ID: 1105032663

View in Genome Browser
Species Human (GRCh38)
Location 12:132894981-132895003
Sequence AACCTTTCACTATTATTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 5, 2: 27, 3: 61, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105032663 Original CRISPR AACCTTTCACTATTATTTAT GGG (reversed) Intronic
900721916 1:4182073-4182095 AACTTTTCACTGTTATTTTCAGG + Intergenic
900841417 1:5051517-5051539 AACCTTTCACTGTTATTTTCGGG - Intergenic
903506247 1:23837810-23837832 CACCTTTCCATATCATTTATAGG - Intronic
905841055 1:41178641-41178663 AACCCTTTACTATTATGTAATGG - Intronic
906379100 1:45320384-45320406 AACCTTTCACTGCTATTCATGGG - Intergenic
906420490 1:45662551-45662573 AGCCTTGCACTATTGTTCATGGG + Intronic
906976090 1:50574490-50574512 AACCCTTTACTATTCTCTATGGG + Intronic
907260244 1:53212496-53212518 AACCTTTTTCTATTACTGATTGG + Intronic
907546821 1:55268604-55268626 TACATTTCACTAATAGTTATAGG + Intergenic
908381978 1:63605393-63605415 AAACTTTGACTTGTATTTATTGG + Intronic
908838550 1:68254377-68254399 AACCTTTTAATATTCTTAATTGG - Intergenic
909497461 1:76294614-76294636 ATGCTTTCACTATTATTTCTGGG + Intronic
909576260 1:77180066-77180088 AACTTGTTACTGTTATTTATAGG - Intronic
909730125 1:78879363-78879385 AACCTTTCACTGCTATTTATGGG - Intergenic
910579554 1:88807985-88808007 AACATTTCACTATCTTTTTTTGG - Intronic
911446631 1:98002057-98002079 ATCCTTTTTCTCTTATTTATTGG + Intergenic
911759361 1:101598719-101598741 AACCTTTCACTGTTATTTTTAGG + Intergenic
911967577 1:104387050-104387072 AATCTTTCACTGTTATTTAAAGG - Intergenic
912118333 1:106436070-106436092 AACCTAGCTCTATTGTTTATTGG - Intergenic
915794341 1:158711837-158711859 TACCTTTTAGTATTATTTACAGG + Intergenic
916636635 1:166676861-166676883 AACATTCCACTGGTATTTATTGG - Intergenic
916848389 1:168676958-168676980 AATATTTCACCATTCTTTATAGG + Intergenic
917491585 1:175502954-175502976 AACCCTGCTCTAATATTTATGGG - Intronic
918681123 1:187355111-187355133 AAGCTTTCACAGTTAATTATGGG - Intergenic
919005086 1:191888657-191888679 AACCTTTTGATATTATTTGTTGG - Intergenic
920908705 1:210194170-210194192 AAACTTTCACTGTTATTCATGGG - Intergenic
921520626 1:216151081-216151103 AACCTTTCACTGTTATTTTCGGG - Intronic
921610077 1:217202135-217202157 ATCTTTTCACTATTTTTAATGGG + Intergenic
921860787 1:220040269-220040291 AATCTTTTCATATTATTTATAGG - Exonic
922369151 1:224892122-224892144 AACCTTTCACTACTATTCATGGG - Intergenic
923075789 1:230607537-230607559 AACCTTTCACTGTTATTTTCGGG - Intergenic
923445223 1:234064421-234064443 AACCTTTTACCATTCTTTTTAGG + Intronic
923749977 1:236738376-236738398 AAAGTTACACTACTATTTATTGG - Intronic
923816587 1:237386172-237386194 AAACTTTCAATCTTATTCATTGG + Intronic
923978485 1:239293314-239293336 ACCCTTTCTCTATAATTGATAGG + Intergenic
1063047443 10:2406699-2406721 ATACTTACACAATTATTTATTGG - Intergenic
1063532178 10:6844146-6844168 AACCTTTCAGTGGTATTTCTAGG + Intergenic
1063847441 10:10146364-10146386 AGCCTTTAACAAGTATTTATCGG - Intergenic
1065636285 10:27738553-27738575 AAGCTTTCACTATAAAATATGGG + Intronic
1065636286 10:27738638-27738660 AATCTTTCACTATAAAATATGGG - Intronic
1066130004 10:32383965-32383987 AACTTTTCACTATTCTTAAGAGG - Intergenic
1066493888 10:35921608-35921630 AACCTGTGATTATTATTTTTAGG - Intergenic
1068703463 10:60046286-60046308 AAACTTTCATTACTTTTTATTGG - Intronic
1070315495 10:75307477-75307499 CACCTTGCACTATTATGTTTTGG - Intergenic
