ID: 1105033330

View in Genome Browser
Species Human (GRCh38)
Location 12:132900520-132900542
Sequence AATTATCTGCAGACAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105033330 Original CRISPR AATTATCTGCAGACAATGTC AGG Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906735632 1:48124030-48124052 AATTCTTTCCAGATAATGTCTGG + Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907659967 1:56382943-56382965 AACTATCTGCACTCAATATCAGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910705133 1:90121501-90121523 AAATATAGGCAGACAATTTCTGG + Intergenic
910863067 1:91762281-91762303 AAACTTTTGCAGACAATGTCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912594084 1:110856795-110856817 AAGTATCTGAAGACATTCTCAGG + Intergenic
913038174 1:114995197-114995219 AATTATCTGAATACAATGACAGG - Exonic
915725220 1:158012451-158012473 AATTACCTGCATAGAATGTGTGG + Intronic
915755220 1:158252939-158252961 AATTATTTGCAGGCCATGCCTGG + Intergenic
916572215 1:166037855-166037877 AATTATCTGCAGAGCATGTATGG + Intergenic
916688378 1:167168395-167168417 AAATATCTCCTAACAATGTCAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917406853 1:174716236-174716258 AATTATCTGCATCCATTGTTTGG + Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920061669 1:203231043-203231065 TAATGTCTGCAGACAATGTCTGG + Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923076325 1:230611969-230611991 TGTTATCTGCAGACATTGTGTGG - Intergenic
923409688 1:233694638-233694660 AATGATGCGCAGACAATATCTGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066399628 10:35063280-35063302 AATTATTTGAAGACACTGTAAGG + Intronic
1066788321 10:39031419-39031441 AATTATCTTCAGACAAAAACTGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069257225 10:66347745-66347767 AGTTATCTGCAGAAATTATCTGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071070390 10:81685021-81685043 AATTATCTGCTTATAATGTGAGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076431436 10:130405961-130405983 AATTAGCTGCATACACAGTCAGG - Intergenic
1076749065 10:132532952-132532974 AATTGTCTGCAGACAGAGCCTGG - Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080883793 11:36347015-36347037 AAGTATCTGCAAACCATGACTGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081623580 11:44633546-44633568 AATTACCTCCAGACTATGTGTGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088495578 11:110428799-110428821 AAGTATCTGCGGACAATGTATGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095368163 12:41433435-41433457 ATTTAACTGCAGAAAATGTTAGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098156644 12:67606379-67606401 AATTATCTGATGACTCTGTCTGG + Intergenic
1098505548 12:71246211-71246233 AATTAACTGAAGTCAATGTCAGG + Intronic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099853972 12:88141397-88141419 AATAATCTGCAAAAAATGTAAGG - Intronic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101493807 12:105235514-105235536 AGTTGTCAGCAGACAATGTCCGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101749782 12:107574038-107574060 AATAGTCTGCAGACAATGCTTGG + Intronic
1102264696 12:111473260-111473282 AATTTTTTGGAGACAAGGTCTGG - Intronic
1102540066 12:113612220-113612242 AATTATCTGGAGTCATTCTCAGG + Intergenic
1102672762 12:114633930-114633952 AAATATCTCCAGACAATGCCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103396526 12:120611420-120611442 AGTTACCTGCAGAACATGTCAGG - Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105586165 13:21744911-21744933 AATTATCTGAGGGAAATGTCAGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1109879265 13:68450499-68450521 AAATATCTGCAGTGCATGTCAGG + Intergenic
1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG + Intergenic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1110510917 13:76349288-76349310 AACTAACTGCAGACAAAGTAGGG - Intergenic
1110851682 13:80253091-80253113 ACTTATATGGAGACAATGTTCGG - Intergenic
1110958387 13:81586791-81586813 AGTTATGTGCAGAAAAAGTCAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112663115 13:101536832-101536854 AATTATTTCCAGAAAATATCTGG + Intronic
1113553239 13:111209651-111209673 AGTTATCTCCAGATAATTTCTGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114430220 14:22654425-22654447 CATTATCTGCCGAGTATGTCAGG - Intergenic
