ID: 1105032639

View in Genome Browser
Species Human (GRCh38)
Location 12:132894805-132894827
Sequence ATCTGTAATATGGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 4, 1: 25, 2: 16, 3: 21, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105032639 Original CRISPR ATCTGTAATATGGAGCTGGA AGG (reversed) Intronic
900543811 1:3217490-3217512 ATCTGGAATAAGGAGCAGAAAGG - Intronic
900841391 1:5051341-5051363 GTCTGTAATATGGAGCTGGAAGG - Intergenic
900862121 1:5241267-5241289 ATCTGTCCTATGGAGAAGGAGGG + Intergenic
904420581 1:30388504-30388526 ATCTGTAAAATGGAGATGATTGG + Intergenic
905118914 1:35666736-35666758 ATCTGTACTTTGGAGATGGGAGG - Intergenic
905147538 1:35899664-35899686 CTCTGGAATATGGAGTTTGAAGG + Intronic
906526391 1:46495732-46495754 ATCTGTAAGATGGGGATGGCAGG + Intergenic
907504623 1:54908926-54908948 ATCTGTAATATGGAGCTGGAAGG + Intergenic
907667797 1:56448705-56448727 ATCTGTAAAATGGAGTTGTGTGG + Intergenic
907935650 1:59039820-59039842 ATTAGTCATATGCAGCTGGAGGG + Intergenic
910346654 1:86246621-86246643 ATCTGCAATGTGGAGATGCATGG - Intergenic
910470893 1:87551716-87551738 AGCTTGAATATGGAGGTGGAAGG + Intergenic
911316277 1:96360371-96360393 ATCTGTAAAATGGTGATGAATGG - Intergenic
911759386 1:101598894-101598916 GTCTGTAATACGGAGCTGGAAGG + Intergenic
912708363 1:111931611-111931633 ATCTGTAAAATGGAGTAAGACGG + Intronic
915507281 1:156365990-156366012 AGCTGGAATCTGGAGATGGAAGG + Intronic
915790363 1:158663076-158663098 ATCAGTGAAATGGAGTTGGAAGG + Intronic
916168453 1:161983375-161983397 ATCTGAGACTTGGAGCTGGAGGG + Exonic
918427766 1:184427689-184427711 ACCTATATTTTGGAGCTGGAGGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921520601 1:216150905-216150927 GTCTGTAATATGGAGCTGGAAGG - Intronic
921691290 1:218153667-218153689 TTATGTAAGATGGAGTTGGAGGG + Intergenic
923075765 1:230607361-230607383 GTCTGTAATATGGAGCTGGAAGG - Intergenic
923299379 1:232627546-232627568 CTGTGTAATATGGATTTGGAAGG - Intergenic
1062931182 10:1353772-1353794 GTCTGTTATACGGAACTGGAAGG - Intronic
1065033293 10:21610396-21610418 ATCTGTCATAGGGAGCTGTTGGG + Intronic
1065769027 10:29059536-29059558 ATCTTTAAGACAGAGCTGGAAGG - Intergenic
1067714325 10:48677071-48677093 ATATGTCATATCGAGCTGCAAGG - Intergenic
1068604269 10:58988453-58988475 ACCTGTGGGATGGAGCTGGAAGG - Intergenic
1073351421 10:102822699-102822721 ATCTGTAATATGGCGGGGGCGGG - Intergenic
1073531169 10:104233032-104233054 ATCTGTAAAATGGGGCTGATGGG - Intergenic
1073709101 10:106018484-106018506 GTCTGTAATATGGAGCTGGAAGG + Intergenic
1074304794 10:112267188-112267210 AACTGGAATATGTAGTTGGAAGG - Intergenic
1074653828 10:115558903-115558925 ATCTGCAAAAGGGAGCTGGGGGG - Intronic
1077491760 11:2864241-2864263 CTCAGTGATGTGGAGCTGGAGGG - Intergenic
