ID: 1105026751

View in Genome Browser
Species Human (GRCh38)
Location 12:132853968-132853990
Sequence GGCTTTGCAGGCGCCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105026751 Original CRISPR GGCTTTGCAGGCGCCTGGTG TGG (reversed) Intronic
900373940 1:2344751-2344773 GGCTCTGCAGGCAGCTGTTGTGG - Intronic
900471717 1:2858274-2858296 GGCTGTGCCTGTGCCTGGTGTGG + Intergenic
900767934 1:4517918-4517940 GTCTTTGCAGGAGCCTGCTCTGG + Intergenic
902128846 1:14240846-14240868 GGCTTTGCAGGGGCATGGGAGGG + Intergenic
902329300 1:15723274-15723296 GGCTTGGCAGGAGCCTGCTTTGG + Intronic
903173670 1:21568619-21568641 GGCTCTGCAGGCGCCCTGGGGGG + Intronic
905913132 1:41667443-41667465 GGCTCAGCAGGCCCCAGGTGGGG + Intronic
906563440 1:46778465-46778487 GGGGTTGCAGGGGGCTGGTGGGG + Intronic
907289231 1:53402335-53402357 GGCTGGGCAGGTGCCAGGTGGGG - Intergenic
912489470 1:110054003-110054025 GGCTGTGCTGCCACCTGGTGGGG - Exonic
913010380 1:114677502-114677524 GGCTTTGCAGGAGGTAGGTGCGG - Exonic
913485341 1:119328143-119328165 GGGTTAGCAGGGGCCTGGAGTGG + Intergenic
915399173 1:155610165-155610187 GGCTTGGCAGGCGCGTGGGCGGG - Intergenic
915416288 1:155745745-155745767 GGCTTGGCAGGCGCGTGGGCGGG - Intergenic
915902243 1:159855287-159855309 GGGATTGCAGGGGCCTGGAGGGG - Exonic
920048922 1:203151630-203151652 GGCTTGGCAGGCCCCCTGTGAGG - Intronic
922586691 1:226738732-226738754 GGCTCTGCTGGCGCCGGGCGAGG - Intronic
1067029542 10:42871119-42871141 TGCTGGGCAGGCTCCTGGTGTGG + Intergenic
1070753028 10:78974997-78975019 TGCTTTGCAGGGTCGTGGTGAGG - Intergenic
1070866255 10:79709598-79709620 GGCTCTGCAGGGGCCGGGTGAGG + Intronic
1070880049 10:79847729-79847751 GGCTCTGCAGGGGCCGGGTGAGG + Intronic
1071563873 10:86661762-86661784 GGCCTGGCAGGAGCCTGGGGTGG + Intronic
1071633161 10:87231819-87231841 GGCTCTGCAGGGGCCGGGTGAGG + Intronic
1071646610 10:87364037-87364059 GGCTCTGCAGGGGCCGGGTGAGG + Intronic
1071950361 10:90696956-90696978 GGGTGTGGAGGCGCCTGCTGTGG + Intergenic
1074419897 10:113299550-113299572 GGCGCTGCAGGCGCCGGGAGCGG + Intergenic
1076548885 10:131264560-131264582 GGCTAAGCAAGAGCCTGGTGTGG - Intronic
1076558627 10:131346537-131346559 AGCCTTGCAGGCGTCTGGGGTGG - Intergenic
1077050019 11:562394-562416 GTCTGTGCAGCAGCCTGGTGTGG - Exonic
1077900007 11:6480451-6480473 GGCTTTGCAGGGTGCTGGGGTGG - Intronic
1078004976 11:7525832-7525854 GGCTTTGCACACTCCAGGTGTGG - Intronic
1078072683 11:8127996-8128018 GGCTTTGAAGCTGCTTGGTGTGG - Intronic
1080271364 11:30453926-30453948 GGCTTTGAGGGCTCCAGGTGTGG + Intronic
1081581756 11:44356923-44356945 GGCTTGGCTGGGGCCGGGTGTGG + Intergenic
1081722702 11:45301970-45301992 GCCTTTGGAGGCCCCAGGTGGGG - Intergenic
1083418088 11:62538212-62538234 GGCTTGGGCGGTGCCTGGTGGGG - Intronic
1083777795 11:64902677-64902699 GGCTCTGCAGGGGCGGGGTGGGG + Exonic