1114831910 14:26153951-26153973 AATTATTTGAAGACCATGTCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115073762 14:29360437-29360459 AAGAAACTGCTGACAATGTCTGG - Intergenic
1116284975 14:42959111-42959133 AATTATCTGCGCCCACTGTCTGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1126112561 15:45184438-45184460 AAATATCTGCACACAATTTCTGG + Intronic
1126896095 15:53258480-53258502 GATTATCTACAGGCAATGTCTGG - Intergenic
1126898839 15:53290146-53290168 AGTTAGCAGCAGAGAATGTCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127781229 15:62318634-62318656 AATTATCTGCAGACAACTAGGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133103332 16:3492266-3492288 AAGTGTCTCCAGACATTGTCCGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136508518 16:30721733-30721755 AATTATGATCTGACAATGTCTGG - Intronic
1137492801 16:48947039-48947061 AAATATCTACAGACCATCTCTGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140286894 16:73611659-73611681 AATTGTGTGCAAACAAAGTCAGG + Intergenic
1141428672 16:83959651-83959673 AATTGTCTCCAGACATTGCCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1145032427 17:19515058-19515080 AATTATCTGCGCACGATGGCAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146612062 17:34315121-34315143 GATTATTTGCAGACAATCACAGG + Intergenic
1147021190 17:37534646-37534668 AATTATCTACATACAATTTTAGG + Intronic
1149664259 17:58354732-58354754 TGTTTTCTGCAGACAAGGTCTGG + Exonic
1150570556 17:66382723-66382745 AAATGTCTCCAGACACTGTCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151157737 17:72138430-72138452 AAATATCTGGAGACAATATTGGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154402711 18:14056894-14056916 AATTATCTTTAGAGAATGTCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156602613 18:38627308-38627330 AGATATCTGCAGAAAAGGTCAGG - Intergenic
1156651728 18:39233873-39233895 AATTCTCGGCAGACAGTGGCAGG - Intergenic
1156949652 18:42879732-42879754 AATTATTAGCAGACAATATTGGG - Intronic
1158019769 18:52827679-52827701 TACTATTTGCAGACAATGGCAGG + Intronic
1158140310 18:54248385-54248407 AAATATCTGGAGAAAATTTCAGG - Intergenic
1159199168 18:65161524-65161546 ATCTATGTGCAGACAATGTGAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1162151622 19:8649701-8649723 AATTCTCTGCAGACAATGTGAGG - Intergenic
1163349095 19:16764101-16764123 AACTATCTGCGGACACTGTAAGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1167198203 19:48045143-48045165 ATTTATATGCAGGCATTGTCTGG + Intergenic
1167215984 19:48164962-48164984 AAATATCTCCAGACACTGGCCGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
926496337 2:13592818-13592840 CACTATCTGCAGACATGGTCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928012165 2:27619414-27619436 AATTATCTCCTGACAAAATCTGG + Intronic
929550259 2:42886001-42886023 AATTATCTGAAGATTATGTCAGG - Intergenic
930340247 2:50104027-50104049 AATTATCTCCAAACAATATAGGG - Intronic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
932221895 2:70006160-70006182 AAATATCTCCAGACATTGCCAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933886881 2:86726681-86726703 AATTATCTCCAGAGTACGTCTGG - Intronic
933923297 2:87070027-87070049 AATTATCTCCAGAGTACGTCTGG + Intergenic
934118030 2:88814068-88814090 AAAATTCTGCAGACAATGTGGGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936646294 2:114376411-114376433 AATTATCTGTGGATAATGGCAGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937702558 2:124880607-124880629 AATTATCTACAAACAATGTTAGG - Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937850269 2:126626255-126626277 AATTCTCTGCAGACACTACCGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943706925 2:191045760-191045782 AACTATCTGCAGGCAATGTAAGG - Intronic
945220364 2:207477544-207477566 TTTTTTCTGGAGACAATGTCTGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947329708 2:229015741-229015763 AATTAGCTGCACACAGTGGCGGG - Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948157607 2:235796677-235796699 AATTATCTGCAAACACTATATGG + Intronic
1170008729 20:11697411-11697433 AGTTATCAGCAGCCAATGACTGG - Intergenic
1170959204 20:21010122-21010144 AATTCTCTGCAGACACTAACTGG + Intergenic
1172744158 20:37193849-37193871 AATTATCTGCATAGAATTTTGGG + Intronic
1172832713 20:37849660-37849682 GATTTTCTGCAGAAACTGTCAGG - Intronic