1077580359 11:3413551-3413573 ATCTATAAAATGGAGGTGGTGGG - Intergenic
1080337814 11:31219242-31219264 ACCTGTAAAAAGAAGCTGGAGGG + Intronic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1082118687 11:48355829-48355851 TTCTGGAATATGGAGCTGTGGGG + Intergenic
1082255637 11:50029478-50029500 TTCTGGAATATGGAGCTGTGGGG - Intergenic
1083152265 11:60799131-60799153 ATCTGTAAAGTGGAGGTGCAAGG + Intronic
1083404666 11:62448326-62448348 GGCTGAAATGTGGAGCTGGATGG + Intronic
1083534800 11:63457768-63457790 GTCTGTAATACAGAGCTAGAAGG - Intergenic
1083668938 11:64289837-64289859 ATCAGTAATGTGGAGCTGTGGGG - Intergenic
1084237286 11:67796379-67796401 ATCTATAAAATGGAGGTGGCAGG - Intergenic
1084354835 11:68631089-68631111 GTCTGTAATACAGAGCTGGAAGG - Intergenic
1086005409 11:82030075-82030097 GTCTGTAATACGGAGCTGGAAGG - Intergenic
1086901611 11:92373905-92373927 ATCTGTAAGCTGGAGAAGGAGGG + Intronic
1087197525 11:95316028-95316050 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1087955029 11:104275815-104275837 ATCTGTCATATGCAACTGGAAGG - Intergenic
1088828268 11:113513954-113513976 ATCTGTTGGCTGGAGCTGGAAGG + Intergenic
1090358018 11:126153637-126153659 ATCTGTAAAATGGAGATGAGGGG + Intergenic
1091046531 11:132330573-132330595 CTCTCTAACTTGGAGCTGGAAGG + Intronic
1091240113 11:134046441-134046463 AGCTGTAACGTGGGGCTGGAAGG + Intergenic
1091480482 12:824378-824400 ATTTGTAATATGGAGCAGATTGG + Intronic
1092407952 12:8233972-8233994 ATCTATAAAATGGAGGTGGTGGG - Intergenic
1092580474 12:9835629-9835651 TTCTGTAATACGGAGCTGGAAGG + Intronic
1093679966 12:21991004-21991026 AACTGTAAAATGGAGCTGTTTGG - Intergenic
1093922910 12:24879934-24879956 GTCTTTAAAATGGGGCTGGAAGG - Intronic
1094723543 12:33089565-33089587 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1094826392 12:34272454-34272476 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1095806128 12:46322961-46322983 GTCTGTAATACGGAGCTGGAAGG + Intergenic
1099017488 12:77361487-77361509 ATTTGTGATAAGGAGCTGGGGGG + Intergenic
1099591945 12:84603476-84603498 ATCTGTAACAGGGAGCTGGGAGG + Intergenic
1100781836 12:98035208-98035230 CTCAGCAACATGGAGCTGGAAGG + Intergenic
1104035139 12:125092618-125092640 ATCTGTACTGTGTGGCTGGATGG + Intronic
1104369912 12:128215404-128215426 TTCTGTTATTTGCAGCTGGAAGG + Intergenic
1105032639 12:132894805-132894827 ATCTGTAATATGGAGCTGGAAGG - Intronic
1105341057 13:19526418-19526440 ATTTTTAAGCTGGAGCTGGATGG - Intronic
1105929708 13:25041142-25041164 AGCAGTGATATGGAGCTGGAGGG - Intergenic
1110591510 13:77267999-77268021 ACCTGTAATATGGAGCTGTATGG - Intronic
1111492353 13:88997208-88997230 ATATGTAATATGGATCATGAAGG + Intergenic
1112450699 13:99506432-99506454 ATCTGAAATCTGGCACTGGAAGG + Intronic
1114622781 14:24107276-24107298 ATCAGTTATCTGGAGCTGAAGGG - Intronic
