ID: 1105026133

View in Genome Browser
Species Human (GRCh38)
Location 12:132850381-132850403
Sequence GAGTGAAGAGTTTGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105026128_1105026133 30 Left 1105026128 12:132850328-132850350 CCTACGACCACTTCACCAATGCC 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 237
1105026130_1105026133 15 Left 1105026130 12:132850343-132850365 CCAATGCCTCTATATACGAAGCA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 237
1105026129_1105026133 23 Left 1105026129 12:132850335-132850357 CCACTTCACCAATGCCTCTATAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 237
1105026131_1105026133 9 Left 1105026131 12:132850349-132850371 CCTCTATATACGAAGCATGCTCT 0: 1
1: 0
2: 2
3: 5
4: 50
Right 1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105026133 Original CRISPR GAGTGAAGAGTTTGGATTCC TGG Intronic
900398537 1:2463285-2463307 AAGTGAAGAGGTTGGATCCAGGG + Intronic
901316989 1:8316229-8316251 GAGGGAAGAGAGTGGATTCATGG - Intergenic
902094961 1:13935558-13935580 GAGTGAAGAGGTTGGAGAGCTGG + Intergenic
904023593 1:27488297-27488319 GAGTGAAGATTGTGGATTTGGGG - Intronic
906279726 1:44544872-44544894 GAATGGAGAGATTGCATTCCAGG - Intronic
907189258 1:52634552-52634574 CAGGGAAGAGGTTGCATTCCTGG + Intronic
908964917 1:69748996-69749018 TCTTGAAGAGTTTGGCTTCCAGG - Intronic
909285724 1:73814777-73814799 TAGTGAAGTGTTTTGTTTCCTGG - Intergenic
909386583 1:75064763-75064785 CAGTGAAGCCTTTGGGTTCCAGG + Intergenic
909965288 1:81902083-81902105 AAGGGTAGAGTTAGGATTCCAGG + Intronic
917539678 1:175900518-175900540 TGGTAAAGAGTTTGGATTCAGGG + Intergenic
917735276 1:177914471-177914493 GAGTGAGGAGTCTGGTTTTCAGG + Intergenic
919541479 1:198851117-198851139 GAGTGAGTAGTTGGGATTACAGG - Intergenic
920052294 1:203171476-203171498 GAATGAAGAGGATGGAGTCCTGG + Exonic
921682586 1:218051893-218051915 GAAAGAAGCTTTTGGATTCCTGG - Intergenic
922239376 1:223745484-223745506 GAGTGAATTTTTTGGAATCCAGG - Intronic
922279222 1:224106877-224106899 GAGCAAAGAGTTTTGCTTCCTGG - Intergenic
922609659 1:226916121-226916143 CAGTCCAGAGTTTGGACTCCAGG - Intronic
924843117 1:247735525-247735547 GAGTGAAGAGCTGGGTCTCCAGG + Intergenic
1062851032 10:743579-743601 GAGTGAAGGGTGTCGAATCCCGG + Intergenic
1062921526 10:1284055-1284077 GAGTGTAGGGTCTCGATTCCAGG + Intronic
1064390050 10:14934379-14934401 TAGTGAAGAATTAGGAGTCCAGG - Exonic
1064400486 10:15016903-15016925 TAGTGAAGAATTAGGAGTCCAGG - Intergenic
1065250530 10:23806900-23806922 GAATGCAGAGTTAGGATTGCTGG - Intronic
1067239579 10:44478951-44478973 CAGTTGAGAGTTTGAATTCCGGG + Intergenic
1068140598 10:53001973-53001995 TAGGGCTGAGTTTGGATTCCTGG + Intergenic
