ID: 1105026136

View in Genome Browser
Species Human (GRCh38)
Location 12:132850392-132850414
Sequence TTGGATTCCTGGGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105026131_1105026136 20 Left 1105026131 12:132850349-132850371 CCTCTATATACGAAGCATGCTCT 0: 1
1: 0
2: 2
3: 5
4: 50
Right 1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 244
1105026130_1105026136 26 Left 1105026130 12:132850343-132850365 CCAATGCCTCTATATACGAAGCA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105026136 Original CRISPR TTGGATTCCTGGGGAAAAGC TGG Intronic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
900598329 1:3492610-3492632 TGGGCTTCCTGGGGAAGGGCGGG - Intronic
900898187 1:5498438-5498460 TTGGCTTCCTGGGGACCAGCTGG - Intergenic
900908953 1:5580544-5580566 ATGGATCCCTTGGGAAAGGCTGG + Intergenic
902709867 1:18231270-18231292 TTGGATTCTTTGGGTAAATCAGG + Intronic
902936213 1:19766684-19766706 TTGGATGCCTGGGGAAACCAAGG + Intronic
905726040 1:40252871-40252893 TTGCCTTCCTGGAGAAAAACTGG + Intergenic
906023252 1:42650285-42650307 TTGAACTCCTGGGTACAAGCTGG - Intronic
906322795 1:44827302-44827324 CTGGATTCCTGGGGGAGACCAGG + Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908720315 1:67118573-67118595 TTGAGTTTCTGGGGAAATGCTGG + Intronic
909119440 1:71582709-71582731 ATACATTTCTGGGGAAAAGCAGG - Intronic
911667459 1:100569694-100569716 GTGGTTTCCTAGGGATAAGCAGG - Intergenic
913498959 1:119453069-119453091 TTGGATCCCAGGGGAGCAGCTGG + Intergenic
915067679 1:153240094-153240116 CTGGCATCCTGAGGAAAAGCTGG - Intergenic
915984559 1:160451354-160451376 TTTGATACCTGGGGAGAAGAAGG + Intergenic
917033118 1:170716934-170716956 CTGCATTCTTGGGGAAAAACAGG + Intronic
917268454 1:173246996-173247018 TTAGATTCCCTGGGAAAAGAAGG - Intergenic
918282193 1:183018068-183018090 TTGGATGCATGGGTAAAAACAGG + Intergenic
919054042 1:192546773-192546795 GTGGAGTCATGGGGAAATGCGGG - Intergenic
920268521 1:204745222-204745244 CTGGATCCCTGGGGAATAGAGGG - Intergenic
920754498 1:208716224-208716246 TTGGGAGCCTGGGTAAAAGCTGG - Intergenic
921068830 1:211642475-211642497 TTGGCTTCCTTGGGAACAGGGGG + Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921427936 1:215026358-215026380 TAGGATTTCTGGGGAAGACCAGG - Intronic
922617877 1:226973817-226973839 TTGGATGCCTCAGTAAAAGCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924895429 1:248333288-248333310 ATGGATGCCTGGGGAAGAGGTGG + Intergenic
1063059554 10:2537356-2537378 TTGGAATCCGGCGGAAGAGCAGG + Intergenic
1064169972 10:13022378-13022400 TTTGATTCAGGGTGAAAAGCAGG + Intronic
1065604648 10:27405082-27405104 TAGTATTCCTGTGGAAAAGCAGG + Intronic
1072769781 10:98128086-98128108 TTTAATTCCTGAGGAAAAGCAGG - Intergenic
1073666738 10:105542433-105542455 TTGGATTACTGGGGAAGTGGGGG - Intergenic
1074558409 10:114513062-114513084 TTGGTTTGCTGGGGAAAGGGAGG - Intronic
1074995832 10:118756079-118756101 TCGAATTCCTGGGCACAAGCGGG - Intergenic
1075233514 10:120705236-120705258 TTGTAGTCCTGGGGAAAGGTAGG + Intergenic
1075272238 10:121062326-121062348 TTGCATTCGAGGGGAAAAACAGG + Intergenic
1076694046 10:132238461-132238483 GAGGCTTCCTCGGGAAAAGCAGG + Intronic
1076831205 10:132995204-132995226 TCTTATTCCTGGGGAAAATCAGG - Intergenic
1077329974 11:1979907-1979929 TTGGACTCTTGGGAAGAAGCTGG + Intronic
1080523666 11:33091253-33091275 GTGGATCACTGGGGAAAAACTGG + Intronic
1080539941 11:33256483-33256505 TTTGTTTCCTAGGGAAAAGGAGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081193822 11:40136753-40136775 GAGGAATCCTGGGGAAAAGTGGG + Intronic