1071686630 10:87764803-87764825 AACCTTTTAAAATTATTTACTGG - Intronic
1073709078 10:106018308-106018330 AACCTTTCACTGTTATTTTCGGG + Intergenic
1078701834 11:13692604-13692626 AATTTTTCACTATTTCTTATTGG + Intronic
1078801432 11:14648319-14648341 AAACTTTAAGTAATATTTATGGG - Intronic
1079429742 11:20377912-20377934 ATCCTTGCACCATTCTTTATGGG + Intronic
1079818722 11:25095959-25095981 AATCTATCATTATTACTTATAGG + Intergenic
1081647062 11:44797425-44797447 TACCCATCATTATTATTTATAGG + Intronic
1083337072 11:61928927-61928949 AACCTTTCTATATCATATATAGG - Intergenic
1083515972 11:63259432-63259454 AATCTCCCACTATTATTTTTGGG + Intronic
1083534822 11:63457944-63457966 AAACTTTTACTGTTATTTACGGG - Intergenic
1084354857 11:68631265-68631287 AACCTTTCACTGTTATTTTTGGG - Intergenic
1086005435 11:82030251-82030273 AACCTTTCACTGTTATTTTCAGG - Intergenic
1086047939 11:82554840-82554862 AAACTTTCAGTTTAATTTATGGG - Intergenic
1086735403 11:90300259-90300281 AATCTCCCACTATTATTGATTGG + Intergenic
1087197548 11:95316204-95316226 AACCTTTCACTGTTATTTTCGGG - Intergenic
1087836256 11:102878269-102878291 TACTTTTCCCTATTATTTAATGG + Intergenic
1088767357 11:112996467-112996489 AACCTTTCACTGTTATAAATTGG + Intronic
1092580446 12:9835453-9835475 TACCTTTCACTGTTATTTTCGGG + Intronic
1092592362 12:9963936-9963958 TACCTTTCACTGTTATTTATGGG + Intronic
1093024757 12:14235507-14235529 AACCTTTCACTGTTATTCATGGG - Intergenic
1093177749 12:15932348-15932370 AAAGTTTCACTATAATTTGTTGG + Intronic
1093219986 12:16408684-16408706 AACTTTTAGCTATTAATTATTGG + Intronic
1093359127 12:18202096-18202118 AACCTTTCACTGTTATTTTCAGG - Intronic
1093791884 12:23261256-23261278 AACTTTACACTAATATATATTGG - Intergenic
1093951476 12:25167993-25168015 AACCTTTCACTGTTATTTTCGGG - Intronic
1094229861 12:28090669-28090691 ATCCTTTCATTATTATCTAGGGG + Intergenic
1094351924 12:29536317-29536339 ACCCCTTCATTATTATCTATAGG - Exonic
1094574818 12:31675438-31675460 AATTTTTCACTATTAGCTATAGG - Intronic
1094826417 12:34272630-34272652 AACCTTTCACTGTTATTTTGGGG - Intergenic
1095178985 12:39125228-39125250 AACCTATCACTATATTCTATTGG + Intergenic
1095346438 12:41155449-41155471 AACATTTCATTAGTCTTTATAGG - Intergenic
1095382017 12:41606360-41606382 AACCTTGCACTAATCTTTCTAGG + Intergenic
1095638755 12:44462451-44462473 AACCAATAAATATTATTTATTGG + Intergenic
1095796637 12:46226463-46226485 AACGTTTCACTGTAATTTTTGGG - Intronic
1095806105 12:46322785-46322807 AAATTTTCACTGTTATTTATGGG + Intergenic
1096905521 12:54932008-54932030 AACCTTTCACTGCTATTCATGGG + Intergenic
1097446358 12:59677749-59677771 AACCTTTCAAAATTACTTACTGG - Intronic
1098427505 12:70381904-70381926 AATCATTCATTATTATTTTTTGG - Intronic
1098514661 12:71359844-71359866 ACCCTTTCATTTTTATTTCTTGG - Intronic
1101161427 12:101980283-101980305 AACTTTTCCCTCTTATTTACAGG - Intronic
1102605046 12:114061850-114061872 AACCTTTCACTGCTATTCATGGG - Intergenic
1103277427 12:119724403-119724425 AACCTTCCACTTTTACCTATTGG - Intronic
1103868358 12:124072210-124072232 AACATTCCAACATTATTTATTGG + Intronic
1104258003 12:127156628-127156650 AACCTTTCATTGCTATTCATGGG - Intergenic
1104695541 12:130860764-130860786 AAATTTTCAGTATTATTTTTAGG - Intergenic
1105032663 12:132894981-132895003 AACCTTTCACTATTATTTATGGG - Intronic
1105205253 13:18217893-18217915 AATCTTTAATTATTATTTTTAGG + Intergenic
1106646099 13:31636155-31636177 ATCCTTTTACCATTATTTAACGG + Intergenic
