ID: 1105031441

View in Genome Browser
Species Human (GRCh38)
Location 12:132887256-132887278
Sequence ACGGCTCCTGCGTCTGGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105031441_1105031456 30 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031456 12:132887309-132887331 CCTTCCTCGGGCCGCTCCATCGG 0: 1
1: 0
2: 0
3: 2
4: 61
1105031441_1105031447 -6 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031447 12:132887273-132887295 AGCCGTCCCCAGGGCTGCGGCGG 0: 1
1: 0
2: 5
3: 23
4: 188
1105031441_1105031453 17 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031453 12:132887296-132887318 CGGCGACTGCTTGCCTTCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 140
1105031441_1105031449 -3 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031449 12:132887276-132887298 CGTCCCCAGGGCTGCGGCGGCGG 0: 1
1: 0
2: 1
3: 25
4: 293
1105031441_1105031446 -9 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031446 12:132887270-132887292 AGGAGCCGTCCCCAGGGCTGCGG 0: 1
1: 0
2: 2
3: 39
4: 309
1105031441_1105031454 18 Left 1105031441 12:132887256-132887278 CCGCGCCCAGACGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1105031454 12:132887297-132887319 GGCGACTGCTTGCCTTCCTCGGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105031441 Original CRISPR ACGGCTCCTGCGTCTGGGCG CGG (reversed) Exonic
900539473 1:3195723-3195745 AGGGCTTCTGCGTGGGGGCGTGG + Intronic
900657932 1:3769253-3769275 ACGCCTTCTGGGTCTGTGCGCGG + Intronic
905630683 1:39516490-39516512 ACGGGACCTGGATCTGGGCGGGG + Intronic
905667078 1:39769680-39769702 ACGGGACCTGGATCTGGGCGGGG - Exonic
907137741 1:52155522-52155544 ACAGCTCCTGTGGCCGGGCGTGG - Intronic
909001339 1:70221300-70221322 ACGGCTGCTGGGCCTGCGCGGGG + Intronic
913131011 1:115838566-115838588 CCGGCTCCCGCGCCAGGGCGAGG - Exonic
914490940 1:148149676-148149698 ACAGCCCCTGGGTCGGGGCGGGG - Intronic
914512343 1:148345241-148345263 AAGGCTCCTGGGTCTGGGGCGGG + Intergenic
914940016 1:152014342-152014364 AAGGCTCCTGGGTCTGGGGCGGG - Intergenic
915731741 1:158058902-158058924 TCGGCTGCGGCGTCTGGGAGAGG - Intronic
922777755 1:228224550-228224572 ACGTCACCTCCGTCTGGGCCTGG - Exonic
922779981 1:228244387-228244409 ACGTCACCTCCGTCTGGGCCTGG - Exonic
1063187366 10:3663591-3663613 ACAGCTCCTGCCTCTGGGAAAGG + Intergenic
1063187389 10:3663685-3663707 ACAGCTCCTGCCTCTGGGAAAGG + Intergenic
1063187411 10:3663779-3663801 ACAGCTCCTGCCTCTGGGAAAGG + Intergenic
1064151740 10:12871358-12871380 ATGGCTCCTGGGCCTGGGTGAGG - Intergenic
1069742069 10:70691115-70691137 ACAGGTCCTGCCTCTGGGCCAGG + Intronic
1071651757 10:87399045-87399067 ACTGCTCCTGCATTTGGGTGGGG + Intergenic
1072588347 10:96803146-96803168 ACGGCTCAGGAGTCTGGGTGGGG - Intergenic
1074056058 10:109923592-109923614 GCGGGGCCTGCGTGTGGGCGGGG - Intergenic
1076866468 10:133168773-133168795 ACAGCTCCTGGGTATGGGCGTGG + Intronic
1083572852 11:63769249-63769271 ACGGCTCCACCCTCTCGGCGGGG - Intergenic