1174853579 20:54021034-54021056 AATGATTTCCAGACAATGTTAGG + Intronic
1175605024 20:60305602-60305624 AATAATTTGGAGACAATATCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1177216973 21:18142786-18142808 AAATATATGCAGACAATAGCTGG + Intronic
1177387854 21:20430346-20430368 AATTTTCTGGAGCCATTGTCAGG - Intergenic
1177746296 21:25217765-25217787 GAGTATTTGCAGACATTGTCTGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178634463 21:34290168-34290190 AATTACCTTCAGATAATGGCAGG - Intergenic
1178906593 21:36642063-36642085 AATCATCTGCAGGCAGGGTCTGG - Intergenic
1179382154 21:40909916-40909938 AATTATCTACAGCAAATGACAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182392173 22:30007585-30007607 CAGTATCTGCAGACCATGGCAGG + Intronic
1183055733 22:35304434-35304456 ATTTGTCTGCAGAGAATATCTGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185212954 22:49582107-49582129 AATTACATGCAGACAAAGTACGG + Intronic
1185230270 22:49676628-49676650 AAATATCAGAAAACAATGTCTGG - Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949932311 3:9088586-9088608 AATTACCTCCAGACATTGCCAGG + Intronic
951112581 3:18822343-18822365 AATTTTCTGCAGAAAGTCTCAGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952209954 3:31220310-31220332 TATTTTTTGAAGACAATGTCAGG - Intergenic
952368410 3:32695806-32695828 GATTATGTGCAGACTCTGTCTGG + Exonic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953321489 3:41976365-41976387 AATTATCCGCAGAGAATGAGGGG + Intergenic
953764845 3:45730928-45730950 AATTATATGCAAATAAGGTCTGG + Intronic
954838216 3:53489877-53489899 AAATATCAGCTGACAATTTCTGG + Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955141657 3:56275797-56275819 AAATGTCTGCAGACATTGCCAGG - Intronic
955399230 3:58579393-58579415 AATTTTCTGGAAACAATGTGTGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957361425 3:79164251-79164273 TAATATCTGCAGACTATATCAGG + Intronic
957411788 3:79850810-79850832 AATTATGTTCAGAGAATGTGGGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958647304 3:96888743-96888765 AAATGTCTCCAGACCATGTCAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
964021344 3:152016076-152016098 TATTATCTGCAAATAATGACAGG + Intergenic
964076742 3:152701051-152701073 AAATATCTCCAGGCCATGTCAGG - Intergenic
964119186 3:153163976-153163998 AAATATCAGCAGACACTTTCTGG - Exonic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965814328 3:172621089-172621111 ATTTTTCTGGAGACAATGTCTGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966943027 3:184758885-184758907 AATACTTTGCACACAATGTCAGG + Intergenic
967714721 3:192749302-192749324 AGTTACGTGCAGACAAAGTCAGG - Intronic
969594502 4:8141325-8141347 AATTAACTGCAGGTCATGTCTGG - Intronic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971771403 4:30901668-30901690 AACCAACTGCAGATAATGTCTGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972361366 4:38328467-38328489 AATTATCTGCAGAAAGCATCTGG - Intergenic
972612490 4:40668586-40668608 AATTCTCTGCAGACAACAGCTGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG + Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976789664 4:88863685-88863707 AATTATCTGCAGACATGAACTGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978046099 4:104129625-104129647 AATTATCTCAACACAATGTGGGG - Intergenic
978093610 4:104747796-104747818 ACTTATCTGGAGTCAAGGTCAGG - Intergenic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980928981 4:139167248-139167270 AAGAATGTGCACACAATGTCTGG + Intronic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981470053 4:145123209-145123231 AATTAGGTGCAGACATTATCTGG + Exonic
981856550 4:149300664-149300686 AATTCTCTGGAGACACTGTGAGG - Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986526433 5:8683553-8683575 AATTATCTGCAGACATTTCTGGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987577066 5:19743575-19743597 AAAGATCTGCAGACAATGGCAGG - Intronic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989343224 5:40400532-40400554 AAATGTCTGCAGACAAACTCTGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991077999 5:62563675-62563697 AATTATCTTCAGACTATATGAGG - Intronic
991485443 5:67130556-67130578 AATTATCAGAAGATAATGACTGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994471194 5:100210245-100210267 AACTGTCTGCAGTCAATGACTGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994993076 5:107022567-107022589 AATCATCTGCAGACAAATTTTGG + Intergenic
