ID: 1105027161

View in Genome Browser
Species Human (GRCh38)
Location 12:132856945-132856967
Sequence CTCGCTTGCCCAGGTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 9, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105027149_1105027161 15 Left 1105027149 12:132856907-132856929 CCGCCCTCACTTGTCTGGGTGCT 0: 1
1: 0
2: 2
3: 36
4: 233
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166
1105027151_1105027161 12 Left 1105027151 12:132856910-132856932 CCCTCACTTGTCTGGGTGCTGGT 0: 1
1: 1
2: 3
3: 25
4: 169
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166
1105027152_1105027161 11 Left 1105027152 12:132856911-132856933 CCTCACTTGTCTGGGTGCTGGTG 0: 1
1: 1
2: 4
3: 31
4: 195
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105027161 Original CRISPR CTCGCTTGCCCAGGTGCTGG TGG Intronic
900363784 1:2302271-2302293 CTTGCCAGCCCCGGTGCTGGAGG - Intronic
900405265 1:2490200-2490222 CTGGGTGGGCCAGGTGCTGGTGG - Intronic
901601240 1:10425116-10425138 ATCGCTTGCCCAGGAGGCGGAGG - Intergenic
902126088 1:14212684-14212706 CTGACTTGCACTGGTGCTGGTGG - Intergenic
904543414 1:31249476-31249498 ATCGCTTGACCAGGAGGTGGAGG - Intergenic
905010381 1:34742942-34742964 CTCACTTGCCGAGGTGTTAGGGG - Intronic
905649461 1:39646769-39646791 CTAGCTTTCCCAGGCCCTGGAGG + Intergenic
905866057 1:41377419-41377441 CTCCCTGGCCCAGGTTCTGAAGG + Intronic
905917400 1:41695271-41695293 CTTGCTTGCCCAGGGGGTTGTGG + Intronic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
907391385 1:54160634-54160656 CCCACTGGCCCAGGAGCTGGAGG - Intronic
908796342 1:67833765-67833787 CTCGCTTGCCCCTGTGCCAGCGG + Intergenic
911997770 1:104788471-104788493 CTGGCTTGCCGAGCTGCAGGTGG - Intergenic
916575513 1:166063409-166063431 CTCGCTTGCACAGGGGCAGGTGG + Intronic
918098227 1:181351644-181351666 TTGGCTTTCCCAGGTTCTGGTGG + Intergenic
918316622 1:183328053-183328075 CTCTCTGGCCCAAGTCCTGGAGG - Intronic
919978902 1:202630298-202630320 CTGGCTTGACCAGGTGCTGGAGG + Intronic
920303461 1:205003755-205003777 CTCGCCAGGCCAGGTGCAGGAGG - Intronic
922432743 1:225571670-225571692 CTCCCTTCCCCAGTTGTTGGCGG - Intronic
922563936 1:226589057-226589079 CTTGCTGGCCTAGGTCCTGGGGG + Intronic
923659797 1:235948126-235948148 CTCTATGGACCAGGTGCTGGTGG - Intergenic
924502357 1:244649650-244649672 CTTGCTTTCCCAGGTTCTAGAGG - Intergenic
1062842235 10:680328-680350 CTCGCTTGGCCCAGTGCTGCAGG - Intronic
1062920313 10:1274154-1274176 CTCGCCTGCCCATGTGCCGTGGG - Intronic
1062960522 10:1570380-1570402 CTCGCAGGTGCAGGTGCTGGGGG - Intronic
1063889436 10:10614580-10614602 CTCTCTTGCCGAGTTCCTGGTGG - Intergenic
1067346301 10:45441331-45441353 CTCCCCTCCCCAGCTGCTGGTGG + Exonic
1068983904 10:63089465-63089487 CTCTCTTTACCAGGTACTGGTGG + Intergenic
1069558940 10:69416185-69416207 CTACCTGGCCCTGGTGCTGGTGG - Exonic
1069760902 10:70810351-70810373 CTCTCTCCCCCAGGTGCTGCAGG + Intergenic