1087113201 11:94493948-94493970 TTGGCTCCTGCGTGAGGGCGGGG - Exonic
1089605450 11:119638772-119638794 AAGGCTCCGGCTTCTGGGAGAGG + Intronic
1104718908 12:131033787-131033809 ACGGCTGCTGCGTCTGCTAGGGG + Intronic
1105031441 12:132887256-132887278 ACGGCTCCTGCGTCTGGGCGCGG - Exonic
1112653639 13:101425220-101425242 ACTGCCCCTGCGTCAGGGTGGGG - Intergenic
1119171550 14:72539661-72539683 AGGGCTCCTGCCTGTGGGCACGG + Intronic
1121639290 14:95474611-95474633 ATGGCTCCTGCCTCTGGATGAGG + Intronic
1123739755 15:23225737-23225759 ACGGCCCCTGGATCCGGGCGGGG + Intergenic
1124290980 15:28454710-28454732 ACGGCCCCTGGATCCGGGCGGGG + Intergenic
1129756633 15:78102934-78102956 ACGGCTCCTCCCTCAGGGCAGGG + Intronic
1131958052 15:97758996-97759018 ACCACTCCTCCGGCTGGGCGCGG + Intergenic
1132333116 15:101026214-101026236 AGAGCTCCTGAGTCTGGGTGGGG + Intronic
1132896798 16:2233132-2233154 ACAGCTCCTGCATCTGGACGTGG - Exonic
1133904369 16:10008167-10008189 ACGGCTCCTGCTTCTAAGAGAGG + Intronic
1136707783 16:32202934-32202956 ACGGCCCCTGGGTTGGGGCGGGG - Intergenic
1136760126 16:32726477-32726499 ACGGCCCCTGGGTTGGGGCGGGG + Intergenic
1136807978 16:33143909-33143931 ACGGCCCCTGGGTTGGGGCGGGG - Intergenic
1140195076 16:72848749-72848771 AGTGGTCCTGGGTCTGGGCGTGG - Intronic
1140959274 16:79896754-79896776 AAGGCTTCTGCGGCTGGGTGTGG + Intergenic
1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG + Intronic
1141987465 16:87589227-87589249 ACGCTGCCTGCGTCTGGGCAGGG - Intergenic
1203062282 16_KI270728v1_random:986799-986821 ACGGCCCCTGGGTTGGGGCGGGG + Intergenic
1145191561 17:20844367-20844389 ACAGCCCCTGGGTCGGGGCGGGG - Intronic
1150715412 17:67568689-67568711 ACAGCTCCTGAGTTTGGGGGTGG + Intronic
1152630532 17:81408837-81408859 CAGGCTCCTGAGTCTGGGGGTGG + Intronic
1160994646 19:1877069-1877091 ACAGCCCCTGGGTCGGGGCGGGG + Exonic
1161297810 19:3528441-3528463 ACGGCTCCTGCTGCCGGGAGAGG - Intronic
1163748807 19:19063576-19063598 ACGGCCGCTGCGACTGGCCGCGG + Intergenic
1164562120 19:29299609-29299631 ATGGCGCGTGCGTCTGGCCGTGG - Intergenic
1164992028 19:32691790-32691812 ACGGCGCCTGCCTGTGGGAGGGG - Intergenic
1166297257 19:41895208-41895230 AGGGCTCCTGGGTCTGAGGGAGG + Intronic
1166315028 19:41984888-41984910 CAGGCTCCTGGGTCTGGGTGGGG - Intronic
1166739218 19:45104071-45104093 AAGGCGCCTGCGTCTAGGCGTGG - Intronic
1166895150 19:46018173-46018195 ACGGGTCCTGGGGCTGGGAGAGG - Intronic
1168687837 19:58358977-58358999 ACTGCTCCTGCGTGTAGGCCTGG + Intronic
928155229 2:28870404-28870426 ACTGCGCCTGCGTCGGGGAGGGG + Intergenic
942360735 2:175168638-175168660 CCGGCTCCTGGGGCTGGGCTCGG - Intergenic
948593343 2:239064810-239064832 ACGCCTCCTGCACATGGGCGTGG - Intronic
1170095579 20:12642417-12642439 AGGGCTGCTGCTTCTGGGCAGGG + Intergenic
1171499786 20:25585020-25585042 ACGCCGCCGGCGTCTGGTCGAGG - Intronic
1175820404 20:61906070-61906092 GCGGCCCCTGCGTCTGGCCTGGG - Intronic
