ID: 1105032876

View in Genome Browser
Species Human (GRCh38)
Location 12:132896836-132896858
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 7, 1: 11, 2: 3, 3: 13, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105032871_1105032876 2 Left 1105032871 12:132896811-132896833 CCATGAAAATCGATCCTCCCCTC 0: 2
1: 6
2: 3
3: 35
4: 146
Right 1105032876 12:132896836-132896858 TGCAGTTACCCCATCATGAAAGG 0: 7
1: 11
2: 3
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902300798 1:15501312-15501334 TGCTGTTACCTCCTAATGAATGG + Intronic
904791418 1:33024875-33024897 TTCAGTTTCCCCATTATAAATGG + Intronic
905353099 1:37360892-37360914 TGTTGTTACCCCATCATAAATGG + Intergenic
907000893 1:50854579-50854601 TGCAGTTACCCCAAAATAAGTGG + Intronic
908643555 1:66251834-66251856 AGCAGGAACCTCATCATGAAGGG + Intronic
921873634 1:220169440-220169462 TGCAGTTAGTGAATCATGAAAGG + Intronic
1062943067 10:1438925-1438947 TTCAGGAGCCCCATCATGAAGGG - Intronic
1062943098 10:1439061-1439083 TTCAGGAGCCCCATCATGAAGGG - Intronic
1065148191 10:22794335-22794357 CCCAATTATCCCATCATGAATGG + Intergenic
1068034862 10:51746790-51746812 AGCATTTGCTCCATCATGAAAGG + Intronic
1070870628 10:79748485-79748507 TGCAATCACCCCAGGATGAAGGG - Intergenic
1071637547 10:87270697-87270719 TGCAATCACCCCAGGATGAAGGG - Intergenic
1071657698 10:87467254-87467276 TGCAATCACCCCAGGATGAAGGG + Intergenic
1072120614 10:92402629-92402651 GGTGGTTACCCCCTCATGAATGG + Intergenic
1073805355 10:107091697-107091719 AGCAGTTACTCTATCTTGAAGGG - Intronic
1075315169 10:121447526-121447548 GGCATTTGCCCCATCATGCAGGG - Intergenic
1077999546 11:7482572-7482594 TGCAGTTTCCTCAGCCTGAAAGG - Intergenic
1079620905 11:22552720-22552742 TTCACTTTCCCCATCCTGAAAGG - Intergenic
1080102110 11:28471585-28471607 TCCAGCTCCCCCATCATGCAAGG + Intergenic
1080921156 11:36710620-36710642 TGCAGTTAGCTCATCCTCAAAGG - Intergenic
1090752805 11:129762350-129762372 TGCAGTAACCACATGGTGAATGG - Intergenic
1092038796 12:5364928-5364950 TGCAGTTCCCCAAACATGCAAGG - Intergenic
1094190655 12:27694985-27695007 TACAGTTACCACATAATGAATGG - Exonic
1095178484 12:39120167-39120189 TGCATTTCCCCAATCATTAATGG + Intergenic
1096258179 12:50075221-50075243 TGCAGTCATCCCATGATGCACGG - Intronic
1096485060 12:51974569-51974591 TACATTTAACCCATCCTGAAAGG - Intronic
1097587512 12:61532067-61532089 TGCAGGTATCAGATCATGAAGGG - Intergenic
1097963576 12:65556088-65556110 TCCTGTTACCCAATCAGGAAAGG + Intergenic
1098601470 12:72336440-72336462 GGCAGCTAACCCATCCTGAAAGG - Intronic
1105032671 12:132895060-132895082 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032681 12:132895140-132895162 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032689 12:132895221-132895243 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032700 12:132895302-132895324 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032711 12:132895383-132895405 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032721 12:132895464-132895486 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032731 12:132895544-132895566 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032739 12:132895625-132895647 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032748 12:132895706-132895728 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032760 12:132895787-132895809 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032770 12:132895867-132895889 