1081311549 11:41580105-41580127 TTGAATTCCTAGGGTAAATCCGG + Intergenic
1081727745 11:45343154-45343176 TTGCACTCCTAGGAAAAAGCCGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083424994 11:62578900-62578922 TCAGAATCCTGGGGAGAAGCAGG + Exonic
1084106982 11:66986627-66986649 TCAGTTTCCTGGGGAAAAGGTGG + Intergenic
1085054025 11:73393822-73393844 GTTGATTCCTGGGGAAGAGAAGG - Exonic
1085303802 11:75473859-75473881 TTGGAGGCCTGGGGAAACCCTGG - Intronic
1088162207 11:106885999-106886021 TTGAATTACTGGGGAAAAGGAGG + Intronic
1090338863 11:125997327-125997349 TTGGATTCCTCGGGCAAACGGGG - Exonic
1090400022 11:126443129-126443151 TGGCGTTTCTGGGGAAAAGCAGG - Intronic
1090590251 11:128259580-128259602 TTTGATTCCTAGGGTAAAGTAGG + Intergenic
1202812951 11_KI270721v1_random:35086-35108 TTGGACTCTTGGGAAGAAGCTGG + Intergenic
1091580546 12:1785728-1785750 TTGGTTTCTTTGGGAACAGCTGG + Intronic
1092836930 12:12499245-12499267 ATGCATTCCTAGGGCAAAGCTGG - Intronic
1093430182 12:19076128-19076150 ATGGATTGCTGGTTAAAAGCAGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095171416 12:39040530-39040552 TTAGATTACTGGGGAAATGTTGG - Intergenic
1095840350 12:46685373-46685395 TTAGCTTCCTGGGGACCAGCTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098516453 12:71382278-71382300 ATGGGTTCCAGGGGAGAAGCTGG - Intronic
1100192735 12:92209922-92209944 CTGGAGTCCTGCGGACAAGCTGG - Intergenic
1100381013 12:94061913-94061935 TTGGAACCCTTGGGCAAAGCTGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103613974 12:122140812-122140834 ATGGATCACTGGGGAAAAGAGGG - Intronic
1104833992 12:131775304-131775326 TTGTTTTCCTGGGGAAATCCCGG + Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1110458982 13:75723149-75723171 GTGGATTTCTGGGGAACAGGTGG - Intronic
1110774923 13:79396777-79396799 TTGTATTCCTGAGGTAAACCAGG - Intronic
1111310966 13:86485158-86485180 TTGGATAACTGGGGAAAAAATGG - Intergenic
1112977684 13:105341206-105341228 ATGGATTCCTGGGGCAGAACTGG - Intergenic
1113355015 13:109570746-109570768 TAGGTTTCTTGGGGAACAGCTGG + Intergenic
1113913922 13:113859984-113860006 GTGGATTCTTTGGGAACAGCTGG - Intronic
1116671218 14:47845770-47845792 AAGGATCCCTGGGGAAAACCTGG - Intergenic
1120540310 14:85742677-85742699 TTGGTTTCCTGGGGAAAGCCTGG - Intergenic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1123885922 15:24728322-24728344 TTAGTGTCCTGGGGAAAATCTGG - Intergenic
1124177705 15:27441747-27441769 TTGACCTCCTGGGGAGAAGCAGG + Intronic
1128516600 15:68345815-68345837 TTGGACTCCTGGGGACAGGATGG + Intronic
1131785704 15:95909064-95909086 AAGCATTCCTGGGGAGAAGCTGG - Intergenic
1132706768 16:1247445-1247467 GTGGCTTCCCGGGGAGAAGCCGG - Intergenic
1134786756 16:16951838-16951860 TTGGATTCCTTTGGAGTAGCAGG - Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1139162483 16:64527858-64527880 GTGGAGTTCTGTGGAAAAGCAGG - Intergenic
1140161140 16:72496390-72496412 TTGGTTTCCTTGGGACAATCTGG - Intergenic
1140753455 16:78046499-78046521 TTTGATTCCTGGCAAAAAGCTGG - Intronic
1142660095 17:1422830-1422852 TTTCATTCCAGGTGAAAAGCAGG - Exonic
1142755791 17:2015671-2015693 GTGGATGCCAGGGAAAAAGCAGG + Intronic
1146296624 17:31655225-31655247 CTGGATGGCTGGGGAAGAGCAGG - Intergenic
1150639104 17:66937687-66937709 TGGGATTGATGGGGCAAAGCTGG - Intergenic
1152305495 17:79518078-79518100 TTGCAGTCCTGGGGAAAAGGAGG - Intergenic
1152326894 17:79646865-79646887 GTGGGTATCTGGGGAAAAGCAGG - Intergenic