1109699193 13:66003652-66003674 AAACTTTGACTATCATATATTGG - Intergenic
1114182022 14:20375648-20375670 TAGCTATCACTATTATTAATGGG + Intronic
1114371855 14:22098227-22098249 TATCTTTCACTATTATGTATAGG + Intergenic
1114770730 14:25427030-25427052 AACCTTTCACTGCTATTCATGGG + Intergenic
1115238928 14:31235608-31235630 AACTTTTGCATATTATTTATGGG + Intergenic
1115508850 14:34120120-34120142 AATTTTTCAATGTTATTTATTGG + Intronic
1118658043 14:67975175-67975197 CACCATTCAATAATATTTATCGG - Intronic
1118936653 14:70294989-70295011 AACTTTTCACTGTTATTTTCGGG + Intergenic
1119248022 14:73129750-73129772 AACCTTTCACTGTTATTTATGGG + Intergenic
1120079613 14:80201093-80201115 AATCTTTAAATATTACTTATGGG + Intronic
1120300796 14:82704082-82704104 AACCTTTTACCATTATGTAATGG + Intergenic
1120465003 14:84845231-84845253 AACCTTAGAGTATTATTTTTAGG + Intergenic
1121192615 14:92043597-92043619 AACCTTTCACTGTTATTTACGGG + Exonic
1121389333 14:93560950-93560972 AACCTTTCACTGTTATTTATGGG + Intronic
1122041560 14:98991334-98991356 AACCTTTCACTGTTATTTTCAGG - Intergenic
1125802703 15:42464365-42464387 AACTTGTAACTATTATTCATGGG + Intronic
1126188783 15:45857381-45857403 AGCTTTTCACTATTATACATAGG + Intergenic
1126509043 15:49445777-49445799 ACTCTTTTACTATTATTTCTTGG - Intronic
1126529768 15:49699998-49700020 AACCTTTCACTGTTATTTTTGGG + Intergenic
1126578229 15:50218521-50218543 AAACTTTCACTATCTTTTTTTGG - Intronic
1130412460 15:83658463-83658485 AATCTCTCACAATTATTTGTGGG - Intronic
1131203609 15:90422437-90422459 TTCCTTGCACTATTATTTAATGG + Intronic
1131624852 15:94106744-94106766 GACCCTTCACAATTATTGATCGG - Intergenic
1133396727 16:5453286-5453308 AACCCTTCACACTTAGTTATTGG - Intergenic
1133766166 16:8839501-8839523 AACCTTTCACTATTATTTTCGGG + Intronic
1135406970 16:22205877-22205899 AACCTTAAAATATTTTTTATCGG - Intergenic
1136126872 16:28189896-28189918 AACATTCCTCTATTATTTCTTGG + Intronic
1137054708 16:35738848-35738870 AATCTTTCAGTACTATTTATGGG + Intergenic
1138302465 16:55944128-55944150 AACCTCTCTGTATTACTTATGGG + Intronic
1138758442 16:59516523-59516545 AACCTTTCACTGTTATTTTCGGG + Intergenic
1140998240 16:80282106-80282128 AACCTTTAACTACTATTTGTGGG - Intergenic
1141117488 16:81322753-81322775 AACCATTTACTATTATTCAGAGG - Intronic
1144342158 17:14318770-14318792 AGTCTTTCACTGTTATTTTTGGG + Intronic
1147540868 17:41358297-41358319 AACCATTCACTACTACTTAATGG - Intergenic
1149209087 17:54283101-54283123 AATGGTTCACTATTATTTAAAGG - Intergenic
1152454635 17:80406653-80406675 AACCTTTCGCTGCTATTCATGGG - Intergenic
1153427551 18:4982732-4982754 AGCCTTGCACTATTATTGTTGGG - Intergenic
1153710158 18:7790661-7790683 AACCTTTCAAAAGTATTAATTGG + Intronic
1155827290 18:30463560-30463582 ATCCTTCCACTATTCTTTAGGGG + Intergenic
1155867653 18:30985560-30985582 AAACTTTCACAAATATTTCTTGG - Intergenic
1156237810 18:35220992-35221014 AACCTTTCACTGTTATTTTCGGG - Intergenic
1156916447 18:42468216-42468238 AACCTTTCACTGTTATTTATGGG - Intergenic
1158394091 18:57066206-57066228 AACCTTTCACTGTTATTTTCGGG + Intergenic
1158419508 18:57280245-57280267 ATCCTTTAACTAGTATTTAGTGG - Intergenic
1159260919 18:66011582-66011604 AACCTTCATCTATTTTTTATTGG - Intergenic
1162242270 19:9364840-9364862 AACCTTTCACTGTTATTTTCAGG + Intronic
1162262959 19:9547517-9547539 AACCTTTCATTGCTATTCATGGG - Intergenic
1162287509 19:9750296-9750318 AGTCTTTCACTACTATTCATGGG - Intergenic
1163899504 19:20089243-20089265 AACCTTTCACTGTTATTTTCGGG + Intronic