1069750422 10:70741840-70741862 CAGTGAAGGGTTGGGATTCGTGG + Intronic
1072182802 10:93004140-93004162 GAATGGAGAGTATGGATTCCAGG + Intronic
1073278568 10:102334298-102334320 GAGTGAAGAGCTTTGCTACCAGG + Intronic
1073779075 10:106817212-106817234 AATTAAAGTGTTTGGATTCCAGG - Intronic
1075401565 10:122164574-122164596 GAGAGAAAAGATCGGATTCCTGG - Intronic
1076635617 10:131880306-131880328 GAGTGGAGACCTTGGCTTCCAGG - Intergenic
1078777816 11:14410041-14410063 GAGTGAATTGTTTGGCTTCAAGG - Intergenic
1079314006 11:19392043-19392065 GAATGGAGAGTTTGGATTAGTGG + Intronic
1081167297 11:39821865-39821887 GACAGAAGAGTTTATATTCCAGG - Intergenic
1081903616 11:46651505-46651527 GAGAGAAGAGCTTGGAATGCTGG + Intronic
1082763000 11:57144840-57144862 GAGCGGAGAGTTTGCATTCCAGG + Intergenic
1085240540 11:75050509-75050531 GAGGGAAGATTTGGGATTCAAGG + Intergenic
1085825491 11:79842491-79842513 GAGTGAAGAGTGGGGTCTCCAGG + Intergenic
1085962227 11:81475323-81475345 GGGTGAGGAGTGTGGAGTCCTGG - Intergenic
1086845906 11:91749365-91749387 GAGTCATGAGTTAGGAGTCCAGG - Intergenic
1087605716 11:100375473-100375495 GAGTTAAGAGTATTGATACCAGG - Intergenic
1087923222 11:103890641-103890663 GAGTGAGGAGTATGGTTCCCAGG - Intergenic
1089184035 11:116602786-116602808 GAGTGGAGAGTTGGGATCCAAGG + Intergenic
1090255552 11:125281214-125281236 GAGGAAAGAGATTGGACTCCTGG + Intronic
1090376679 11:126294418-126294440 AAGTGAAGAGATGGGAATCCAGG + Exonic
1090625909 11:128608585-128608607 GAGTGAATAGCTGGGATTCAAGG - Intergenic
1090751456 11:129749826-129749848 CAGTGAAAATTTTGGATTTCTGG + Intergenic
1092191029 12:6521025-6521047 GACTGAAGGGTTCGGACTCCTGG - Exonic
1092747125 12:11683721-11683743 GAGTGTAAAGTTTGTTTTCCTGG + Intronic
1095315692 12:40758801-40758823 CAGTGAAGAGTTTGCAAACCAGG + Intronic
1095593753 12:43936244-43936266 GAGAGAAGAGTTTGGATGTAAGG + Intronic
1095742546 12:45622884-45622906 CCATGAAGAGCTTGGATTCCTGG - Intergenic
1096573058 12:52534958-52534980 GACTGAAGAGTGTGGCTTTCTGG - Intergenic
1097173209 12:57128727-57128749 GGGTGAAGGGTTTGGATTTCGGG + Exonic
1097420516 12:59372918-59372940 TAGTGAAGAGTTTTCAATCCAGG - Intergenic
1101937461 12:109069859-109069881 GAGTGAAGTGTGTGGACACCTGG + Intronic
1102613470 12:114132825-114132847 CAGTGAAGACTTTGGCTTCCTGG + Intergenic
1102765272 12:115427511-115427533 GAGGGTAGGGTTTGGGTTCCTGG - Intergenic
1104357620 12:128101616-128101638 AGGGGAAGAGTATGGATTCCTGG + Intergenic
1104572380 12:129936150-129936172 GAGTTCAGGATTTGGATTCCGGG + Intergenic
1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG + Intronic
1106438457 13:29744183-29744205 GAGTGAACAGGATGTATTCCTGG + Intergenic
1108931184 13:55822535-55822557 CAGTGAAGTAATTGGATTCCTGG + Intergenic