1155407437 18:25504231-25504253 TTACATTCGTGGGGTAAAGCTGG - Intergenic
1155781591 18:29844485-29844507 TTGTATTCCCTGGGAGAAGCAGG - Intergenic
1155841429 18:30648498-30648520 TTAGATTCCAGGGTAAAAACAGG + Intergenic
1156569370 18:38235560-38235582 TTGGACTACCGGGGAAATGCAGG - Intergenic
1162675250 19:12294115-12294137 TTGAATTCCAGCGGAAAGGCTGG + Intronic
1166143980 19:40821874-40821896 TGGGGTTTCTGGGGAAAAGGAGG + Intronic
1166183629 19:41125222-41125244 TGGGGTTTCTGGGGAAAAGGAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925022939 2:586300-586322 TTGGATTTCTGCTGAAAAGGAGG - Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
926703694 2:15821400-15821422 TTCTATTCTTGGTGAAAAGCAGG + Intergenic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
930240463 2:48930849-48930871 TTGTATTCCATGGGAGAAGCAGG - Intergenic
931796386 2:65714010-65714032 TAGGCTTCCTGGAGCAAAGCAGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933392597 2:81690832-81690854 ATGGCTTCCTGGGGAAAAGATGG - Intergenic
936572189 2:113626514-113626536 TTGGTTCCCTCGGGAAAGGCGGG - Intergenic
937314160 2:120920413-120920435 GTGGATTCCTGGGGGAGAGAAGG - Intronic
939622956 2:144443075-144443097 TTAGATCCTTGGGGAAAAGTAGG + Intronic
940100412 2:150031312-150031334 TTGGATTCAATGGGAAAAGATGG - Intergenic
941030420 2:160505101-160505123 CTGGATCCCTGGGGAAATTCAGG + Intergenic
941367449 2:164624484-164624506 TGGGATTCCTGAGGAAAGACAGG - Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945328477 2:208511608-208511630 TTGTATTCTTTGGGAAAAGACGG + Intronic
946298445 2:218806000-218806022 TTGGATTCCAGGAAAGAAGCTGG + Intronic
948711397 2:239827756-239827778 TTTGATTCCTTGTGGAAAGCTGG - Intergenic
1168856079 20:1010011-1010033 TTGGCCTCCTGGGCAAAGGCAGG + Intergenic
1169682308 20:8229145-8229167 TTCTATTCCTGGAGAAGAGCAGG + Intronic
1169941546 20:10943270-10943292 TTGGTTTCCTGGGAAAAACATGG + Intergenic
1170034934 20:11980308-11980330 TTAGAGTCCTGGGGTAAACCTGG + Intergenic
1170041318 20:12042833-12042855 TTGGATACCTGGGATAAAGGAGG - Intergenic
1171221963 20:23406274-23406296 TGGGAGTGTTGGGGAAAAGCAGG + Intronic
1171403021 20:24891817-24891839 TCGGGATCCTGGGGAAAGGCAGG - Intergenic
1173132370 20:40406548-40406570 TTTGATACCTGGTGAAAAGTAGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174843805 20:53923897-53923919 TTTGATATCTGGGGAAAAGGTGG - Intergenic
1175048185 20:56126982-56127004 TTGGGTTCCAGAGGGAAAGCTGG - Intergenic
1175813143 20:61869679-61869701 TTGGGGACCTGGGGAAAAGGCGG - Intronic
1176529440 21:7946775-7946797 TTGGATTCCAGTGGAATGGCTGG - Intergenic
1179805480 21:43834503-43834525 TTGGGTTCTTGGGGCACAGCAGG + Intergenic
1180072456 21:45443170-45443192 GTGGATTCCTGGAGGACAGCTGG + Intronic
1181944185 22:26503018-26503040 TTGAATTTATGGGGGAAAGCAGG - Intronic
1182035759 22:27197065-27197087 TTGGATTCCTGGGAAAAGCCAGG + Intergenic
1182844832 22:33421824-33421846 TTAGATTTCTGGGGGTAAGCAGG + Intronic
1184173845 22:42774911-42774933 GCGGATTCCTGGGCAGAAGCCGG + Intergenic
1184303919 22:43581596-43581618 TTAAATTCCTGGGGAATTGCTGG + Intronic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1185171924 22:49299263-49299285 TTGGCGTCCTTGGGAGAAGCAGG + Intergenic
1185428003 22:50784366-50784388 TTGGTTCCCTCGGGAAAGGCGGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
954673541 3:52303437-52303459 TTGGATTCATGGGGAAAGTGGGG + Intergenic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960585377 3:119316422-119316444 TTGGCTTCCTAGGGAAATGGTGG - Intronic