1085477308 11:76796557-76796579 TGCGGTGCCGGCGCCTGGTGCGG + Exonic
1091091299 11:132773496-132773518 GTCTCTGCAGGTTCCTGGTGAGG + Intronic
1096221229 12:49829108-49829130 GGCTCTGCAGGGGCCTGGATGGG - Intergenic
1096341733 12:50806505-50806527 GCCTGTGCAGCCTCCTGGTGGGG - Intronic
1096563204 12:52451783-52451805 GGCTTTGGTGGCGCCGGGAGTGG - Exonic
1096565356 12:52473442-52473464 GGCTTTGGTGGCGCCGGGAGTGG - Exonic
1096567376 12:52492893-52492915 GGCTTTGGTGGCGCCGGGAGTGG - Exonic
1097233723 12:57526575-57526597 GGCTTTGGAGGCAGCTGGTGGGG - Exonic
1099861411 12:88229191-88229213 GGCTGGGTAGGAGCCTGGTGAGG - Intergenic
1101482098 12:105107950-105107972 GGCTGCGCAGCCGTCTGGTGCGG + Intronic
1102005233 12:109585494-109585516 GGCAATGCAGGGGCCAGGTGCGG + Intronic
1102074416 12:110048439-110048461 GCCTCTGCAGCCTCCTGGTGGGG - Intronic
1104117076 12:125760017-125760039 GCCTTTGTAGGAGCCTTGTGAGG + Intergenic
1104838419 12:131807779-131807801 TGTTTTTCAGGGGCCTGGTGTGG - Intergenic
1104946157 12:132415722-132415744 GTCCTTGCAGGGGCCTGGTGGGG - Intergenic
1105026751 12:132853968-132853990 GGCTTTGCAGGCGCCTGGTGTGG - Intronic
1105612615 13:21982348-21982370 GGCTTTGCTTGGGCCTGCTGTGG + Intergenic
1108488508 13:50953611-50953633 GGCTTTGTAGGTGCCAGGTGTGG - Intronic
1110138070 13:72092573-72092595 GGCTGTGAAAGCGGCTGGTGGGG - Intergenic
1112923432 13:104643654-104643676 GGCTTTCCTGGCCCTTGGTGTGG + Intergenic
1113553394 13:111211190-111211212 TGCTTTGCAGGAGCCTGTTCTGG + Intronic
1114461386 14:22888156-22888178 GGCTTTGCAGGTGACAGCTGGGG - Intergenic
1114586374 14:23817520-23817542 GGCTTTGCAGGGACCTGCAGAGG + Intergenic
1117454529 14:55884128-55884150 TGCTTTTAAGGCGCCTGTTGTGG + Intergenic
1118410283 14:65470641-65470663 GGCTCAGCAGTCGCCTGATGTGG + Intronic
1118454837 14:65935112-65935134 GGCTTAGCAGGTGGCTGGGGAGG + Intergenic
1118642757 14:67807656-67807678 GGCTTTGCAGGGCCCTGATTCGG - Exonic
1119476721 14:74934780-74934802 GGCTTCGCAGGCCCCAGGAGAGG + Intergenic
1122316354 14:100827989-100828011 GGCGCAGGAGGCGCCTGGTGCGG + Intergenic
1123021311 14:105399049-105399071 GGCTTTCCAGGCTCCCGGGGTGG + Intronic
1128082000 15:64862304-64862326 GGCTTTCCAGGCCCCTGGAGGGG + Intronic
1128675886 15:69608084-69608106 GTCTCTGCAGGGGCCGGGTGTGG + Intergenic
1129352362 15:74963689-74963711 TGCTTTGCATTTGCCTGGTGTGG + Intronic
1129668179 15:77591430-77591452 GGCTCTGCCCGCTCCTGGTGAGG + Intergenic
1130897486 15:88182552-88182574 GGCTCTGCAGGAACCAGGTGGGG - Intronic
1131517941 15:93091666-93091688 GGCTTTCCCTGCGCCGGGTGTGG - Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132572860 16:651584-651606 AGCTGTGCAGATGCCTGGTGAGG - Intronic
1133891716 16:9885509-9885531 GCCTTTGTAGGTGGCTGGTGTGG - Intronic
1135395834 16:22131117-22131139 GGCTTTGCAGGCTTTTAGTGGGG - Intronic
1139676450 16:68526986-68527008 GGCTGCGCAGGAGCCTGGGGCGG - Intergenic