1114898121 14:27019577-27019599 ATGTGTACTATGGAGCTGATAGG + Intergenic
1115772552 14:36681142-36681164 ATCTCTAAGATGGTGCTTGATGG + Intronic
1116283109 14:42934872-42934894 ATCTTTAATATGTATGTGGACGG + Intergenic
1117573067 14:57068748-57068770 AACTGTATTATGGTCCTGGATGG - Intergenic
1118936676 14:70295165-70295187 GTCTGTAATATGGAGCTGGAAGG + Intergenic
1120375027 14:83694048-83694070 ATGATTAATATGAAGCTGGAGGG + Intergenic
1120733444 14:88027833-88027855 ATGTGTTATATGGAGGTGCAGGG - Intergenic
1121192641 14:92043761-92043783 ATCTGTAATACGGAGCTGGAAGG + Exonic
1121389359 14:93561122-93561144 ATCTGTAATATGGAGCTGTAAGG + Intronic
1122041534 14:98991158-98991180 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1122681905 14:103471300-103471322 ATCTCTAAAATTGAGCTGGGGGG - Intronic
1123964804 15:25444228-25444250 ATCTATAAAATGGAGGTGTAGGG + Intergenic
1124995525 15:34719872-34719894 ATCTGTAATCTCTAGCTGGCTGG + Intergenic
1126213114 15:46122225-46122247 ATCTGTAATCTGCAGATGAATGG - Intergenic
1127634653 15:60857865-60857887 ATCTGTGAAATGGAGGTGGCTGG - Intronic
1130630985 15:85568983-85569005 ATTTGAAATAAGGAGCTGAATGG + Intronic
1132299463 15:100767190-100767212 ATCTGTAAAATGGGGCTGCAAGG - Intergenic
1133348899 16:5088802-5088824 ATCTATAAAATGGAGGTGGCGGG - Intronic
1133512891 16:6477881-6477903 ATCTGTAACATGCAAGTGGAAGG - Intronic
1133766191 16:8839678-8839700 GTCTGTAATATGGAGCTGGAAGG + Intronic
1137864651 16:51880675-51880697 CTCTGTAAAATGTAGATGGATGG - Intergenic
1138758461 16:59516698-59516720 GTCTGTAATGTGGAGCTGGAAGG + Intergenic
1139520094 16:67477191-67477213 ATCAGTAAAATTGAGATGGATGG + Intronic
1141823255 16:86462339-86462361 AGCGGTTTTATGGAGCTGGAAGG - Intergenic
1142652405 17:1363651-1363673 ATCTTTAAAATGGCACTGGAAGG - Intronic
1144765868 17:17732130-17732152 ATCTGTAAAATGGGGATGGCAGG - Intronic
1144836471 17:18159026-18159048 ATCTGTAAAATGGTGATGCAGGG + Intronic
1145758928 17:27414570-27414592 ATCTTTAAAATGGCACTGGAAGG - Intergenic
1145929082 17:28671598-28671620 AACCGTAACATGGAGCTTGATGG - Intronic
1146967798 17:37047624-37047646 ATGTGTAATTTAGAGCTGTAGGG + Intronic
1147171130 17:38619579-38619601 ATCTGTAAAATGGGCCTGGGAGG + Intergenic
1149118827 17:53135987-53136009 GTCTCTAAAATGGAGATGGAAGG - Intergenic
1149469114 17:56901747-56901769 CACAGTAATCTGGAGCTGGAGGG + Intronic
1150862798 17:68818490-68818512 TTCTGTATTATGGAGAGGGATGG + Intergenic
1152114457 17:78376901-78376923 ATCTGTAATATGCAGCTCCCTGG - Intergenic
1153050652 18:900489-900511 ATTTGCAATATGGGGATGGAGGG + Intergenic
1153997973 18:10458088-10458110 ATCTGTGTTTTGGAGCTGAATGG - Intronic
1156237784 18:35220820-35220842 GTCTGTAATACGGAGCTGGAAGG - Intergenic
1156562311 18:38139269-38139291 TTCTGTAATAGGGAGATAGAAGG + Intergenic
1157229678 18:45903330-45903352 ATCTGTAAAATGGTGCTGGCTGG - Intronic