1164081210 19:21862903-21862925 AACCTTTCATTGCTATTCATAGG - Intergenic
1166396961 19:42448496-42448518 AACCTTTCACTGTTATTTACAGG + Intergenic
1166532894 19:43553139-43553161 ACCCTTTCACTCCTATCTATGGG + Intronic
1167901525 19:52625753-52625775 AAACTTTCACTGTTATTTATGGG - Intronic
925484254 2:4310970-4310992 AACCTCCCACTATTATTGTTAGG + Intergenic
928770433 2:34697964-34697986 AACCTTTCACTGTTATTTTCAGG + Intergenic
928778691 2:34794550-34794572 AACCTTTCACTGTTATTTTCAGG - Intergenic
930039567 2:47109972-47109994 ATCCTTTCCTTATTCTTTATAGG + Intronic
930098344 2:47584281-47584303 AACCTTTCACTGCTATTCATGGG + Intergenic
930958782 2:57233731-57233753 AACCTTTCACTGTTATTTGCGGG - Intergenic
931561651 2:63567993-63568015 AAGCTGTCATTATTTTTTATGGG - Intronic
933047061 2:77552303-77552325 AACCTTTAACTAGGATTTAATGG + Intronic
933144279 2:78832279-78832301 AACCTCTCACTTTTCTTTACAGG + Intergenic
934141966 2:89055402-89055424 AACCTTTCACTGTTATTTACGGG - Intergenic
934227271 2:90145144-90145166 AACCTTTCACTGTTATTTACGGG + Intergenic
935373565 2:102372812-102372834 TATTTTTCACTATTATTTAAAGG + Intronic
935677337 2:105607283-105607305 AACATGTCAATATTATCTATAGG + Intergenic
936806205 2:116335534-116335556 ATCCCTTTACTATTATGTATTGG + Intergenic
937148037 2:119664092-119664114 AAGCTTGCACTATTGGTTATGGG - Intergenic
937420414 2:121749905-121749927 AACATTCAACTATTATTAATGGG + Intronic
937603496 2:123768803-123768825 AAACTTTCACTTTTATTTGCTGG - Intergenic
938814519 2:134886642-134886664 AATATTTCACCATTATGTATGGG - Intronic
939304055 2:140386690-140386712 AAATTTTCACTATTATTAAATGG + Intronic
939592399 2:144081832-144081854 AGCCTATCACTATCATTTACGGG + Intronic
939981156 2:148783322-148783344 AACCATTCATTAATATTTTTTGG + Intronic
940275505 2:151936492-151936514 AGCCTTTTACTATTCTTTGTAGG - Intronic
940355222 2:152734080-152734102 ATCCTTTTATTATTATTAATGGG + Intronic
940530691 2:154873006-154873028 AACCTTTCACTGTTATTTTGGGG - Intergenic
940726789 2:157343878-157343900 AACCTTTCACTGCTATTCATGGG - Intergenic
940912574 2:159221739-159221761 AAGCTTTCCATATTATTTTTAGG - Intronic
941455501 2:165709136-165709158 AATCTTTCACTGTTATTTTCGGG + Intergenic
942178049 2:173354186-173354208 AACCTTTAACGATTATCTGTTGG - Intergenic
943412301 2:187559494-187559516 AACCTTTCACTGTTATTTTCGGG + Intronic
943865783 2:192923299-192923321 AACCTTTCACTGTTATTTTCAGG - Intergenic
944251810 2:197586233-197586255 AACTTTTCACTGTTATTTATGGG - Intronic
945339125 2:208630844-208630866 AACTTGTCAGGATTATTTATAGG - Intronic
945539541 2:211067496-211067518 TTCCATTCACAATTATTTATTGG - Intergenic
945596601 2:211803148-211803170 CACATTTTACTATTATTAATAGG - Intronic
945858537 2:215094703-215094725 AACCTTTCACTGCTATTCATGGG - Intronic
1168739714 20:177271-177293 AAACTTTCACTGTTATTTACAGG - Intergenic
1168839511 20:900240-900262 AACCATTCACTGTTATTTACAGG - Intronic
1169990806 20:11500600-11500622 AACCTTACACTATCCTTTACTGG - Intergenic
1170418209 20:16166951-16166973 AGCCTGTCACTGGTATTTATGGG - Intergenic
1173902230 20:46599239-46599261 ATTCATTCACTAATATTTATTGG - Intronic
1177062649 21:16394338-16394360 AACCGTTCACTGCTATTCATGGG + Intergenic
1177089850 21:16754438-16754460 AACATTTCGTTATTCTTTATTGG - Intergenic
1177451984 21:21280436-21280458 AAACTTTCATTTTTCTTTATAGG + Intronic
951274225 3:20665549-20665571 GACCCTTCAATATTATTTTTGGG - Intergenic