1141140025 16:81491244-81491266 GGCCTTACAAGAGCCTGGTGAGG + Intronic
1141911007 16:87058212-87058234 GGCTTTGCAGGCACGGGGAGTGG - Intergenic
1143189785 17:5033064-5033086 GGCATTGCTGGCAGCTGGTGTGG - Exonic
1144005719 17:11097274-11097296 GGATTTGCAGGAGACAGGTGGGG - Intergenic
1144853317 17:18254895-18254917 AGCTTGGCAGACGCCTGGTGGGG - Intronic
1145747073 17:27328301-27328323 AGCTGTGCAGGGGCCAGGTGCGG + Intergenic
1146783636 17:35698722-35698744 GGCTTTACAGGGGCAGGGTGGGG + Intronic
1147339733 17:39746265-39746287 GCCTCTGGAGGGGCCTGGTGAGG - Intronic
1149437535 17:56645776-56645798 GACTTAGCAGGCCACTGGTGTGG - Intergenic
1152366577 17:79860035-79860057 GCCTTTGCAGGCACCTGGAGGGG + Intergenic
1152782363 17:82231945-82231967 ACCTTTGCAGGCGCCTGGGGCGG + Intronic
1152809805 17:82376037-82376059 GCCTGTGCAGGCGGCTGGTCTGG + Intergenic
1152876799 17:82790923-82790945 GGCTTTGCAGGGACCTGAAGGGG - Intronic
1152911911 17:83010007-83010029 GGCTGTGGGGGCCCCTGGTGTGG + Intronic
1153854994 18:9136864-9136886 GGCTTTACAGGCGGCTGCAGCGG + Exonic
1155519706 18:26656488-26656510 GGCTTTAAAGGCGCCTGGGTGGG + Intronic
1157222384 18:45837440-45837462 GGGTTTCCAGGCCCCGGGTGCGG + Intronic
1157920221 18:51706828-51706850 GGGTTTGAAGGCTCATGGTGAGG - Intergenic
1160148571 18:76383460-76383482 GGCTGAGAAGGTGCCTGGTGTGG - Intronic
1160148583 18:76383502-76383524 GGCTGAGAAGGTGCCTGGTGGGG - Intronic
1160148596 18:76383544-76383566 GGCTGAGAAGGTGCCTGGTGGGG - Intronic
1160148624 18:76383627-76383649 GGCTGAGAAGGTGCCTGGTGGGG - Intronic
1160373259 18:78391432-78391454 GGCTGTGCAGGGCCGTGGTGTGG + Intergenic
1161327306 19:3670043-3670065 GCCTCTGCAGGCGGCAGGTGGGG + Intronic
1161327336 19:3670126-3670148 GCCTCTGCAGGCGGCAGGTGGGG + Intronic
1161388819 19:4010774-4010796 GGCCTTGCTGGTGCCTGGTAGGG + Intronic
1161400037 19:4063206-4063228 GGCTTTGCAGGCAGCAGCTGGGG + Intronic
1162133532 19:8542079-8542101 GGCTTTCCTGGGGCCTGCTGTGG + Intronic
1162578614 19:11514071-11514093 GTTTGGGCAGGCGCCTGGTGGGG - Exonic
1162788650 19:13051833-13051855 GCCTTAGCAGGTGCCTGGAGGGG + Intronic
1163584375 19:18155987-18156009 GGCCTTGCAGGCGCTGGGCGTGG + Exonic
1165193467 19:34082491-34082513 GGCCTTACAGGCGTCTTGTGTGG + Intergenic
1165367286 19:35376052-35376074 GGCTGTGCATATGCCTGGTGGGG + Intergenic
1165818764 19:38660875-38660897 GGCTTTGCGAGCGGGTGGTGAGG + Intronic
1165905597 19:39192749-39192771 GGCTTTGCAGGGCCCAGCTGTGG + Intergenic
1167338032 19:48898514-48898536 GCCTCTCCAGGCACCTGGTGAGG - Intronic
925196297 2:1928890-1928912 GGCTTCCCAGGCACCTGGAGTGG - Intronic
926795776 2:16617750-16617772 GGCCTGGCAGGACCCTGGTGTGG - Intronic
927491912 2:23526436-23526458 GGCTCTGCAGGGGCCGGGGGAGG + Intronic
929425476 2:41840770-41840792 GGCTTGCCAGGCTCCTGGAGAGG - Intergenic