1069915607 10:71784878-71784900 CTGACTGGCCCAGATGCTGGTGG + Intronic
1070771532 10:79085257-79085279 CCAGCCTGCCCAGGTGCTGCAGG - Intronic
1070772081 10:79088408-79088430 CCAGCTTGCCATGGTGCTGGGGG + Intronic
1075404544 10:122186012-122186034 ATAGCTTGCCCAGGAGGTGGAGG - Intronic
1077609225 11:3634188-3634210 CACTCTTGGCCAGGTCCTGGGGG + Intergenic
1083886626 11:65576323-65576345 CCCGCTTGCCCACGCGCTGCAGG - Exonic
1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG + Intergenic
1088595326 11:111436716-111436738 CTTGCTGGCCCAGGGGCAGGCGG + Intronic
1088914973 11:114220624-114220646 CTCCCCAGACCAGGTGCTGGTGG + Intronic
1091901447 12:4147320-4147342 CTCGCATGGGCAGGTGCTTGTGG - Intergenic
1092121735 12:6049142-6049164 CTCGCTGGAGCAGGTGCTAGTGG - Intronic
1093876265 12:24352988-24353010 CTCACATGCCCAGGGGATGGGGG + Intergenic
1096037047 12:48481725-48481747 ATAGCCTGCCCAGGTGATGGTGG - Intergenic
1097695116 12:62768023-62768045 GTCCCTTTCACAGGTGCTGGGGG + Intronic
1100089533 12:90953914-90953936 GTCTCTTGCCCCGCTGCTGGTGG - Exonic
1100295678 12:93258683-93258705 CTCACATTCCCAGGTACTGGGGG - Intergenic
1103600161 12:122049785-122049807 CACTTTTGCCCAGGTGCAGGTGG + Intronic
1103644660 12:122381807-122381829 ATCACTTTCACAGGTGCTGGGGG - Intronic
1103701248 12:122849798-122849820 CTCTCGTGCCCAGGTCCTTGAGG + Intronic
1103807286 12:123583451-123583473 ATCACTTGCCCAGGAGTTGGAGG + Intergenic
1105027108 12:132856751-132856773 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027125 12:132856814-132856836 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027143 12:132856879-132856901 CTCACTTGCCTGGGTGCTGGTGG + Intronic
1105027153 12:132856912-132856934 CTCACTTGTCTGGGTGCTGGTGG + Intronic
1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG + Intronic
1105027180 12:132857008-132857030 CTCACGTGCCTGGGTGCTGGTGG + Intronic
1105027190 12:132857041-132857063 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027201 12:132857074-132857096 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027211 12:132857107-132857129 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027220 12:132857140-132857162 CTCACGTGCCCGGGTGCTGCTGG + Intronic
1105027230 12:132857172-132857194 CTCACGTGCCCAGGTGGTGGTGG + Intronic
1105027248 12:132857235-132857257 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027259 12:132857268-132857290 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027268 12:132857301-132857323 CTCACGTGCCCGGGTGCTGCTGG + Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1114849034 14:26360159-26360181 CTGGCTAGCACAGCTGCTGGTGG - Intergenic
1120871279 14:89339488-89339510 CACGCTTGCCCTGGTGCAGACGG - Intronic
1121741413 14:96254791-96254813 CTGCCTTGCCAAGGTGGTGGAGG - Intronic
1121794542 14:96724262-96724284 CTCTCTTGCCAAGGTTTTGGGGG - Intergenic
1122101306 14:99412403-99412425 CTTGCTTTCCCTGGTGCTGTGGG - Intronic