951331937 3:21379399-21379421 AACCTTTCACTGTTATTTTTGGG + Intergenic
951762127 3:26159175-26159197 AACCTTTCACTGTTATTTTCGGG + Intergenic
952007616 3:28860241-28860263 CACCTTTCAACACTATTTATTGG + Intergenic
952106249 3:30073060-30073082 AACCTTTCAGTATTTCTTCTAGG + Intergenic
952274610 3:31865190-31865212 AAGCTTCCACTATTACTTAATGG - Intronic
952297567 3:32074646-32074668 AACCTTTCACTGCTATTCATGGG - Intronic
952663837 3:35880200-35880222 AACCTATCACAATAATTTCTAGG + Intergenic
953645381 3:44749064-44749086 CACCTTTCAGTGTTCTTTATAGG + Exonic
953834065 3:46328088-46328110 AACCTTTCATTGCTATTCATAGG + Intergenic
955521565 3:59780285-59780307 TACCAATCACTATCATTTATTGG - Intronic
956382537 3:68680493-68680515 AATTTTTCAGTACTATTTATAGG + Intergenic
956903822 3:73744583-73744605 ACCCATTCATTATTTTTTATGGG + Intergenic
957510394 3:81180674-81180696 CACCTTTCACTATTACTTACTGG - Intergenic
957527852 3:81400236-81400258 ATCCATTCACTATTATATTTGGG + Intergenic
957981220 3:87513235-87513257 ATCTTTTCATTATTTTTTATTGG + Intergenic
958034459 3:88152986-88153008 AAACTTTCACTATCACTTATGGG + Intronic
958521535 3:95194946-95194968 TACTTTTCACTATTTATTATAGG - Intergenic
958755834 3:98248266-98248288 AAGCTTTCACTGCTATTCATGGG - Intergenic
959282186 3:104358388-104358410 AATATTTGACTATTATTCATTGG + Intergenic
959635019 3:108556198-108556220 CACCCTTCATTATTATTGATGGG + Intronic
960202544 3:114855233-114855255 AACCTTTCGTAATTATTTAATGG + Intronic
962602581 3:137005500-137005522 ATCCTTTTACTATTATGTAATGG + Intronic
963320442 3:143804352-143804374 AACCTTTCACTGTTATTTACGGG - Intronic
963429646 3:145181989-145182011 GATCTTTTGCTATTATTTATTGG + Intergenic
964306126 3:155342181-155342203 AATCTTTCTCGATTTTTTATTGG + Intergenic
964451868 3:156821150-156821172 CAGCTTTCACTAATATTTCTGGG - Intergenic
964827539 3:160846088-160846110 AACCTTTCCATTTTCTTTATTGG - Intronic
965286253 3:166824117-166824139 AAACTTTCACTGTTATTTTTGGG + Intergenic
965335776 3:167429648-167429670 AATCTTTCACTGTTATTTATGGG - Intergenic
965416979 3:168408119-168408141 AACCTTGTAATATTATTTCTAGG - Intergenic
965625833 3:170683359-170683381 AACCTTTCACTGTTTTTTTCGGG + Intronic
966067497 3:175834643-175834665 AACCTTTCACTGTTATTTTTGGG - Intergenic
966079744 3:175986637-175986659 AACCTTTTATTATTATGTAATGG + Intergenic
966304881 3:178520449-178520471 CACCTTTTACTATCATTTAGGGG - Intronic
966341449 3:178929184-178929206 AACCCTTCACCATTATGTAATGG - Intergenic
968412341 4:401108-401130 AACCTTTCACTGCTATTCATGGG + Intergenic
969537102 4:7763153-7763175 TACCTTTTATTATTATTTTTTGG - Exonic
970092880 4:12429819-12429841 GACCTTTAATTATTAATTATAGG + Intergenic
970760905 4:19484857-19484879 AGCCTTAAAATATTATTTATAGG + Intergenic
970985982 4:22158677-22158699 AACCATTTACTATTATGTAATGG + Intergenic
971523611 4:27587124-27587146 AACTTTTGTCTATTTTTTATTGG - Intergenic
971585580 4:28402238-28402260 ATCCTTTCAGTTTTATATATAGG - Intronic
971672778 4:29584852-29584874 AACATTTAACAAATATTTATTGG + Intergenic
972174724 4:36389275-36389297 AATCTTTCTCTGTAATTTATCGG - Intergenic
972969030 4:44549483-44549505 AAGCTTTCACTCCTATTTTTAGG + Intergenic
973001299 4:44954696-44954718 AATTTTTCACTACTAGTTATTGG - Intergenic
974067557 4:57093976-57093998 AACCCTTCATTTTTAATTATTGG - Intronic
974146982 4:57961002-57961024 AACCTAGCACTTTTATTTACGGG - Intergenic
974324924 4:60401704-60401726 AATTTTTCACTATTTTTCATGGG - Intergenic
974722210 4:65755039-65755061 AACCTCTCACAATAATTCATTGG - Intergenic