1109275613 13:60300460-60300482 GAGGAAGGAATTTGGATTCCTGG - Intergenic
1110003321 13:70233182-70233204 GGTAGAAGAGTTTGGTTTCCTGG - Intergenic
1110319403 13:74143259-74143281 GCATGAAGACTTTGGTTTCCTGG + Intergenic
1111146446 13:84187472-84187494 TACTGAAGATTTTGGATTCCAGG - Intergenic
1112159491 13:96853121-96853143 GAGAGAATGGTTTGGTTTCCTGG - Intergenic
1112990760 13:105511028-105511050 GAATAGAGAGTTTCGATTCCAGG - Intergenic
1114371773 14:22097345-22097367 GACTGAATAGTTTGGATTAATGG - Intergenic
1114406781 14:22464173-22464195 GAGTGAAGAGGGTGGCTTCAGGG - Intergenic
1120260613 14:82179905-82179927 GAGAAAAGAGTTTAGATTCATGG - Intergenic
1122644214 14:103181289-103181311 AAGGGAAGAGTTAGCATTCCAGG - Intergenic
1202845580 14_GL000009v2_random:170434-170456 GAGTGAAGAAATTGCATTGCAGG + Intergenic
1202875214 14_GL000225v1_random:200786-200808 GAGTGAAGAAATTGCATTGCAGG - Intergenic
1202877690 14_KI270722v1_random:22006-22028 GAGTGAAGAAATTGCATTGCAGG - Intergenic
1126662414 15:51046022-51046044 AAATGAACAGTTTGGATTCTAGG + Intergenic
1126840219 15:52710394-52710416 GAGGAAAGAGACTGGATTCCAGG - Intergenic
1126951250 15:53884304-53884326 GAGTGAAGAGTTTAGGATCCTGG - Intergenic
1126983206 15:54270878-54270900 AAGTGAAGAGTTTGGATGTAGGG - Intronic
1127698240 15:61472714-61472736 GAGAGCAGGGTTTGAATTCCAGG - Intergenic
1128689182 15:69710239-69710261 GAGGGAGGGGTTGGGATTCCTGG + Intergenic
1130098381 15:80873077-80873099 AAGTGTAGTGTTTGAATTCCAGG - Intronic
1133904950 16:10013595-10013617 GAGAGAAGAGCTATGATTCCAGG - Intronic
1138058598 16:53863372-53863394 GAGAGATTAGTATGGATTCCTGG + Intronic
1139146193 16:64328213-64328235 CAGTGAAGACTTTGGATCCAAGG - Intergenic
1141748531 16:85942607-85942629 GAGGAAAGAGAGTGGATTCCAGG - Intergenic
1143500414 17:7335551-7335573 GAGAGAAGAGTTTGAGTTCATGG - Intergenic
1144182739 17:12768061-12768083 TAGTGAAGAGTCTGGGTTCTTGG + Exonic
1149972527 17:61233282-61233304 CAGGGAAGAGTTTGGACCCCAGG + Intronic
1150651319 17:67012138-67012160 GAATCAAGAGGCTGGATTCCAGG + Intronic
1152458463 17:80429332-80429354 GTGTGGGCAGTTTGGATTCCAGG + Intronic
1155597646 18:27506700-27506722 GAGTGAAGCCATTGGATTCTGGG - Intergenic
1155731515 18:29165486-29165508 TATTGAATAGTTTGAATTCCAGG + Intergenic
1156237702 18:35220192-35220214 GAGTTAAGAGTTGTCATTCCTGG - Intergenic
1156272166 18:35545653-35545675 GAATGAAGAGGGTGAATTCCAGG + Intergenic
1158932729 18:62336764-62336786 GAGTGAAGAGTCTGCAGCCCTGG - Intronic
1159305133 18:66631103-66631125 GAGTTCAGAGTTTTGACTCCAGG + Intergenic
1160991227 19:1861121-1861143 GAGGGATGGGTTTGGAGTCCTGG - Intronic
1161292089 19:3499989-3500011 GCGTGAAGAGTTAGGAATCCAGG + Intronic