1124494502 15:30178185-30178207 CTGGCTTGACCAGGTGCTGGAGG + Intergenic
1124749068 15:32360460-32360482 CTGGCTTGACCAGGTGCTGGAGG - Intergenic
1128016944 15:64356081-64356103 CTCTCTTTCCCAGGAGCGGGAGG + Exonic
1129021339 15:72521896-72521918 GGCACTTGCCCAAGTGCTGGGGG - Intronic
1131121968 15:89828434-89828456 CTGGCTTGCCTCGGTGCTGCTGG + Intergenic
1131179635 15:90231013-90231035 CTCCCTTTCCCAGATCCTGGAGG - Exonic
1132518359 16:376336-376358 CACTCCTGCCCAGGTCCTGGTGG + Exonic
1132870175 16:2112373-2112395 CTCGGTGGCCCAGGTGCTGGTGG - Exonic
1133131654 16:3679820-3679842 CCCGGCTCCCCAGGTGCTGGGGG - Intronic
1134504231 16:14792114-14792136 CTCTCTTGTCCAATTGCTGGGGG + Intronic
1134522368 16:14924583-14924605 CTCGGTGGCCCAGGTGCTGGTGG + Intronic
1134576342 16:15336794-15336816 CTCTCTTGTCCAATTGCTGGGGG - Intergenic
1134710038 16:16323234-16323256 CTCGGTGGCCCAGGTGCTGGTGG + Intergenic
1134717253 16:16363234-16363256 CTCGGTGGCCCAGGTGCTGGTGG + Intergenic
1134941332 16:18292153-18292175 CTCTCTTGTCCAATTGCTGGGGG - Intergenic
1134949565 16:18345411-18345433 CTCGGTGGCCCAGGTGCTGGTGG - Intergenic
1134957499 16:18388925-18388947 CTCGGTGGCCCAGGTGCTGGTGG - Intergenic
1138658644 16:58504674-58504696 CTGGCTTGCCCTGGTGTTTGGGG - Intronic
1141186879 16:81794078-81794100 CTTGCTCTGCCAGGTGCTGGAGG + Intronic
1141663705 16:85454923-85454945 GTCGCCTGCCCAGGTGCGGAGGG + Intergenic
1141666286 16:85467121-85467143 CATGCTCGCCCAGCTGCTGGAGG - Intergenic
1141707258 16:85673691-85673713 TTAGCTTGTCCAGATGCTGGGGG - Exonic
1144767208 17:17739344-17739366 TTCGCTTCCCCAGCTCCTGGGGG - Intronic
1144842210 17:18194191-18194213 CTCTGTTGCCCAGGTGCAGTGGG + Intronic
1145258017 17:21338105-21338127 CTCCACAGCCCAGGTGCTGGAGG - Intergenic
1148382564 17:47210346-47210368 CTCTCTGGCCCAGCTGCTGAAGG + Intronic
1149535512 17:57430709-57430731 TTCCCTGGCCCATGTGCTGGTGG + Intronic
1149535710 17:57431843-57431865 CTGACTTGCCCAAGTGCAGGTGG - Intronic
1151558615 17:74859610-74859632 CTAGCTTGCCCCACTGCTGGGGG + Intronic
1152241548 17:79163809-79163831 CCTCCTTGCCCAGGTGCTGTGGG + Intronic
1152558717 17:81067358-81067380 TTCCCCTGCTCAGGTGCTGGAGG - Intronic
1152921201 17:83067440-83067462 CTCGCCTGCCCAGGTGGTGTGGG + Intergenic
1153167507 18:2279528-2279550 GCAGCTTGGCCAGGTGCTGGGGG + Intergenic
1153984402 18:10340063-10340085 TTCCCTTGCTCAGGTGCTGAAGG + Intergenic
1160052977 18:75454704-75454726 CTCGCCTGCCCAGGAACAGGGGG + Intergenic
1160865898 19:1255783-1255805 CTGACCTGCCCAGGGGCTGGGGG + Intronic
1161301413 19:3544677-3544699 TTCCCTTGCACAGGTGCAGGAGG + Exonic
1161800164 19:6412924-6412946 CTTGCTCCCCAAGGTGCTGGAGG + Intergenic
1162300681 19:9843142-9843164 CTCACATGCCCAGGGCCTGGAGG + Intronic
1162586930 19:11565632-11565654 CCCTCGAGCCCAGGTGCTGGAGG - Intronic
1164649350 19:29880873-29880895 CACCCTGGCCCTGGTGCTGGAGG + Intergenic