974751651 4:66149852-66149874 ATCCTTGTGCTATTATTTATAGG + Intergenic
975078919 4:70251240-70251262 AAACTATCATTATTTTTTATAGG + Exonic
977042243 4:92029563-92029585 AACCTTTCACTGTTATTTTTGGG - Intergenic
978090555 4:104709408-104709430 AATCTCCCACTATTATTTTTTGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978712889 4:111806872-111806894 TACCTTTGCATATTATTTATGGG - Intergenic
979687124 4:123523329-123523351 AACGTTACACTATTCTTTAATGG + Intergenic
979812267 4:125051690-125051712 AACATTTCTCTATGTTTTATTGG + Intergenic
980287629 4:130801048-130801070 AACTTTTCATTATTATTGATTGG - Intergenic
980715092 4:136617336-136617358 AATCTTTCACTGCTATTCATGGG - Intergenic
981146059 4:141325887-141325909 AAACGTTTACTATTATTCATAGG + Intergenic
981783829 4:148455556-148455578 AACACTTCAGTATTATTTCTAGG - Intergenic
981796074 4:148597009-148597031 ATCCCTTTACTATTATTTAATGG + Intergenic
981875291 4:149535733-149535755 AACCTTTGACTCTTATTATTTGG - Intergenic
982634958 4:157883741-157883763 TTCCTTTAATTATTATTTATAGG - Intergenic
982707037 4:158721884-158721906 AAGATTTCATTATTTTTTATGGG + Intronic
982739779 4:159045449-159045471 AACCTTTCTTTATTATTTTTAGG + Intergenic
982851528 4:160322594-160322616 AATCATTCCCTTTTATTTATAGG - Intergenic
983047695 4:163006252-163006274 CACCTCTCACTATTCTTCATGGG - Intergenic
983152784 4:164305664-164305686 AAGTTTTCACTATTAGTCATTGG - Intronic
984164958 4:176295728-176295750 AACCTTTCACTGTTATTTACAGG + Intergenic
984607048 4:181797305-181797327 TCCCTTTCACCATTATGTATTGG - Intergenic
986206130 5:5627126-5627148 CACATTCCACGATTATTTATTGG + Intergenic
986270853 5:6229490-6229512 AACCATTTTCTATTATTCATTGG + Intergenic
987587619 5:19876661-19876683 AATCTTTAACTTTTATGTATGGG + Intronic
988868041 5:35356816-35356838 TACGTTTCATTATTACTTATAGG + Intergenic
989614171 5:43322708-43322730 AAACTTTCACTGTTATTTACGGG + Intergenic
989645494 5:43627671-43627693 TACCCTTTACTACTATTTATAGG + Intronic
989715558 5:44458381-44458403 AACCTCTCACTTTTGTTTCTGGG - Intergenic
989781520 5:45270623-45270645 ATTCTTTTACTATTATTAATTGG + Intronic
990134408 5:52628070-52628092 AACCTGTCACTATTATTGTGTGG + Intergenic
990268257 5:54103538-54103560 CTCCTTTCACTTTTGTTTATTGG - Intronic
991172903 5:63648995-63649017 CTCCTTTCACTATTTTTTCTTGG + Intergenic
991243592 5:64485820-64485842 CAATTTTCTCTATTATTTATAGG + Intergenic
993260348 5:85649829-85649851 AGCCTTGCACTATTATATAGTGG + Intergenic
994155090 5:96494363-96494385 AAACTTTTACTATCATTTACAGG - Intergenic
994325302 5:98439632-98439654 AACCTTTCATTGCTATTCATGGG - Intergenic
994634572 5:102328291-102328313 AACCTCTAAATATCATTTATAGG - Intergenic
994979024 5:106848526-106848548 TACCTTTCACAATAAGTTATTGG + Intergenic
995124756 5:108569166-108569188 AACCTTTCACTGTTATTTTCAGG + Intergenic
996187965 5:120502845-120502867 AACCACTTACTATTATTTTTTGG - Intronic
996358070 5:122618456-122618478 AACCTTTCACTGTTATTTTTGGG + Intergenic
996593047 5:125169268-125169290 TCTCTTTCACTATGATTTATTGG - Intergenic
996786996 5:127248792-127248814 CACCTTTCGTTATTATTTCTTGG - Intergenic
998858682 5:146421742-146421764 ATCCTTTCATTATTATCTATTGG - Intergenic
999413877 5:151378162-151378184 AATCATTCACTTTTATTTATAGG + Intergenic
999884007 5:155899996-155900018 AACCTTTTACTAATTTATATTGG + Intronic
1000681996 5:164196645-164196667 ACCCTCCCAGTATTATTTATTGG + Intergenic
1001109326 5:168882810-168882832 AAGCTCTCACTCTTATTAATAGG - Intronic