1158308257 18:56130281-56130303 ATCTGTTAAATGGAGATGAAAGG - Intergenic
1158394109 18:57066382-57066404 GTCTGTAATATGGAGCTGGAAGG + Intergenic
1160916250 19:1498011-1498033 ATCTATATTATGGGGCTGGTCGG - Intergenic
1161161484 19:2763882-2763904 ATCTGTAAAATGGGGCTGATGGG + Intronic
1161394091 19:4035489-4035511 ATTTGTAAAATGGGGCTGGTAGG + Intronic
1162242295 19:9365016-9365038 GTCTGTAATATGGAGCTGGAAGG + Intronic
1163899529 19:20089419-20089441 GTCTGTAATATGCAGCTGGAAGG + Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165109992 19:33496755-33496777 CTCTGGCAGATGGAGCTGGATGG + Intronic
1165225153 19:34349510-34349532 ATCTTTAATAAAGAGATGGAGGG - Intronic
1166396988 19:42448672-42448694 TTCTGTAATATGGAGCTGGGAGG + Intergenic
1167901503 19:52625587-52625609 GTCTGTAATACGGAGCTGGAAGG - Intronic
1168358298 19:55716553-55716575 ATCAGTAAAATGGAGCTGGCTGG - Intronic
926611571 2:14953141-14953163 AGCTGTGAGATGGAGCTGGAGGG + Intergenic
928273701 2:29880023-29880045 ATCTGTAGTATGGAGCTTCTTGG - Intronic
931848946 2:66233967-66233989 ATCAGTAATATGCATCTGGATGG + Intergenic
932484899 2:72078841-72078863 TTCAGTAACAGGGAGCTGGATGG - Intergenic
936434012 2:112487645-112487667 ATCTGTAAAATGGGGATGGATGG + Intronic
939519331 2:143209912-143209934 ATTTCAAATGTGGAGCTGGATGG - Intronic
939772316 2:146336484-146336506 TTCTGCCACATGGAGCTGGAAGG + Intergenic
940802831 2:158152753-158152775 ATCTGAAATATAGAGTTGAAGGG + Intergenic
941273583 2:163461462-163461484 CACTGTAGAATGGAGCTGGATGG - Intergenic
941455524 2:165709312-165709334 GTCTGTAATATGGAGCTGGAAGG + Intergenic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
942666856 2:178328858-178328880 ATCTGTAATATACATATGGAGGG + Intronic
942946131 2:181676233-181676255 ATTTGGAATATGGGACTGGACGG - Intronic
943865757 2:192923127-192923149 GTCTGTAATATGGAGCTGGGAGG - Intergenic
944251783 2:197586057-197586079 ATCTGTAATACGGAGCTGGGAGG - Intronic
944936495 2:204574655-204574677 ATCTGTAAGATGGCGTTGCAGGG + Intronic
948179016 2:235965605-235965627 ATCTGTAAAGTGGAGGTGGTAGG + Intronic
1168739691 20:177095-177117 GTCTGTAATATGTAGCTGGAAGG - Intergenic
1168830633 20:843606-843628 ATCTGTAAAATGGAGGGGGCGGG - Intronic
1170481105 20:16765799-16765821 ATCTGGAACATGGAGCTGCCTGG - Intronic
1172452242 20:35034505-35034527 CTCTTCAATTTGGAGCTGGAGGG + Intronic
1173791635 20:45831784-45831806 ATCTGTAAAATGGAGGTGATAGG + Intronic
1174365465 20:50053730-50053752 ATCTGTAAAATGGGGATGGCTGG + Intergenic
1175290166 20:57870218-57870240 ATCTATAAAATGGAGATGCAAGG - Intergenic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1179246755 21:39639982-39640004 AACTGTAAAATGTACCTGGAGGG + Intronic
1181540077 22:23568199-23568221 ATCTTAAAAATGGAGCTGGTGGG + Intergenic