1163049675 19:14672912-14672934 GGGTCAAGAATTAGGATTCCAGG - Intronic
1164895067 19:31869331-31869353 TAGTCAATAGTTTAGATTCCTGG + Intergenic
1166167581 19:41003119-41003141 GAGTGAAGTGGCTGGTTTCCTGG + Intronic
1167015370 19:46837970-46837992 GGGTGATGGGTTTAGATTCCAGG - Intergenic
1168556252 19:57343397-57343419 AAGTGAAGGGTTTGGATTTGGGG + Intergenic
1202672987 1_KI270710v1_random:10934-10956 GAGTGAAGAAATTGCATTGCAGG + Intergenic
925161887 2:1690334-1690356 GAGGGAAGAGTTTGGAGTGTGGG + Intronic
925272963 2:2627532-2627554 GAGAAAAGAGTTTTGCTTCCTGG - Intergenic
926438075 2:12857865-12857887 GAATGCAGAGTTGGGATTGCAGG - Intergenic
928178370 2:29050445-29050467 GAGTGTGGACTTTGGAGTCCAGG + Intronic
928494946 2:31822110-31822132 CAGTGAAGCCATTGGATTCCAGG + Intergenic
929260446 2:39861337-39861359 GAGGGAAGTGTTTGGATTATAGG + Intergenic
931992028 2:67800052-67800074 GAGTGGAAACTTTGGCTTCCAGG - Intergenic
932141898 2:69286403-69286425 GAGTGAAGTGATTGGATTATGGG - Intergenic
932880298 2:75494988-75495010 GAGTGAACAGTTTTCATTCTAGG + Intronic
935053140 2:99541210-99541232 AAGTGAAGATTTTAGGTTCCGGG + Intergenic
935212887 2:100953724-100953746 GGGTGAAGAGTGTGGGCTCCGGG - Intronic
935938686 2:108215886-108215908 GAGGAAAGAGTTTTGCTTCCTGG + Intergenic
936084831 2:109460258-109460280 GAGTGAATAGTATCCATTCCAGG + Intronic
938991117 2:136631048-136631070 GAGTTAGGAGTTTGCATTTCAGG + Intergenic
939070925 2:137541225-137541247 GAGTGAAGAATCTGATTTCCAGG + Intronic
940691718 2:156926968-156926990 GAGTGATGATTTAGGATACCTGG - Intergenic
941215950 2:162709387-162709409 GATTGAGAAGTTTGGTTTCCAGG - Intronic
941635500 2:167931261-167931283 AAGTGATGAGTCTGGATTTCTGG - Intergenic
942749311 2:179269739-179269761 GAGTGAAGTGATTGGATTATGGG - Intergenic
944717049 2:202385087-202385109 AACTGAAGAATTTGGATTACTGG - Intronic
945771858 2:214053556-214053578 GAGTGAATTGGTTGTATTCCAGG - Intronic
946172017 2:217901225-217901247 GACCACAGAGTTTGGATTCCAGG + Intronic
946446089 2:219740853-219740875 GATTGAATTGTTTGGATTCAGGG + Intergenic
947503760 2:230691251-230691273 GAGGGTTGAGTTTGGATTCCTGG - Intergenic
947854646 2:233314865-233314887 GAATGAATATTTTGAATTCCAGG - Intronic
948861963 2:240757073-240757095 CAGGGAAGAGTCTGGGTTCCAGG - Intronic
1170024422 20:11873393-11873415 GAGAGATGAGTTAAGATTCCAGG - Intergenic
1171952712 20:31435629-31435651 GAGTGATGTGTATGGCTTCCTGG - Intergenic
1173121267 20:40291715-40291737 GACTGATGAGTTAGCATTCCTGG + Intergenic
1174728756 20:52893078-52893100 GAATGTAGAGTTTTGATTCATGG - Intergenic
1176261678 20:64185201-64185223 GAGGGAAGAGTTGATATTCCTGG + Intronic
1176638979 21:9279446-9279468 GAGTGAAGAAATTGCATTGCGGG - Intergenic