1003279705 6:4680676-4680698 AAACCATCATTATTATTTATGGG - Intergenic
1006325399 6:33349892-33349914 AACCTTTCACTGTTATTTACGGG - Intergenic
1007300290 6:40862916-40862938 AACCTTTCACTGTTATTTACGGG + Intergenic
1007344618 6:41218980-41219002 AATCTTTTACTAGTATTTTTGGG - Intergenic
1008796252 6:55306625-55306647 AACCTTCCACATTTACTTATTGG - Intergenic
1008849822 6:56011680-56011702 AACCTTTCACTGTTATTTTCGGG + Intergenic
1009343867 6:62590200-62590222 AAACTTTCACTGTTATTTTCGGG - Intergenic
1009673834 6:66790623-66790645 ATCCTTTTACTATTATATAATGG - Intergenic
1010586050 6:77659563-77659585 AACCTTTCACTGTTATTTTTGGG + Intergenic
1010763601 6:79752749-79752771 GACCTTTCCCTACTATTTGTAGG - Intergenic
1012134439 6:95538572-95538594 AACCTTCCACTATTATTGTGTGG + Intergenic
1012972677 6:105748455-105748477 CATTTTTCACTATTATTTTTTGG + Intergenic
1014072250 6:117196359-117196381 AACTTTTCATTCCTATTTATAGG + Intergenic
1014267123 6:119292308-119292330 AACCATTCACTAATAATCATGGG + Intronic
1014723127 6:124942979-124943001 ATCCTTTACCTATTTTTTATTGG + Intergenic
1015020417 6:128466933-128466955 AAGCTTTTACTATTATATTTTGG + Intronic
1015049585 6:128823371-128823393 AATCTTTCACCATTAAATATGGG - Intergenic
1016205114 6:141459159-141459181 AACCTTTCACTGTTATTTCGGGG - Intergenic
1017257444 6:152349898-152349920 AACCTTTCACTGTGATTTTGAGG + Intronic
1017297827 6:152818942-152818964 GACTTTTCATGATTATTTATGGG - Intergenic
1017922119 6:158881916-158881938 AACCTTTCACTGCTATTCATGGG + Intronic
1020976073 7:15008195-15008217 ATTCTTTCACTATATTTTATTGG + Intergenic
1022373428 7:29790960-29790982 AATCTTTCACTGTTATTTTCGGG - Intergenic
1023256123 7:38314251-38314273 ATACTTTCATTATTATTGATGGG - Intergenic
1024819725 7:53313526-53313548 AACCTTTCAGTATGAATGATAGG + Intergenic
1027833371 7:83209692-83209714 AAACTTTCTCCATAATTTATAGG - Intergenic
1027904584 7:84163236-84163258 TACCTTTAAGTATAATTTATTGG - Intronic
1028312055 7:89351307-89351329 AGACATTCATTATTATTTATAGG - Intergenic
1029786489 7:102796947-102796969 AAACTATTACTATTATTTTTTGG + Intronic
1031453974 7:121956918-121956940 AACATTTCATTATTGTTTTTTGG - Intronic
1034034953 7:147809378-147809400 CACCTTTCACTATTATTGTGAGG - Intronic
1034084428 7:148310910-148310932 AACCTTTCACTGTTATTTTCGGG + Intronic
1035930501 8:3775188-3775210 AACCTTTCAAAATTCTTTTTTGG - Intronic
1037015541 8:13901742-13901764 GGCCTGTCACTATTATCTATTGG + Intergenic
1038097895 8:24336142-24336164 GAACTTTCACTTTTCTTTATTGG - Intronic
1039098367 8:33912275-33912297 TACCATTCACTGTTATTTCTAGG + Intergenic
1039227347 8:35402786-35402808 AACCTCTCACTATTCTTTTGGGG - Intronic
1039274165 8:35916980-35917002 AACCTATGACTATTGTTTACTGG - Intergenic
1039712081 8:40065923-40065945 ATGATTTCACTCTTATTTATGGG - Intergenic
1040556920 8:48487960-48487982 ATCCCTTCACTATTATGTAATGG - Intergenic
1040613053 8:49005267-49005289 ATCCCTTCACTATTATGTAATGG + Intergenic
1040639073 8:49310689-49310711 AACCCTTCACTCTTATTCAAGGG + Intergenic
1040749697 8:50690983-50691005 AACCTTTTACCATTATGTAACGG + Intronic
1041275546 8:56154228-56154250 ATCCTTTGTCTATTTTTTATTGG - Intergenic
1041427998 8:57745001-57745023 AAATTTTCACCATTATATATTGG + Intergenic
1041900389 8:62976419-62976441 ATCCTTTTACTATTATGTAATGG + Intronic
1042048020 8:64676186-64676208 AACCATTCATTCATATTTATGGG + Intronic
1042075610 8:64991290-64991312 AATATTTAACTATTATTCATGGG - Intergenic
