ID: 1105027161

View in Genome Browser
Species Human (GRCh38)
Location 12:132856945-132856967
Sequence CTCGCTTGCCCAGGTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 9, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105027152_1105027161 11 Left 1105027152 12:132856911-132856933 CCTCACTTGTCTGGGTGCTGGTG 0: 1
1: 1
2: 4
3: 31
4: 195
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166
1105027149_1105027161 15 Left 1105027149 12:132856907-132856929 CCGCCCTCACTTGTCTGGGTGCT 0: 1
1: 0
2: 2
3: 36
4: 233
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166
1105027151_1105027161 12 Left 1105027151 12:132856910-132856932 CCCTCACTTGTCTGGGTGCTGGT 0: 1
1: 1
2: 3
3: 25
4: 169
Right 1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG 0: 1
1: 0
2: 9
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105027161 Original CRISPR CTCGCTTGCCCAGGTGCTGG TGG Intronic