1183346493 22:37311183-37311205 ATCTGTAAAATGGGCATGGAGGG - Intronic
1183684833 22:39355668-39355690 ATCTGTAACATGGGATTGGAGGG + Intronic
1183775901 22:39965041-39965063 ATCTGTAAAATGGAGAAGTAAGG + Intronic
1185263913 22:49887624-49887646 ATCTGTAAATAGGAGGTGGAGGG + Exonic
949876253 3:8627905-8627927 ATCTGTAAAATGGTGCGGGGTGG + Intronic
950835797 3:15917965-15917987 ATCTGCAATTTGGACCTGAAGGG + Intergenic
951954868 3:28242679-28242701 ATCTGTAAAATGGAGCTAAAAGG - Intronic
953902262 3:46849991-46850013 CTCTGTAATGTGGCCCTGGAGGG + Intergenic
957053229 3:75426148-75426170 ATCTATAAAATGGAGGTGGTGGG - Intergenic
958477099 3:94598515-94598537 GTCTATAATTTGGAGGTGGAAGG + Intergenic
960958423 3:123051702-123051724 ATCTGTAAAATGGAGTAGTAAGG - Intergenic
960991459 3:123314308-123314330 AGCATGAATATGGAGCTGGAAGG + Exonic
961301597 3:125925396-125925418 ATCTATAAAATGGAGGTGGTGGG + Intergenic
961886870 3:130102459-130102481 ATCTATAAAATGGAGGTGGTGGG - Intronic
962265986 3:133944686-133944708 TTCTGTGACATGGACCTGGAAGG - Intronic
963059044 3:141210015-141210037 ATCTGTAATATGGAGCTGGAAGG - Intergenic
963320416 3:143804176-143804198 ATCTGTAATATGGAGCTGGAAGG - Intronic
964980707 3:162673906-162673928 ATCTGTAATATGAAACCTGATGG + Intergenic
965286274 3:166824293-166824315 GTCTGTAATATGGAGCTGGAAGG + Intergenic
965625856 3:170683535-170683557 GTCTGTAATATGGAGCTGAAAGG + Intronic
965959166 3:174408170-174408192 ATCTGCATTAAAGAGCTGGATGG - Intergenic
966067475 3:175834467-175834489 GTCTGTAATATAGAGCTGGAAGG - Intergenic
966913493 3:184572134-184572156 ATCTGTAAAATGGGGCTGCTTGG - Intronic
968470027 4:776024-776046 TTCTTTCATATGGAGGTGGAGGG + Intergenic
968856016 4:3122874-3122896 TTCTGTGATTTGCAGCTGGAGGG + Exonic
968996035 4:3946464-3946486 ATCTATAAAATGGAGGTGGTGGG - Intergenic
969030195 4:4205780-4205802 ATCTATAAAATGGAGATGAAGGG - Intronic
969757951 4:9162235-9162257 ATCTATAAAATGGAGGTGGTGGG + Intergenic
969817932 4:9699777-9699799 ATCTATAAAATGGAGGTGGCAGG + Intergenic
972283281 4:37623652-37623674 ATCTGAAATGTGGAGGTGGAGGG - Intronic
972694483 4:41432142-41432164 ATCTGTACTATAGAGCTGAGTGG - Intronic
977007057 4:91580876-91580898 ATCTGTAAAATGAAGATGTATGG - Intronic
977042217 4:92029387-92029409 GTCTGTAATATGGAGCTGGAAGG - Intergenic
977966807 4:103160752-103160774 CTCTGTAATTTGGAATTGGAAGG - Exonic
978402345 4:108343924-108343946 ATCTAAAATATGGAACTGGCCGG - Intergenic
978497585 4:109376713-109376735 ATCTGTAAAATGGAGGGGGTGGG + Intergenic
978711733 4:111790557-111790579 ATGTGTAATATGGAGATAAATGG + Intergenic
980098249 4:128515475-128515497 AGCTGTGCTATGGAGGTGGAAGG - Intergenic
981942343 4:150295766-150295788 ATTTGTAATATTGACATGGAGGG - Intronic
982435419 4:155379247-155379269 ATCTTTAAAATGGCACTGGAAGG - Intergenic
989989354 5:50742818-50742840 ATCTGCAGTTTGGAGCTGGTAGG + Intronic