961191972 3:124969597-124969619 GTGGATTCCTGAGGAAGAACAGG - Exonic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962674365 3:137743520-137743542 GTAGATGCCTGGGGAAAAACTGG + Intergenic
963804719 3:149711619-149711641 TTGGTGACCTGGGCAAAAGCAGG - Intronic
964716038 3:159722909-159722931 TAGAATTCCTGGAGAAAAGTGGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965648396 3:170908520-170908542 GTGAAGACCTGGGGAAAAGCTGG - Intronic
967339337 3:188378940-188378962 TTGGATTCCTGGGGGTGAGAAGG + Intronic
967915261 3:194573691-194573713 GTGGATCTCTGGGGAAGAGCGGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968591763 4:1463144-1463166 TTGGGGTCCTGGGAATAAGCCGG + Intergenic
968949211 4:3681758-3681780 TGGGATTTCTGTGGAAAGGCTGG - Intergenic
969373874 4:6750487-6750509 GTGGCTCCCTGGGGAAGAGCTGG - Intergenic
970148843 4:13067965-13067987 TCTGATTCCAGGGTAAAAGCAGG + Intergenic
972342681 4:38166080-38166102 TGGGCTTCCTGGGGAAAGGCAGG - Intergenic
972532795 4:39976748-39976770 TTCGATCCCTGGGAAAGAGCGGG - Intronic
973112409 4:46412299-46412321 TTGGAAGCATGGGGAAAAGAGGG + Intronic
973678929 4:53295967-53295989 TTGTATTCCTGGGATGAAGCTGG + Intronic
978602479 4:110443371-110443393 TTGGAGTCACAGGGAAAAGCTGG + Intronic
980295921 4:130917130-130917152 TTGGATTACTGGAGACAAACTGG - Intergenic
980564352 4:134519033-134519055 TTGGTTTTGTGGGGAACAGCAGG + Intergenic
981131198 4:141160335-141160357 CTGCATTACTGGGGAAATGCTGG + Intronic
981572091 4:146162743-146162765 TGGCTTTCCTGGGGAAAAGATGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986151215 5:5132198-5132220 GGTGATTCCTGGTGAAAAGCAGG - Intergenic
986654754 5:9999923-9999945 TTTGCTTCCTGGGGAAACACAGG - Intergenic
987051620 5:14151458-14151480 TTGGATTTCTGTGGAATAGGTGG + Intronic
987540849 5:19253147-19253169 ATGGATTCCTGGGGAAATAGAGG - Intergenic
990483167 5:56231032-56231054 TTGTATTCCTGGGGAAACTAAGG + Intronic
991776452 5:70090091-70090113 TTGGATTCCTGAGTTAATGCTGG + Intergenic
991855739 5:70965538-70965560 TTGGATTCCTGAGTTAATGCTGG + Intergenic
996128788 5:119755792-119755814 TTGGAGACTTGGGGAAAAGATGG + Intergenic
996391442 5:122966921-122966943 TTGAATTCCTGGGGACATTCTGG - Intronic
996403023 5:123083747-123083769 TTAAATTCCTGGGGAAAGGGTGG + Intergenic
997303933 5:132825185-132825207 TTGGGTTCCTGGGGAGGATCAGG - Exonic
1000850293 5:166331495-166331517 TTTTATTCCTGGGGACAAGTGGG - Intergenic
1000970887 5:167713337-167713359 TTGGATTTCTGTGCCAAAGCTGG + Intronic
1002992683 6:2252425-2252447 TTTTATTCCAGTGGAAAAGCAGG - Intergenic
1003423968 6:5984113-5984135 TTCGATTCCCTGGGCAAAGCTGG - Intergenic
1003611240 6:7616696-7616718 TGGAATTCAGGGGGAAAAGCTGG - Intergenic
1003652720 6:7976126-7976148 TAGGATTCTTGGGGAAATGCAGG + Intronic
1005997331 6:30939440-30939462 TTGGGTCCCTGGGGAAAGGGGGG + Intergenic
1007478756 6:42136426-42136448 TTGGATTCCTGGGGCTTAGGAGG + Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1007743771 6:44029758-44029780 GTGGCTTCCTGTGGAAAAGTAGG - Intergenic
1008213865 6:48760491-48760513 TTTGTTTCCTGGGGCAAAGGAGG - Intergenic
1010212432 6:73372642-73372664 TTGGAAGCCTGGGGACAAGTGGG + Intronic
1011087841 6:83562339-83562361 TTGCATTCCTGGGTAAAACCTGG - Intronic
1014208335 6:118681110-118681132 TTGAATTACTGGTAAAAAGCTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016582294 6:145642446-145642468 TTGAATTACTGGCAAAAAGCAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017650461 6:156576623-156576645 ATGGACTCTTGGGGAAAAGAAGG - Intergenic