1176159798 20:63642287-63642309 GCGCCTCCTGCGTCTGTGCGGGG + Exonic
1184645411 22:45892305-45892327 GAGGCTGCTGCGTGTGGGCGAGG - Intergenic
954791162 3:53134639-53134661 CCGCCTCCTGCGTCTGTGCCAGG + Intergenic
960664487 3:120095621-120095643 ATGGCCCCCGCGGCTGGGCGGGG - Intergenic
968015488 3:195328787-195328809 ATGTCTCTTGCGGCTGGGCGTGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969321803 4:6417150-6417172 ACGGGTCCAGCCCCTGGGCGGGG + Intronic
979122838 4:116925965-116925987 ACGGCTCGGGTTTCTGGGCGAGG + Intergenic
982235678 4:153249287-153249309 TCGGCTCCCGCCTCGGGGCGGGG + Intronic
987191830 5:15486593-15486615 CCTGCTCCTGTGTCTGGGTGGGG - Intergenic
993891386 5:93478690-93478712 ACTGCTCCTTTGGCTGGGCGCGG - Intergenic
1003115062 6:3278095-3278117 ATGGCTCCAGAGTCTGGGCACGG - Intronic
1006427567 6:33975867-33975889 ACAGCACCCGCGTCTGCGCGGGG + Intergenic
1007709080 6:43810290-43810312 AGGGCTCCTGGGGCTGGGCTGGG + Intergenic
1012916906 6:105180070-105180092 GCGGCGGCTGCGTCTGGGCCGGG + Intergenic
1013349254 6:109290756-109290778 ACGGGGCCTGGGTCTGGCCGGGG - Intergenic
1019211296 6:170407443-170407465 CCGGCTCCCACGTCTGGGCTTGG + Intergenic
1019421065 7:951440-951462 AAGGCTGCTGAGTGTGGGCGGGG - Intronic
1019525431 7:1478477-1478499 GGGGCTCCTGCGCCTGGCCGAGG - Exonic
1019617749 7:1973898-1973920 ACTGCTCCTGTGTCTGTGCTGGG - Intronic
1023659507 7:42458014-42458036 ATGGCTGCTGCTTCTGGGAGAGG - Intergenic
1023883848 7:44336662-44336684 ACGGCACCGGAGTCTGGGCAGGG + Intergenic
1024053392 7:45644341-45644363 ACGGGTCCTGGGGCTGGGCAGGG + Intronic
1024509321 7:50190695-50190717 ACAGCACCTGCCTCTGGGCATGG + Intergenic
1029495755 7:100894997-100895019 CCGGCTCCTGGCTCGGGGCGGGG - Intronic
1032474867 7:132204724-132204746 AGGGCTACTGCCTCTGGGCAGGG + Intronic
1033492352 7:141855727-141855749 ACGGTTCCTGCCTCTGTGTGGGG - Intergenic
1034930978 7:155163940-155163962 ACGGCTCCTGGCTCTGGTGGAGG - Intergenic
1037803611 8:22048159-22048181 ACTGCTTCTGCTTCTCGGCGTGG - Exonic
1037817339 8:22119135-22119157 CCCGCTCCTGCCTCTGGCCGAGG + Intronic
1038000172 8:23384622-23384644 AAGGCTCCAGCGGCCGGGCGTGG + Intronic
1044812973 8:96082929-96082951 AAGACTCTTGCGGCTGGGCGTGG + Intergenic
1044965722 8:97571820-97571842 ATGGCTGCTGTGGCTGGGCGTGG + Intergenic
1049710782 8:144062427-144062449 GGGGCTCCTGCATGTGGGCGTGG - Intronic
1056568240 9:87793708-87793730 ATGGCTCCTGCATTTGGGTGAGG + Intergenic
1062035472 9:134380756-134380778 CCGGCACCTGGGTCTGGCCGAGG + Intronic
1062732970 9:138119803-138119825 ACGGGTCCTGATTCTGGCCGTGG + Intronic
1192146731 X:68687724-68687746 AAGGCTCCTGGGTCAGGGCCAGG - Intronic
1198330909 X:135621621-135621643 GAGGCTCCTGGGTCTGGGCAAGG + Intergenic
1198336017 X:135667374-135667396 GAGGCTCCTGGGTCTGGGCAAGG - Intergenic
1198363514 X:135918353-135918375 GAGGCTCCTGGGTCTGGGCACGG + Intergenic
1200073897 X:153541965-153541987 TCGGCTCCTGCTTCTGGGGAGGG + Intronic