990816170 5:59787541-59787563 ATCTGTAATATACAGAAGGAAGG + Intronic
991010332 5:61875925-61875947 ATATGTAATTTGGGGCTGGGTGG - Intergenic
994410470 5:99401927-99401949 AACTATAATATGGGGCTGGCTGG + Intergenic
994483355 5:100363342-100363364 AACTATAATATGGGGCTGGCTGG - Intergenic
995124782 5:108569342-108569364 GTCTGTAATATGGAGCTGGAAGG + Intergenic
996129249 5:119761388-119761410 ATGTGCAATATGGAGCTGAATGG + Intergenic
996358093 5:122618632-122618654 GTCTGTAATATGGAGCTGGAAGG + Intergenic
999111552 5:149125743-149125765 AGCTGGAACATGGATCTGGAGGG + Intergenic
999364093 5:151010138-151010160 ATCTGTAAAATGGATGTGGTGGG + Intergenic
999599119 5:153241091-153241113 ATATGTAAAGTGTAGCTGGAAGG - Intergenic
1001320106 5:170673836-170673858 ATCTGTAAAATGGTGGTGGGCGG + Intronic
1001619095 5:173067394-173067416 ATCTGTAAAATGGGACTGGGTGG + Intronic
1002818566 6:701212-701234 ATCTGCATTATTGTGCTGGATGG - Intergenic
1004254497 6:14050517-14050539 ATCTGTAATATGGACATAGATGG - Intergenic
1004276261 6:14237904-14237926 ATCTGTAAGATGGAGATCTAGGG + Intergenic
1006173227 6:32107427-32107449 AGCTGGAATGGGGAGCTGGAGGG - Intronic
1006325375 6:33349716-33349738 ATCTGTAATACAGAGCTGGGAGG - Intergenic
1006482319 6:34306531-34306553 TCCTGGAATGTGGAGCTGGATGG + Intronic
1007300316 6:40863092-40863114 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1007842349 6:44727246-44727268 ATCTGTAAAATAGAGATAGATGG + Intergenic
1007976086 6:46102652-46102674 ATCTGTAATTTGAAGATGGCTGG - Intergenic
1009343848 6:62590024-62590046 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1010586075 6:77659739-77659761 GTCTGTAATATGGAGCTGGAAGG + Intergenic
1012265691 6:97139207-97139229 ATGTAAAATATGGAGCTGGAAGG - Exonic
1013230601 6:108158127-108158149 ATCTGTAAAATGGAGCAGCTGGG + Intronic
1016205090 6:141458984-141459006 GTCCGTAATATGGAGCTGGAAGG - Intergenic
1020320307 7:6934873-6934895 ATCTATAAAATGGAGGTGGCGGG - Intergenic
1021000403 7:15323467-15323489 ATATGTCATATGGAGATGGTAGG + Intronic
1021430860 7:20557294-20557316 ATCTGTCATGTGGAGGTAGAGGG - Intergenic
1022373403 7:29790784-29790806 GTCTGTAACATGGAGCGGGAAGG - Intergenic
1022383991 7:29884831-29884853 ATCTGTAAAATGGGGATAGATGG + Intronic
1023837330 7:44076037-44076059 TTCTGTAAAATGGAGAAGGAAGG - Intronic
1027991406 7:85367014-85367036 ATATGTATTCTGTAGCTGGATGG + Intergenic
1028793943 7:94883430-94883452 ATCTGTAGTGTGTAGTTGGATGG - Intergenic
1029837135 7:103324692-103324714 AACTCGAAGATGGAGCTGGAAGG + Intronic
1031387657 7:121172044-121172066 ATTGGTGAAATGGAGCTGGAAGG + Intronic
1031816423 7:126443347-126443369 ATAAGTAATACGAAGCTGGATGG - Intronic
1036381203 8:8237557-8237579 ATCTATAAAATGGAGGTGGCAGG + Intergenic
1036848359 8:12185071-12185093 ATCTATAAAATGGAGGTGGCGGG - Intronic