1018366433 6:163124624-163124646 TCCCATTCCTGGGGAAATGCTGG - Intronic
1019135261 6:169903882-169903904 CTGGAATCCTGGTGAACAGCTGG - Intergenic
1020868288 7:13592903-13592925 GTGGTTTCATGGGGAAAAGTTGG - Intergenic
1023170354 7:37385365-37385387 TTGGCCTGCTGGGGAATAGCAGG - Intronic
1023358051 7:39387116-39387138 CTGGGTTCCTGGGGATGAGCGGG - Intronic
1023519375 7:41035234-41035256 TTGGATTCCTGGAGACCACCTGG - Intergenic
1025142622 7:56478639-56478661 CTGGCTTCCTGGGGAATTGCTGG - Intergenic
1025708682 7:63889240-63889262 CTGGCTTCCTGGGGAATTGCTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026391602 7:69908256-69908278 CTGGGTTCCTGTGGCAAAGCAGG - Intronic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1028471722 7:91213222-91213244 TAAGATTCCCTGGGAAAAGCAGG + Intergenic
1029658638 7:101944322-101944344 ACGCCTTCCTGGGGAAAAGCAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031400699 7:121323462-121323484 AAGGATTGCTGGGGAAATGCTGG + Intergenic
1031562924 7:123260255-123260277 TTGGATTACTGTAGAAAAACAGG + Intergenic
1032384396 7:131511494-131511516 TCTGAATCCTGGGGAAGAGCTGG - Intronic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1041152095 8:54945221-54945243 AGGGATTCCTGGGGAAAGGGGGG - Intergenic
1044797384 8:95917773-95917795 GAGGATTCCTGGAGAAAAGGAGG - Intergenic
1045243314 8:100421504-100421526 CTGGCTTCCTGGGCACAAGCTGG + Intergenic
1045988077 8:108273558-108273580 TTGGATCCCTGAAGAAAAGTTGG + Intronic
1046486847 8:114897818-114897840 TTGGTTTCCTCTGGAAAGGCAGG - Intergenic
1047000779 8:120570391-120570413 TTGGAACCATGGGGAACAGCAGG - Intronic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG + Intergenic
1050282070 9:4060853-4060875 TTTGATTCCTGGGCAGAGGCTGG - Intronic
1050486010 9:6135332-6135354 TTTGGTTGCTGGGGAAAAGGTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057710004 9:97431699-97431721 TTGGATTTATGGGGAAGAGACGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059127006 9:111698723-111698745 TAGTATTCCTGGGGGAAGGCAGG + Intronic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1061386862 9:130295586-130295608 GTGGATTCCTGGAGACATGCGGG + Intronic
1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG + Intronic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1062514270 9:136924613-136924635 CTGGAGTCCTGGGCTAAAGCTGG - Intronic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1187214966 X:17267315-17267337 TTGGGTTCCTGGGGTAGAGATGG - Intergenic
1189321070 X:40087761-40087783 TTAGAGTCCTGGTGCAAAGCAGG + Intronic
1189350667 X:40273342-40273364 TTGGAGACCTGGGGAGAAGTTGG - Intergenic
1190442757 X:50492243-50492265 TTGGAGCTCTGGGGAGAAGCTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1195273517 X:103255469-103255491 TAGGATTCCAGGGGAAATGGTGG - Intergenic
1195973403 X:110498546-110498568 TTTGATTCTTGGGAGAAAGCTGG + Intergenic
1197601221 X:128532713-128532735 TTTGTTTCATGGGGAAAAGCTGG + Intergenic
1199577788 X:149330940-149330962 GTGGATTTCTGGTGAAAATCGGG - Intergenic
1200021702 X:153216737-153216759 GTGGATCCCTTGAGAAAAGCAGG + Intergenic
1200180084 X:154144719-154144741 TCAGCTTCCTGGGGAAGAGCTGG + Intronic
1200185912 X:154183113-154183135 TCAGCTTCCTGGGGAAGAGCTGG + Intergenic
1200191564 X:154220251-154220273 TCAGCTTCCTGGGGAAGAGCTGG + Intronic
1200197319 X:154258055-154258077 TCAGCTTCCTGGGGAAGAGCTGG + Intronic