930032753 2:47068589-47068611 GGTTCTGCAGGCCCATGGTGTGG + Intronic
934276102 2:91574016-91574038 TGCTGGGCAGGCTCCTGGTGTGG + Intergenic
934889784 2:98057150-98057172 GGCTATGCAGGCACCATGTGGGG - Intergenic
935740550 2:106143781-106143803 GGCTTTGAAGGAGCCATGTGCGG - Intronic
937071826 2:119069633-119069655 GGCTTTGCTGGGGCTTGGGGAGG + Intergenic
942044366 2:172090771-172090793 GTCTTTTCAGGCGCGCGGTGGGG + Intergenic
948518570 2:238521778-238521800 GGGTTTGCAGGAGCACGGTGTGG + Intergenic
948523817 2:238558485-238558507 AGCTCTGCAGGCGGCAGGTGTGG - Intergenic
1169080278 20:2794211-2794233 ACCTTCGCAGGCGCCTGGAGCGG - Exonic
1169794592 20:9448160-9448182 GTCTTTGCAGGCGATTAGTGGGG - Intronic
1170656206 20:18289308-18289330 GGATTCCCAGGCCCCTGGTGTGG + Intronic
1172141854 20:32728200-32728222 GGCTATGCAGTTGCCTGGGGTGG - Intronic
1172287105 20:33748499-33748521 GGTTTTGCACGCAGCTGGTGTGG - Intronic
1172525670 20:35599598-35599620 TGCTCTGCAGGCGCCAGGTGTGG + Intergenic
1175944577 20:62552704-62552726 GGCTTTGCAGGTGCCTGGGGGGG - Intronic
1176055168 20:63141415-63141437 GGCACTGCAGCCTCCTGGTGAGG + Intergenic
1178635975 21:34304149-34304171 GACTCTGCAGTCACCTGGTGTGG - Intergenic
1181217801 22:21344809-21344831 GGCTGGGCAGGCCCCGGGTGGGG - Intergenic
1183341889 22:37286092-37286114 GGCTTTGCAGGGGTTGGGTGGGG + Intronic
1184429311 22:44431966-44431988 GGCTGTGCAGGTGCTGGGTGAGG - Intergenic
1185205308 22:49534554-49534576 AGCTGTGCTGGCGCTTGGTGCGG - Intronic
950425558 3:12923161-12923183 GGCCCTGCAGATGCCTGGTGTGG + Intronic
950541361 3:13615170-13615192 GGGTCTGCAGGAGCCTGATGAGG + Intronic
951695427 3:25441244-25441266 TGCTTTGCAGGAGCCAAGTGAGG - Intronic
952214982 3:31269276-31269298 TGCTTTGCAGGAGCCAAGTGAGG + Intergenic
953694352 3:45146173-45146195 GGCTTTGGAGGCGGATGGCGTGG - Intronic
953999748 3:47546718-47546740 GGCTTTGCAGGAGGCTGAGGCGG + Intergenic
955411968 3:58661567-58661589 GACTTTGCAGAGGCCTCGTGTGG + Intronic
957322673 3:78652855-78652877 AACTTTGCAGGCCCCTTGTGTGG - Intronic
959085821 3:101849756-101849778 GGCGTCGCAGGCGCCCGGGGCGG - Exonic
959509100 3:107189516-107189538 GGCTCTGGAGGGCCCTGGTGTGG - Intergenic
960162409 3:114364969-114364991 TGATGTGCCGGCGCCTGGTGTGG + Intronic
961654494 3:128433635-128433657 GGCCTTGCAGCCACCTGGTGTGG + Intergenic
964824664 3:160811941-160811963 GGCTTGCCAGGCACTTGGTGTGG + Intronic
965241859 3:166211469-166211491 AGCTTTGCAGGGGCTAGGTGGGG - Intergenic
968571840 4:1346380-1346402 GGCTTCGGAGGAGCGTGGTGTGG - Intergenic
970040154 4:11787215-11787237 TCCTCTGCAGGTGCCTGGTGAGG + Intergenic
972675662 4:41257408-41257430 GGCTTCGCGGGCGCCACGTGTGG + Intronic
973637717 4:52875347-52875369 TGCTTTGCAAGGGCCTGGTTAGG + Intronic
975744634 4:77464322-77464344 TGCATTGCAGCAGCCTGGTGGGG - Intergenic
983512066 4:168619519-168619541 GGCTCTTCAGGTGCCTGGTCTGG + Intronic