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032786 12:132896029-132896051 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032795 12:132896110-132896132 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032807 12:132896191-132896213 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032817 12:132896271-132896293 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032823 12:132896352-132896374 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032830 12:132896433-132896455 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032837 12:132896513-132896535 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032848 12:132896594-132896616 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032857 12:132896675-132896697 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032867 12:132896756-132896778 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032876 12:132896836-132896858 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032885 12:132896916-132896938 TGCAGTTACCCCATCATGAAAGG + Intronic
1115913654 14:38285252-38285274 TGCAGCTCCCCCATAAAGAAGGG + Intergenic
1115949049 14:38699034-38699056 TGGATTTACCCCATTATGCAAGG + Intergenic
1116353007 14:43889938-43889960 TGCATTTATCCCATCATTAAAGG + Intergenic
1122348860 14:101076457-101076479 TGAAGTTACCCCTCCATGGAAGG - Intergenic
1127688205 15:61369033-61369055 TTGAGTTACCCCATCAGGCAAGG + Intergenic
1132920599 16:2388532-2388554 ATCAGTTACTCCATCATGACTGG - Intergenic
1135998071 16:27268520-27268542 CTCAGTTTCCCCATCAAGAAGGG + Intronic
1138683561 16:58705348-58705370 TGCAGACACCACATGATGAATGG + Intergenic
1142219276 16:88845435-88845457 TGCAGCTACCCTATCTTAAAAGG + Intronic
1145401069 17:22533504-22533526 TTCAGTTACCCCATCACGGCTGG + Intergenic
1146661027 17:34665315-34665337 TGCTGTGAACCCCTCATGAATGG - Intergenic
1149470255 17:56910608-56910630 GGCAGTACCCTCATCATGAATGG + Intronic
1152339829 17:79718062-79718084 TACAGGGACCCCAGCATGAATGG + Intergenic
1155381085 18:25223437-25223459 TGCAGTAACCCCAAACTGAAGGG + Intronic
1156475774 18:37404497-37404519 TGCACTTGCCCCATCAGGCAGGG - Intronic
1161685158 19:5698887-5698909 TTCAGTTACTCCAGCATGAGTGG + Intronic
1163324751 19:16596211-16596233 TGCAATGACCCCATCACAAAAGG + Intronic
928107098 2:28477593-28477615 TGCAGCTTCCCCAGCCTGAATGG - Intronic
932258219 2:70304857-70304879 TGGAGTTAGCCCATCAGGATTGG - Intergenic
936344722 2:111666583-111666605 TGCAGTTATACCACCATCAATGG - Intergenic
943086172 2:183314120-183314142 TGTAATTACCACATCATGTAAGG + Intergenic
947876823 2:233473323-233473345 TGCAGATAACCCACCATGTAAGG - Intergenic
1169769256 20:9183243-9183265 TGGAGTTACCCCATTATGCTTGG - Intronic
1175536536 20:59718524-59718546 TGCAGGTACAGCATCGTGAAAGG + Intronic
1175592555 20:60204624-60204646 GGCTGTTACTCCATCGTGAATGG - Intergenic
1176936134 21:14869153-14869175 TGCAGCTACCCTAACTTGAATGG + Intergenic
1179208519 21:39305981-39306003 TGCAGTGACCCAATAATGAATGG - Intronic
1180008249 21:45033155-45033177 TGCGGCTAGCCCATCCTGAAGGG - Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
1182781578 22:32872772-32872794 TGCAGTCACCCCAACATTTAAGG + Intronic
954941220 3:54375031-54375053 TGCAGTTCCCTCATCCTGGAAGG + Intronic
955706695 3:61735047-61735069 TGCAGTTTCTTCATCAGGAAAGG + Intronic
957038486 3:75317122-75317144 TGCAGTAACCACCTCATCAATGG - Intergenic
959799309 3:110472623-110472645 TGATTTTACCCCATAATGAAAGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