1166893354 19:46008158-46008180 CTGGCTTGCCCTGGTACGGGAGG - Exonic
1167504455 19:49863751-49863773 CTCCCATCCACAGGTGCTGGTGG - Exonic
925190389 2:1877593-1877615 CTCCCTTGGCCAAGTGCTGATGG - Intronic
925867150 2:8238330-8238352 CTAGGTTGCACAGCTGCTGGAGG - Intergenic
929832185 2:45356135-45356157 GTCCCTGGCCCAGGTCCTGGTGG - Intergenic
930619034 2:53625263-53625285 CTCCCTTGCCCAGGTTAGGGAGG + Intronic
931630097 2:64290808-64290830 CTCGCTTGCCAAGGTTCTGCAGG + Intergenic
932316886 2:70790557-70790579 CCCGCAAGCCGAGGTGCTGGAGG - Exonic
934486500 2:94717865-94717887 ATTGCTTGCCCAGGAGGTGGGGG + Intergenic
936316317 2:111427519-111427541 CACCCTTGCCCAGGTGCAAGGGG - Intergenic
941677287 2:168357279-168357301 CTGGCTTGACCAGCTGCTGCAGG + Intergenic
945492846 2:210476502-210476524 CTCGATGGCCCTGGAGCTGGAGG - Exonic
1172162129 20:32876059-32876081 CCTGCTTCCTCAGGTGCTGGAGG + Intronic
1175474414 20:59260759-59260781 CACTCTTTCCCAGGTGCTGCAGG - Intergenic
1176167557 20:63682020-63682042 CTCGCCTGGCCATGTGCTGGAGG - Intronic
1179488533 21:41726253-41726275 CTCCCTTTCCCAGGAGCTGACGG + Intergenic
1179563937 21:42234803-42234825 CTCGCGCGCGCAGGTGCGGGCGG + Intronic
1179988405 21:44933200-44933222 GTGGCTTGGGCAGGTGCTGGGGG + Intronic
1181037049 22:20174747-20174769 CTCGCCCACCCAGGAGCTGGGGG + Intergenic
1181719818 22:24764927-24764949 CTCGCTTGCCCTCGTGCCTGGGG + Intronic
1181872643 22:25912310-25912332 CTCTCTTGCCCTGATGCTGAAGG - Intronic
1182279510 22:29209628-29209650 CTCACTCACGCAGGTGCTGGAGG - Intronic
1182894182 22:33845176-33845198 CTGGGTTTCCCAGGGGCTGGGGG - Intronic
1183391087 22:37546062-37546084 CTGGCTTGACCAGGCTCTGGCGG - Intergenic
1183700428 22:39448124-39448146 CTCGCTGGCCCAGGTCCAGCTGG + Intergenic
1185204179 22:49528459-49528481 CTCACCTGCCCAGGTGGAGGGGG - Intronic
1185228781 22:49668360-49668382 CACGCTTCTGCAGGTGCTGGGGG - Intergenic
953280394 3:41548687-41548709 ATGGCTTGCTCAGGTCCTGGAGG - Intronic
955717023 3:61840865-61840887 ATTGCTTGCCCAGGTGGTGGAGG - Intronic
959592107 3:108091821-108091843 CTCGCTAGTCCCGGTGGTGGCGG - Intergenic
961436840 3:126924944-126924966 CTCACTTGCTCAGGAGCTGCTGG + Intronic
966100408 3:176262276-176262298 CCCGCTTGCCAAGCTGCGGGTGG - Intergenic
967186003 3:186945220-186945242 ATCCCTTGCCCAGGAGCTCGGGG + Intronic
968691250 4:1991592-1991614 CTCGCTTAACCTGGAGCTGGAGG - Exonic
969196272 4:5566291-5566313 CACACCTGCCCAGGTGGTGGTGG + Intronic
969308193 4:6337407-6337429 CTCACCTGGGCAGGTGCTGGGGG - Intronic
969371252 4:6732923-6732945 CTCCCTGGGCCAGGAGCTGGAGG - Intergenic
970913914 4:21310387-21310409 ATCACTTGCCCAGGTGCTCCTGG + Intronic
974113343 4:57550897-57550919 CTCGTTAGCCCAGGAGGTGGAGG - Intergenic
984363712 4:178771080-178771102 CTCCTTTGCCCAGCTGCTGTGGG + Intergenic
988828700 5:34967269-34967291 GTGGCATGCTCAGGTGCTGGTGG + Intergenic
998041975 5:138956327-138956349 CTTGCTTTCCCAGATGATGGAGG - Intronic
