGAGAGAGGGAGG + Intronic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034393118 7:150801056-150801078 CAGTCGGTGGAGCGGGAGGTCGG + Exonic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1035291700 7:157843546-157843568 CAGTCAGTGGCCAGGGAAGTTGG - Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037759465 8:21732443-21732465 GAGTCTGCGGAGAGGGGAGGGGG + Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041929054 8:63267285-63267307 CAATCTGGTGGGAGGGAAGGGGG + Intergenic
1042156851 8:65853476-65853498 CAGTCCTTTGAGAGGTAAGGAGG - Intergenic
1042590323 8:70392010-70392032 CACACCGTGGAGAGGGTAGGAGG + Intronic
1044157850 8:88872199-88872221 CAGTTTGAGGAGTGGGAAAGAGG - Intergenic
1044823381 8:96174075-96174097 CAGTCTGTGAAGAAAGAAGGGGG - Intergenic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1046486940 8:114899147-114899169 AAGTTTGTGGAGAGAGAAAGAGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1047883005 8:129217331-129217353 CTGTCTGTGGAAATGAAAGGTGG - Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048744250 8:137595773-137595795 CTGTCTTTGGAGAAGGGAGGTGG + Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049219011 8:141420409-141420431 CCTTCCGTAGAGAGGGAAGGGGG + Intronic
1049346938 8:142144132-142144154 GAGGCTGTGGCCAGGGAAGGGGG + Intergenic
1049476153 8:142797825-142797847 CTGGCTGTGGAGAGAGGAGGAGG + Intergenic
1049735386 8:144202349-144202371 CCCTCTGTGGAGGGGAAAGGAGG + Intronic
1050064192 9:1741640-1741662 AAATTTCTGGAGAGGGAAGGAGG + Intergenic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1050866935 9:10512650-10512672 CAATTTGTTGAGAGGGAAGGAGG + Intronic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1051419810 9:16877815-16877837 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
1051928647 9:22359573-22359595 GGGTTTGTGGAGGGGGAAGGTGG - Intergenic
1052591754 9:30505487-30505509 CAGTTTGTGGAAAGGGAAAGGGG + Intergenic
1053102245 9:35380773-35380795 CTGACTGTGGGGAGGGATGGGGG + Intronic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1054736955 9:68763209-68763231 CAGCCTGTGCAGAGGAAAAGAGG + Intronic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1054832562 9:69643045-69643067 CTGTGTGTGGAGGGGGGAGGAGG - Intronic
1054945261 9:70788992-70789014 CAGTCTGTGGACAGGGGATTGGG + Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1055022372 9:71684023-71684045 CACCCTGTGGAAAGGGAAGCTGG + Exonic
1056098497 9:83278245-83278267 CAGTCTGAGGGGTGGGCAGGAGG + Intronic
1056190013 9:84175854-84175876 CAAGCTGGGGGGAGGGAAGGTGG - Intergenic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056552390 9:87663078-87663100 GACTCAGCGGAGAGGGAAGGTGG - Intronic
1056555786 9:87686219-87686241 GAGGCTGTGGAGAGGGTGGGAGG - Intronic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1057802631 9:98199353-98199375 AAGGCTGTGGGGAGGGGAGGTGG + Exonic
1058418301 9:104810932-104810954 CAGGCAGTGGAGGGGGCAGGGGG + Intronic
1058712862 9:107696111-107696133 CAACCTCTGGAGAGGAAAGGGGG + Intergenic
1058866111 9:109163869-109163891 GATTCAGTGGAGAAGGAAGGAGG - Intronic
1058901673 9:109447634-109447656 AAGTTTGTGGAGAGAGGAGGTGG - Intronic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1060103391 9:120858702-120858724 CAGTCTGGTGAGAGGCAAGGTGG - Intronic
1060207984 9:121693727-121693749 CAGTCTGTTGAAAGGGGAGAGGG + Intronic
1060300188 9:122370591-122370613 CAGTCTGCAGAGAAGAAAGGGGG - Intronic
1060518934 9:124282977-124282999 CAGCCTGTGGGGCAGGAAGGAGG + Intronic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1061402593 9:130376518-130376540 TCGTCTTTGGAGATGGAAGGGGG - Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1061625567 9:131838936-131838958 CAGGGTGTGGAGAGGGAGAGGGG + Intergenic
1061710413 9:132483543-132483565 AAGGCTGTGGTGGGGGAAGGAGG - Intronic
1061998580 9:134204095-134204117 CAGTCTATGGAGGAGGCAGGTGG - Intergenic
1062048381 9:134434849-134434871 CAGACTGTGGGGCGGGGAGGGGG + Intronic
1062261796 9:135666604-135666626 CAGGCTCTGGGAAGGGAAGGGGG - Intergenic
1062473248 9:136715291-136715313 GGGGCTGGGGAGAGGGAAGGTGG + Intronic
1185484128 X:469327-469349 CAGGCTGTGGGGAGGGAATGAGG + Intergenic
1186527099 X:10258611-10258633 CAGTCTGTGGGAAAGAAAGGGGG + Intergenic
1186889002 X:13941725-13941747 CAGTGTGTGGAGGAGGACGGAGG - Intergenic
1187256457 X:17647503-17647525 AAGTGTGTGGAAAGGGAGGGTGG + Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188526895 X:31097073-31097095 TAGACGGGGGAGAGGGAAGGGGG + Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190224530 X:48534882-48534904 AGGTCTGTGGAGAGTGACGGAGG - Intergenic
1190512435 X:51186483-51186505 CAGTCTGTAAAGACCGAAGGAGG + Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1191659339 X:63634236-63634258 CAATCTGTAGAGTTGGAAGGGGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192389350 X:70709063-70709085 CAGTCTGTAGGAAGTGAAGGTGG - Intronic
1192672673 X:73162264-73162286 TAGTCTGAGGAGAGGTAAAGAGG + Intergenic
1193178689 X:78427303-78427325 CAGACTCTGGGGAGGGGAGGTGG + Intergenic
1193606975 X:83581007-83581029 CAATCTCTGGAGAGGGGAGGGGG + Intergenic
1194578131 X:95638952-95638974 CAACCTCTGGAGAGAGAAGGAGG + Intergenic
1195091402 X:101463133-101463155 CACTCTCTGGAGAGAGGAGGTGG + Intronic
1195196657 X:102503641-102503663 AAGCCTGGGGAGAGGGAAAGGGG - Intergenic
1195520643 X:105824082-105824104 CTATATGTGGAGAGGTAAGGTGG + Intronic
1195732604 X:107981588-107981610 CATTCTGGGGACAGGGCAGGGGG + Intronic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1196512159 X:116524326-116524348 CAGCCAGTGGACTGGGAAGGTGG - Intergenic
1196799276 X:119528077-119528099 TAGCCTGGGGAGGGGGAAGGAGG - Intergenic
1199544713 X:148995773-148995795 CAGACTTTGAGGAGGGAAGGGGG + Exonic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200232007 X:154448799-154448821 GAGACTGTGGACAGGGAAGCTGG - Intronic
1202041209 Y:20685978-20686000 TAATCTCTGGAGAGGGAATGAGG + Intergenic