962651516 3:137498609-137498631 TGCAGTTAACGCATCATCACAGG - Intergenic
963948570 3:151172596-151172618 TGCAGCTACCCCATCCTGAGTGG - Intronic
965317851 3:167212602-167212624 TGCAGTTAGCCCAAGATGAAGGG - Intergenic
967260971 3:187641701-187641723 TCCTGTTACCCCATCAAGATAGG - Intergenic
967425823 3:189326241-189326263 TGAATTTACCCAATCAGGAAAGG - Intergenic
970170518 4:13284653-13284675 AGCAGTTACCAAATAATGAAGGG + Intergenic
970934696 4:21555401-21555423 TTCAATTACTCCAGCATGAATGG + Intronic
972129341 4:35810467-35810489 TGCAGTGACCACATGATGAAAGG + Intergenic
979718291 4:123868221-123868243 TGAAATAAGCCCATCATGAAAGG + Intergenic
982860560 4:160443699-160443721 AGCAGTTACCTCATGATGATTGG - Intergenic
983669644 4:170221337-170221359 AGCAGTTAAGCCATCATGACTGG - Intergenic
984486612 4:180378021-180378043 TCCAGTTACCCCATCATGGCTGG + Intergenic
984692073 4:182738136-182738158 TGCTGTGAACCCCTCATGAAGGG + Intronic
985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG + Intergenic
986380625 5:7181721-7181743 GGCTGTTACCCCAACATGAGGGG - Intergenic
986453853 5:7895046-7895068 TACAGTTACACCACCATGCAAGG + Intronic
987220896 5:15789632-15789654 TGCACTTTCCCCATCCTGCAAGG + Intronic
991157870 5:63459490-63459512 TGCAATTAGCCCAGGATGAAGGG - Intergenic
991927200 5:71717707-71717729 TGCACTTACCCCTCCTTGAAAGG - Intergenic
992246558 5:74830201-74830223 TGCAAGTTCCCCATCATCAAGGG - Intronic
998257745 5:140601455-140601477 TGCTGTTGTCCCAACATGAAGGG - Intergenic
999537501 5:152533335-152533357 TGGACTTATCCCATCTTGAATGG - Intergenic
1007289240 6:40772710-40772732 TGCCCTTACCCTATTATGAAGGG + Intergenic
1008134241 6:47755186-47755208 GGCACTAATCCCATCATGAAGGG - Intergenic
1016796568 6:148124377-148124399 AGCAGTTCCCCCATCATCCATGG + Intergenic
1017913358 6:158813993-158814015 CGCAGTCACCCTAACATGAAGGG + Intronic
1018882239 6:167895953-167895975 TGCAGTTACATCATCATTCATGG + Intronic
1022881561 7:34593167-34593189 TTCACATACCTCATCATGAAAGG + Intergenic
1024219857 7:47278952-47278974 AGCAGTTTCCGCATCATGAAGGG + Intronic
1028938136 7:96488737-96488759 TCCAGTTACCCCATCCTTAGTGG + Intronic
1028963381 7:96774837-96774859 AGCAGTCACTCCATCATGATAGG + Intergenic
1029337861 7:99917798-99917820 TGGAGTTACACCATCAGTAATGG + Intronic
1032880454 7:136084442-136084464 TGAAGATACCCCTTCAAGAAAGG - Intergenic
1033754602 7:144387786-144387808 TGCAGTTGACACCTCATGAATGG + Intergenic
1035434435 7:158848959-158848981 TGCTGTTCCCCCAGCATTAAAGG + Intergenic
1040470057 8:47729452-47729474 TGCACTTACCCCATCTTCACCGG - Exonic
1040983224 8:53267016-53267038 TGCATTTACCCCATTTGGAAAGG - Intergenic
1042996326 8:74703552-74703574 AACAGTAATCCCATCATGAAGGG - Intronic
1044364521 8:91327154-91327176 TGCAGTAACCCAACCATGTATGG + Intronic
1045254248 8:100506368-100506390 TGTAGTTTCCCCATCATGTCAGG + Intergenic
1045499612 8:102735015-102735037 GGCAGTGACCCCATCAAGACTGG + Intergenic
1048069191 8:131004025-131004047 TGCAGTTACTCCAGCATGGTGGG - Intronic
1052162055 9:25274918-25274940 TCCTCTTACCCCATCATGAATGG - Intergenic
1052894364 9:33733609-33733631 TGCAGTAACCACATGGTGAATGG - Intergenic
1059494778 9:114700370-114700392 TGCAGGCACCCCATCCTGGATGG + Intergenic
1188824814 X:34818605-34818627 TGCAGTTACCCCTACAGGAGGGG + Intergenic
1191735785 X:64386638-64386660 TGCAGCTTCCCCATCAGGTAAGG - Intronic
1193703166 X:84789058-84789080 AGCAGTTACTCCATCAGGACTGG - Intergenic
1194854647 X:98914592-98914614 TGCAGTCATCCCAGGATGAAGGG + Intergenic