1042706961 8:71673948-71673970 AACCTTTCTCATTTATTTATTGG - Intergenic
1043134510 8:76504704-76504726 AACATTTCACTAATTCTTATAGG + Intergenic
1044859682 8:96510706-96510728 AACCATTTACTATGATTCATAGG + Intronic
1046301840 8:112304315-112304337 ATCATTTCTCTATCATTTATAGG + Intronic
1047586151 8:126275329-126275351 AACATTTCACTAATAATTCTGGG - Intergenic
1047894609 8:129352801-129352823 AACCTTTGATACTTATTTATTGG + Intergenic
1050046150 9:1547690-1547712 AACCTTTGCCTATTTTTTATTGG - Intergenic
1050212000 9:3271144-3271166 TACCTTACAATATTATTTACGGG + Intronic
1050755923 9:9003124-9003146 AACCTTTCAATAATAGTTAATGG - Intronic
1051197178 9:14575543-14575565 AACATTTCACTAGTAATTAGAGG - Intergenic
1051352585 9:16212480-16212502 TTCCATTCACAATTATTTATAGG + Intronic
1052653973 9:31333091-31333113 AACCTCTCACTGTTACTTTTGGG - Intergenic
1053339638 9:37313168-37313190 AACATTTTAATGTTATTTATAGG + Intronic
1055389257 9:75801207-75801229 AAACATTCACTAGTAATTATTGG + Intergenic
1055875169 9:80933478-80933500 AACCATTCACTGTTTATTATTGG - Intergenic
1056300961 9:85240980-85241002 ATCCTTTTACCATTATTTAGTGG - Intergenic
1056324533 9:85465366-85465388 AACCTTTCACTGTTATTTTTGGG - Intergenic
1057345221 9:94244606-94244628 AAGAATTCACAATTATTTATTGG - Intergenic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1060226599 9:121795191-121795213 AACCTTTCACTGTTATTTTCGGG - Intergenic
1062223531 9:135434614-135434636 AACATTTCAATATTTTTTCTTGG - Intergenic
1186390399 X:9153154-9153176 TAATTTCCACTATTATTTATTGG + Intronic
1186761735 X:12730193-12730215 CACCTTTCTCAAGTATTTATGGG + Intergenic
1187635375 X:21222353-21222375 AACCCTTTACCATTATGTATTGG + Intergenic
1187828931 X:23361384-23361406 ATCCTTTTACTATTATGTAATGG + Intronic
1188156866 X:26751061-26751083 AACATTTAACTATTAATTAAAGG + Intergenic
1188200260 X:27287780-27287802 AACCTTTCACTATTATTTACGGG + Intergenic
1188992315 X:36836778-36836800 TATCTTTCACTAAAATTTATGGG + Intergenic
1191082324 X:56525871-56525893 ATCCTTTTACTATTATGTAATGG - Intergenic
1191761973 X:64656034-64656056 AACCTTTCACTGTTATTTTCGGG - Intergenic
1192137514 X:68617992-68618014 AATTTTTCACTTCTATTTATGGG + Intergenic
1192402666 X:70852348-70852370 AATTTTTCACTTTTATTTTTTGG + Intronic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192913740 X:75633126-75633148 AACCTTTCACTGCTATTCATGGG + Intergenic
1193281289 X:79654137-79654159 ATCCTTTTACCATTATTTAATGG + Intergenic
1193638900 X:83987154-83987176 AGACTTTCACTATTATTATTTGG - Intergenic
1194021031 X:88692690-88692712 ATGCTTTCATTATTATTTTTTGG - Intergenic
1194318863 X:92418030-92418052 AATCTTTCACTGATATATATTGG + Intronic
1195549777 X:106154343-106154365 ATCCTTTCACTTTTACTTTTTGG - Intergenic
1196226823 X:113177651-113177673 AGCCTTTCACTGTTATTTATGGG + Intergenic
1196525080 X:116721816-116721838 AACCTTTCACTATTATTTACGGG + Intergenic
1196631562 X:117946100-117946122 AATCTTTTACTTTTATTAATGGG - Intronic
1197896930 X:131326270-131326292 AACAATTCACAATTCTTTATGGG - Intronic
1198929611 X:141839354-141839376 AACCTTTAAAAATTATTTCTTGG - Intronic
1199324790 X:146485624-146485646 AACCTTTTATTATTATATAATGG + Intergenic
1200626996 Y:5531186-5531208 AATCTTTCACTGATATATATTGG + Intronic
1201937765 Y:19426104-19426126 AACCTTTCACTGTTATTTTTGGG - Intergenic
1201981964 Y:19918019-19918041 AACCATTCAATATTTGTTATTGG - Intergenic
1202075859 Y:21037517-21037539 AACCTTTCACTGTTATTTTCAGG + Intergenic