1040973950 8:53169584-53169606 AAATGAAATATGGAGCTGCATGG + Intergenic
1043541229 8:81265127-81265149 ATGTGAAATTTGGAGCCGGAAGG - Intergenic
1044701941 8:94973256-94973278 ATCTGTAAAATGGAGATGATAGG + Intronic
1045224771 8:100233743-100233765 ATCATTATTTTGGAGCTGGAAGG - Intronic
1045383026 8:101645612-101645634 ATCTGTAAAAAGGAGATGGCAGG + Intronic
1046597901 8:116283091-116283113 TTCTGTGAAATGGAGCTGGAAGG - Intergenic
1048037414 8:130690423-130690445 ATCTATAAAATGGATCTGTAGGG + Intergenic
1048559786 8:135521628-135521650 ATTTGTAATATGAGGTTGGATGG + Intronic
1048604481 8:135953291-135953313 ATCTATAATATGGGGGTGGATGG + Intergenic
1050599632 9:7237373-7237395 GCCTGTAACATGAAGCTGGAGGG - Intergenic
1050802045 9:9627536-9627558 CTCTGTAAGGTGGGGCTGGAGGG + Intronic
1051131127 9:13862166-13862188 ATCTGTAAAATGGAACTACATGG - Intergenic
1052042632 9:23756857-23756879 ATCTGTAGTGGGGACCTGGAAGG - Intronic
1052653947 9:31332915-31332937 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1052872834 9:33524399-33524421 ATCTCGAATTTGGAGCTGGGTGG + Exonic
1053071575 9:35105160-35105182 TTCTCTAAGATGGAGCAGGATGG + Exonic
1055263041 9:74461264-74461286 CTCTGTAATAAGAAGCTGTAAGG - Intergenic
1056324507 9:85465163-85465185 GTCTGTAATATGGAGCTGGAAGG - Intergenic
1057968686 9:99531411-99531433 ATCTGTCTGATGGAGATGGAAGG + Intergenic
1058094936 9:100848981-100849003 ATTTATAATATGGTGCTTGAAGG + Intergenic
1058907442 9:109493356-109493378 CTCTGTAAAATGGGGCTGGAAGG + Intronic
1059542897 9:115147852-115147874 ATATGTAATATATAGCTGGGGGG + Intronic
1060660921 9:125404908-125404930 ATCTGTAAAATGGGGGTAGATGG - Intergenic
1062400220 9:136369396-136369418 GTCTGTAAGGTGGAGCGGGAAGG + Intronic
1188200286 X:27287955-27287977 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1188211920 X:27436418-27436440 CACTGTCATATGGAACTGGAAGG + Intergenic
1188772823 X:34175365-34175387 ACCTGTAATATGGATCCAGAGGG - Intergenic
1190370026 X:49731389-49731411 TTCTGTAACATGGAGTTGGGAGG + Intergenic
1193168219 X:78305787-78305809 TTCTGTAATATGCAACTGCATGG - Intronic
1195338328 X:103878896-103878918 AGCTGTCACATGGGGCTGGAAGG - Intergenic
1196633552 X:117972979-117973001 ATCTGTAAAATAGGGCTGTAAGG + Intronic
1196719981 X:118844581-118844603 ATCTATAAAATGGAGCTAAAGGG + Intergenic
1197441999 X:126502929-126502951 TTCTGTAATATGTAGGTGGCAGG + Intergenic
1200409333 Y:2845991-2846013 ATCTGTGATATTGACCAGGAAGG + Intronic
1201342196 Y:12946726-12946748 ATCTGGAATCTGGGGCAGGATGG + Intergenic
1201862535 Y:18615184-18615206 ATTTGTAATATGAAGATGCAGGG - Intergenic
1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG + Intergenic
1202075951 Y:21038109-21038131 TTCTGTAATACAGAGCTGGAAGG + Intergenic
1202591109 Y:26484171-26484193 ATTTTTAAGCTGGAGCTGGATGG + Intergenic