989531538 5:42513495-42513517 GGCTTAGCAGGGGCCAGGCGCGG + Intronic
991181872 5:63761272-63761294 GGCTTTACAGGAGACAGGTGGGG + Intergenic
992802923 5:80309974-80309996 AGGAGTGCAGGCGCCTGGTGCGG - Intergenic
993952518 5:94194185-94194207 GGGTTAGCAGGAGCCTGGGGAGG - Intronic
994096307 5:95851189-95851211 GGCTTTGCAGGCGGCGCTTGCGG + Intergenic
998142563 5:139708493-139708515 GGCTTTGCAGGCCCCCTGAGGGG - Intergenic
999253640 5:150197033-150197055 GGCTGCGCCGGCGCCTGGTGTGG - Exonic
999382467 5:151131218-151131240 GGCTATGAAGGTGCGTGGTGGGG - Exonic
999722300 5:154407754-154407776 TTCTGTGCAGGGGCCTGGTGGGG + Intronic
1001086985 5:168707579-168707601 GGTTTGGCAGGGGCATGGTGGGG + Intronic
1001317293 5:170652904-170652926 GGTTTTGCAGGGGCAAGGTGGGG - Intronic
1004183494 6:13400992-13401014 GGCTCTCCAGGCACCTGTTGAGG - Intronic
1006463716 6:34178587-34178609 GCCTGTGCTGGCGCCTGGAGCGG - Intergenic
1006944767 6:37777973-37777995 GGCTTTGCAGGCTCATGGAGAGG - Intergenic
1010821963 6:80424937-80424959 GGCTTTGAAGCTGCTTGGTGTGG + Intergenic
1017914262 6:158819311-158819333 AGCACTGCAGGCGCCGGGTGAGG - Exonic
1019469144 7:1209029-1209051 AGCTTAGCTGGAGCCTGGTGCGG + Intergenic
1022739636 7:33109076-33109098 GGCCCGGCAGGAGCCTGGTGCGG - Intronic
1023874680 7:44280448-44280470 GGCTTTGGAGGCCCCTGATAAGG + Intronic
1024048763 7:45603416-45603438 GGCTTTGCATACTCCTGGTAGGG - Intronic
1026981677 7:74530291-74530313 GGCTAAGCAGGGGCCTGGGGAGG + Intronic
1033448996 7:141446344-141446366 GGCTTGGCAGGCGAGTGATGGGG - Intronic
1035317616 7:158006661-158006683 GGCTTGGGAGCCACCTGGTGTGG + Intronic
1036650174 8:10637044-10637066 GGCCTTGCAGTAGGCTGGTGAGG + Intronic
1040478185 8:47799324-47799346 GGCTGTGCAGGCGGCTGAGGAGG - Exonic
1041828376 8:62124309-62124331 GGCTTTGCAGGTGACTGCTGTGG - Intergenic
1046102255 8:109628707-109628729 GGCTATGCAGGAGCCTGAAGTGG + Intronic
1049167167 8:141133604-141133626 GGTCTTGCAGGTGCTTGGTGTGG + Intronic
1049252903 8:141598701-141598723 GGCCTTTCACCCGCCTGGTGGGG - Intergenic
1049664016 8:143835187-143835209 TGCTGTGCAGGCTCCTTGTGTGG + Exonic
1057354209 9:94321412-94321434 GGCTCTGCAGGGGCCGGGTGAGG - Intronic
1057653555 9:96936223-96936245 GGCTCTGCAGGGGCCGGGTGAGG + Intronic
1057916246 9:99057781-99057803 GGCTTGGCAGGAGCCAGGTATGG + Intronic
1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG + Intronic
1060392198 9:123287236-123287258 GGATTTGCAGGGGCCTGGGTCGG + Intergenic
1060911787 9:127357098-127357120 GGCTCTGCAGGAGCCTGGAGAGG + Intronic
1061283659 9:129610672-129610694 GGCTTTGGCGCCGCCTGGCGCGG - Intronic
1185608889 X:1382510-1382532 GTCTGTGCAGGCGCCTGGCCCGG - Exonic
1189456935 X:41199885-41199907 GCCTATTCATGCGCCTGGTGTGG - Intronic
1190268948 X:48847522-48847544 GGCCTTGCAGGGGCCTGGCCAGG + Intergenic
1199517805 X:148697760-148697782 GGGTCTGCAAGCACCTGGTGGGG + Intronic