1177362670 21:20093722-20093744 CAGTGAATAGTTTGGAAACCTGG + Intergenic
1177596890 21:23256264-23256286 GAGAGAGGAGTTTGGAATGCAGG + Intergenic
1178005123 21:28210125-28210147 GAGTGAAAAGTATGGAATACTGG + Intergenic
1179311708 21:40201958-40201980 ATGTGGAGAGTTTGAATTCCAGG - Intronic
1180423024 22:12886953-12886975 GAGTGAAGAAATTGCATTGCGGG - Intergenic
1183474681 22:38029607-38029629 GAATGAAGGGATTGGTTTCCAGG + Intronic
949437646 3:4046751-4046773 CAGTTAAGAGTTTAAATTCCAGG - Intronic
949762518 3:7487134-7487156 GAGTGATGAATTAGGATTTCTGG + Intronic
949881334 3:8663394-8663416 GAGTAAAGAGTTTCAGTTCCAGG - Intronic
950258665 3:11527483-11527505 TAGTTAAGAATTTGCATTCCTGG + Intronic
951036831 3:17941798-17941820 TACTGTAGAGTCTGGATTCCAGG + Intronic
955763168 3:62311212-62311234 CTATGAAGAGTTTGGAGTCCAGG + Intergenic
956045333 3:65190109-65190131 GAGTTAAGCATTGGGATTCCAGG - Intergenic
956298634 3:67743557-67743579 GATTGTAAAGTTTGAATTCCCGG - Intergenic
956781072 3:72603820-72603842 GAGGGTAGCGATTGGATTCCTGG + Intergenic
957101230 3:75831419-75831441 GAGTGAAGAAATTGCATTGCAGG + Intergenic
957688254 3:83532957-83532979 GATTGAAGAGATTGGATACACGG - Intergenic
959221580 3:103527692-103527714 CAAGGAAGAGTTTGGATTTCAGG + Intergenic
960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG + Intronic
961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG + Intergenic
962150445 3:132887248-132887270 GAGTGATGAGTCTGGTTTCATGG - Intergenic
962519807 3:136187996-136188018 GTGTGGAGAGTTTTGATCCCAGG - Intronic
964382284 3:156109746-156109768 GAGTGATGTTTTTGTATTCCTGG - Intronic
967942840 3:194779577-194779599 GAGAGAAGAGTTTGGAATAGAGG - Intergenic
968352867 3:198075952-198075974 GAGAGGAGAGTTTGGACTCTTGG + Intergenic
1202747916 3_GL000221v1_random:125573-125595 GAGTGAAGAAATTGCATTGCGGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969112842 4:4854394-4854416 GAATGAAGGGAGTGGATTCCAGG + Intergenic
969499003 4:7541865-7541887 GAGTCAACTGTTTTGATTCCAGG + Intronic
969537143 4:7763358-7763380 CAGGGAAGAGCTTGGATCCCCGG - Exonic
970461454 4:16278477-16278499 GACTTAAAAATTTGGATTCCTGG + Intergenic
972876236 4:43364557-43364579 GCAGAAAGAGTTTGGATTCCTGG + Intergenic
975421200 4:74166851-74166873 GGGTGCAGAGTTTGGGTCCCTGG - Intronic
976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG + Intergenic
982725841 4:158905003-158905025 GAATACAGACTTTGGATTCCAGG + Exonic
983732473 4:171012469-171012491 GTGTGAGGAGTTTGGATTGTTGG - Intergenic
984190519 4:176600630-176600652 GAGGGAAGATTTAGGATTCAAGG + Intergenic
984524626 4:180843279-180843301 GAGTGATGTGTTTGAGTTCCGGG + Intergenic
1202753871 4_GL000008v2_random:37856-37878 GAGTGAAGAAATTGCATTGCGGG - Intergenic