1001270456 5:170307336-170307358 CTCGCTTTCCCCGGTTCTAGAGG - Intergenic
1002389211 5:178896163-178896185 CCCTCTTCCCCAGGAGCTGGCGG + Intronic
1004987608 6:21100382-21100404 CTCACATACCCAAGTGCTGGAGG - Intronic
1006611462 6:35296801-35296823 CTCTCTTCCCAAGGAGCTGGTGG - Intergenic
1006740206 6:36302506-36302528 CTCGCTTGCCAAGGGGCTCCAGG - Intronic
1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG + Intergenic
1012864397 6:104600530-104600552 CTCTCTCTCCAAGGTGCTGGGGG + Intergenic
1017061590 6:150490229-150490251 CCCGCTGGTCCAGCTGCTGGGGG - Intergenic
1017900643 6:158715993-158716015 TTCACTGGCCCAGGTGCTGAAGG + Intronic
1019149137 6:169992861-169992883 CCCGCCTGGCCGGGTGCTGGAGG - Intergenic
1019204109 6:170344631-170344653 CGGACTTGCCCAGGTGGTGGCGG - Intronic
1019708003 7:2505561-2505583 CTCGCTGGCCCAGGGCCTGGTGG + Intergenic
1019777586 7:2921840-2921862 CCCGCCTGCCCCGGAGCTGGGGG + Intronic
1021058340 7:16078441-16078463 CTCATTTGATCAGGTGCTGGGGG + Intergenic
1021653458 7:22853497-22853519 GTCGCATTCACAGGTGCTGGAGG + Intergenic
1030351093 7:108488486-108488508 ATTGCTTGCCCAGGAGGTGGGGG + Intronic
1031380789 7:121083596-121083618 CCTGATTGCACAGGTGCTGGAGG + Intronic
1039250972 8:35663552-35663574 CTGGCATGCTCTGGTGCTGGTGG + Intronic
1040654557 8:49491281-49491303 CTCACTTTCCCAGCTGCTTGGGG - Intergenic
1041215617 8:55597164-55597186 CTCCCTTGTCCAGGTGTTAGTGG + Intergenic
1049438164 8:142597202-142597224 CTCTCATGCTCAGGTGCAGGGGG + Intergenic
1049859313 8:144887414-144887436 CTCGCTTGCTCTGATGCTAGTGG + Intronic
1050439809 9:5650161-5650183 ATGGCTTGCTTAGGTGCTGGTGG + Intronic
1050892648 9:10843910-10843932 ATCGCGTGCCCAGGAGATGGAGG - Intergenic
1053512620 9:38701593-38701615 CTCGCTTCCCCAGCTCCTGGTGG + Intergenic
1053671298 9:40366460-40366482 ATTGCTTGCCCAGGAGGTGGGGG - Intergenic
1053921108 9:42992834-42992856 ATTGCTTGCCCAGGAGGTGGGGG - Intergenic
1054513317 9:66009850-66009872 ATTGCTTGCCCAGGAGGTGGGGG + Intergenic
1056557096 9:87698581-87698603 CTCTCCTGCCCAGGTGAGGGCGG - Intronic
1057312789 9:93952341-93952363 CTGGCTCACCCAGGTGCTGGCGG - Intronic
1058668660 9:107342473-107342495 CTCCCCTGCCCAGGGGCTGCAGG - Intergenic
1061008670 9:127942706-127942728 TTCCCTTGCCCTGGTGGTGGGGG - Exonic
1061727597 9:132589980-132590002 GCCGCTGGCCCAGGTGCTCGAGG - Exonic
1062399360 9:136365698-136365720 CTGGTCTGCCCAGGTCCTGGCGG - Intronic
1185734874 X:2489009-2489031 GTGGCATGCCCAGGTGGTGGAGG - Exonic
1185765353 X:2721377-2721399 CTCTCTAGCCCAGGAGTTGGAGG - Intronic
1187366355 X:18668806-18668828 CGTGGTTGCCCAGGGGCTGGGGG + Intronic
1190924317 X:54888270-54888292 CTCCCTTGGCCAGGGGATGGGGG - Intergenic
1192345295 X:70298312-70298334 ATCGCTTGAGCAGGAGCTGGAGG - Intronic
1195087205 X:101423758-101423780 CTCCCTTCCCCAGAGGCTGGGGG - Intronic
1200553498 Y:4606751-4606773 CTGTGTTTCCCAGGTGCTGGGGG + Intergenic