985477871 5:90036-90058 AAGTGATGAGGTTGGGTTCCAGG - Intergenic
986690950 5:10313496-10313518 GAGGGAAGAGTTTGGATCATGGG - Intergenic
986795545 5:11207668-11207690 GAGTGGTGGGTTTGGAGTCCAGG - Intronic
986985830 5:13500218-13500240 GAGTGATGAATTAGGATTTCTGG + Intergenic
987809709 5:22818951-22818973 GAGAGAAGAGTTTGGTTTCAAGG + Intronic
988806377 5:34744607-34744629 GAGTGCAGGGTTTGAATTCCAGG + Intronic
989285675 5:39696893-39696915 GAGATAAATGTTTGGATTCCAGG - Intergenic
991544543 5:67766875-67766897 GAGTGAAGGGTCTAGATTTCAGG + Intergenic
994468195 5:100165909-100165931 GATTGCAGAGTTTGAATTCTGGG + Intergenic
996584526 5:125070065-125070087 GAATGAAGAGACTGGATTCATGG + Intergenic
997383022 5:133450923-133450945 GGGTGAAGAGTCTGGCTACCTGG - Intronic
1001401535 5:171449256-171449278 GAGTGATGGTTTGGGATTCCCGG + Intronic
1004346442 6:14853727-14853749 GAGTGAATAGATTGTATTCTTGG + Intergenic
1004369205 6:15037713-15037735 GGGTGGAGAGTGTGGATTCTGGG - Intergenic
1005402375 6:25448056-25448078 GAGTGAAGATCATGGATTCTTGG - Intronic
1005829113 6:29656619-29656641 CAGGGCAGAGTTTGGATTCGCGG + Intergenic
1007181136 6:39930105-39930127 GAGTAATGAGTTTGCATTGCTGG - Intronic
1008972173 6:57381721-57381743 GAGTTAAGAGTTTGAAATCCTGG + Intronic
1009161087 6:60283255-60283277 GAGTTAAGAGTTTGAAATCCTGG + Intergenic
1009371564 6:62909901-62909923 GAGTGAAGCCATTGGGTTCCAGG - Intergenic
1009722474 6:67490045-67490067 GAATGCAGAGATTGGATTCATGG + Intergenic
1009833969 6:68973187-68973209 GACTGAGGAGTGTGGATTCTAGG + Intronic
1011791306 6:90902051-90902073 GAGTGAAGAGCTTAGAATGCAGG + Intergenic
1013298653 6:108782308-108782330 GAGTGTAGAGATTGCATCCCTGG - Intergenic
1015299154 6:131633127-131633149 GAGGGAAGTGATTGGATTCTGGG + Intronic
1018252858 6:161889614-161889636 GAGGGAAGAGTTTTGAATCCTGG + Intronic
1018560422 6:165096691-165096713 GAGTGAGTAGTGTGGCTTCCAGG + Intergenic
1020565348 7:9787909-9787931 GAGTGATGATTTAGGATACCTGG - Intergenic
1022813220 7:33889233-33889255 GATTGAAGGGTTTGGAGTCTGGG - Intergenic
1024866746 7:53911934-53911956 GGGTACAGATTTTGGATTCCTGG - Intergenic
1026137589 7:67677109-67677131 GAGTGAAGAGGTAGGCTTTCTGG - Intergenic
1027637959 7:80699810-80699832 GAGTGAAAGATTTTGATTCCCGG - Intergenic
1028728740 7:94120553-94120575 GGGTGAAATGTGTGGATTCCTGG + Intergenic
1029308743 7:99641608-99641630 GAATGAAGAGTTTGGTTTTGTGG - Intergenic
1031261455 7:119525699-119525721 GAGGGAAGATTTGGGATTCAGGG - Intergenic
1031560988 7:123237813-123237835 GAGTGATGATTTTTTATTCCTGG + Intergenic
1031691431 7:124792873-124792895 GAGAGAAGAGTAGAGATTCCTGG - Intergenic
1033761582 7:144441899-144441921 GAGTGGAGAGTTTAGTGTCCTGG + Intergenic
1034560139 7:151875283-151875305 GGGTGAAGAGGGTGGAGTCCAGG - Intronic
1035069583 7:156132406-156132428 GAGGGAAGAGATTGGATTATGGG - Intergenic
1038791475 8:30672018-30672040 GAGGGAAGTGATTGGATTCTGGG - Intergenic
1039096056 8:33887262-33887284 GAGAGATGACTTTTGATTCCAGG - Intergenic
1042216552 8:66434165-66434187 TAGTGAAGAGTTGAGATTTCTGG + Intronic
1043301978 8:78744850-78744872 GTGGGAAGAGTGTGGTTTCCAGG + Intronic
1043623006 8:82220157-82220179 GAGTAAAGAGTTTAGCTTCAAGG - Intergenic
1047799469 8:128293794-128293816 GACTGCAAAGTTTTGATTCCTGG - Intergenic
1049301015 8:141870369-141870391 TAGTGAAGACTCTGGATTCTAGG + Intergenic
1050282073 9:4060864-4060886 GAGTTGAGAATTTTGATTCCTGG - Intronic
1051160418 9:14201202-14201224 GAGTGAAGTGTTGTGATTCCTGG - Intronic
1051774133 9:20615646-20615668 GAGTGTAGAGTTAGGATCTCAGG + Intronic
1051929555 9:22367972-22367994 GAGGGAAGATCTGGGATTCCAGG - Intergenic
1052786070 9:32829657-32829679 CAGTGAAGAGTTAAGATTACTGG + Intergenic
1055756909 9:79567984-79568006 GAGGAAAGGGTTTGGTTTCCTGG - Intergenic
1058430781 9:104917172-104917194 GAGACAAGAGTTTGAATCCCTGG + Intronic
1058778717 9:108311514-108311536 GTTTGAAGAGTCTGGATGCCTGG + Intergenic
1203757168 Un_GL000218v1:142988-143010 GAGTGAAGAAATTGCATTGCAGG + Intergenic
1203716553 Un_KI270742v1:155655-155677 GAGTGAAGAAATTGCATTGCGGG + Intergenic
1203534660 Un_KI270743v1:22580-22602 GAGTGAAGAAATTGCATTGCAGG - Intergenic
1186217412 X:7314789-7314811 GAGAGAAAGGTTGGGATTCCGGG + Intronic
1187125426 X:16449890-16449912 GAGGGAAGAGTCTTGATTCTTGG - Intergenic
1187588949 X:20694070-20694092 GAGGGAAGATTTGGGATTCAAGG - Intergenic
1188492233 X:30749818-30749840 GAGTGCAGAAGTGGGATTCCTGG + Intergenic
1189438317 X:41012296-41012318 GAGCCAAGAGTTTGGGTCCCTGG - Intergenic
1192547166 X:72023692-72023714 GAGTGAGGAGCTTGGACTCAGGG + Intergenic
1192902938 X:75519728-75519750 TAGTGAAGAGTTGGAAATCCAGG - Intronic
1193093238 X:77517552-77517574 CAGTGAAGACATTGGTTTCCAGG - Intronic
1193585812 X:83319468-83319490 GAGGGAAGTGTTTGGATTATGGG + Intergenic
1193957645 X:87881987-87882009 CAGTGAAGACATTGGGTTCCAGG + Intergenic
1194941133 X:100011535-100011557 GAGTCAGGAATCTGGATTCCAGG + Intergenic
1195972725 X:110491399-110491421 GAGGGAAGAGCTAGGATTCAAGG + Intergenic
1196238998 X:113318229-113318251 GAGGGAAGAGTATGGAATCAAGG - Intergenic
1198845795 X:140908913-140908935 GAGTGAACCATTTGTATTCCTGG - Intergenic
1199467518 X:148155912-148155934 CAGTGGAGAGACTGGATTCCTGG + Intergenic
1199760909 X:150903383-150903405 GAGAGAGGAGTTTGGATTCCTGG + Intergenic
1200416755 Y:2919874-2919896 GATTGAATAGTTTTGATTTCTGG - Intronic
1201170749 Y:11260608-11260630 GAGTGAAGAAATTGCATTGCAGG + Intergenic