995417850 5:111929954-111929976 AATTGCCTGCAGACAAATTCAGG - Intronic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997349082 5:133217307-133217329 GGGTATCTGCAGTCAATGTCCGG - Exonic
998881906 5:146653615-146653637 AAATCTCTGCAGACAATGCACGG - Intronic
1000565172 5:162837488-162837510 AATTATCTACACACAATGAGGGG + Intergenic
1000766633 5:165299637-165299659 AATTTTTTGCAGCCAATGACAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001570055 5:172725004-172725026 ACCTGTCTGCAGGCAATGTCTGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006529837 6:34642415-34642437 GATTAGCTGCAGACAAGGGCAGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011161712 6:84398037-84398059 AATAACCTGCACAGAATGTCTGG + Intergenic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013356769 6:109352094-109352116 AATTATTTGGAGACAATGTGAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1016881763 6:148918454-148918476 CATTGTCTGCAGACAAATTCAGG - Intronic
1017289556 6:152720222-152720244 ATTTATATGCTGACAATGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018457842 6:163968737-163968759 TATTATGTGAAGACAATCTCTGG - Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019810266 7:3159889-3159911 ATTTGTTTGCAGACAATTTCCGG + Intronic
1020505369 7:8980255-8980277 AATTATCTACAGACAACAACTGG - Intergenic
1020515213 7:9108974-9108996 AAATTTTTGCAGAAAATGTCTGG - Intergenic
1020605751 7:10334538-10334560 AAGTTTCTGCACACAATTTCAGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1021508270 7:21408970-21408992 ATTTACCTGGAGACAGTGTCAGG + Intergenic
1022568163 7:31424425-31424447 ACCTACCTGGAGACAATGTCAGG + Intergenic
1023314398 7:38920457-38920479 ACTTATCTGCACAGAATGACAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024434827 7:49339554-49339576 CATTATCTGATGTCAATGTCTGG + Intergenic
1024799696 7:53061855-53061877 ACTTGTCTGCAGATTATGTCAGG + Intergenic
1026886258 7:73948758-73948780 AATTCTCTGCAGAAATTATCTGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027688008 7:81302065-81302087 AATTGTCAGCAAACACTGTCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028820161 7:95200198-95200220 AAATACCTGCAGAAAATGTGTGG - Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029410420 7:100406214-100406236 AATTATCTCCAGCCATTGCCAGG - Intronic
1029589043 7:101495104-101495126 CGTTATCTGCTGAGAATGTCAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030654986 7:112157542-112157564 AATTATTTGGAGATAATGTAAGG + Intronic
1030968743 7:116027126-116027148 AGTTCTCTGCAGACATTGGCAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031977269 7:128102102-128102124 AAGTATCTGCAGATAGTATCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1036939966 8:13042180-13042202 AATTACCAGCAGACAACATCTGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG + Intergenic
1041491181 8:58435363-58435385 AATTATATACAGATACTGTCAGG + Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045332318 8:101166109-101166131 ATCTATCTGCAGGCATTGTCTGG - Intergenic
1045897541 8:107237398-107237420 AATTATCTGCAAATAAGGTATGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052280519 9:26727971-26727993 TATCATCTGCAGATATTGTCAGG + Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1055863527 9:80784478-80784500 AATAAACTGCAGATAATGACAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059002725 9:110366983-110367005 AATTATCTGGAGAAAAGGCCAGG + Intronic
1059204941 9:112455749-112455771 AATTATCTGCTGACACTGGCAGG - Intronic
1059527803 9:115008309-115008331 TGTTATTTGCAGACAATGTTGGG + Intergenic
1060551106 9:124485878-124485900 AATTGTCAGAAGAGAATGTCAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185622255 X:1457386-1457408 AAATATCTTCAGACATTGCCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187535582 X:20139022-20139044 AATTAAGTGAAGACAGTGTCTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187726744 X:22211190-22211212 ACTCATCTGCACTCAATGTCAGG + Intronic
1188359004 X:29229321-29229343 AATTTTCTGCAGAAAATTTAAGG - Intronic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190493513 X:51005576-51005598 TATTATCTGCAGACACCGGCTGG - Intergenic
1190511194 X:51175827-51175849 TATTATCTGCAGACACCGGCTGG + Intergenic
1190601542 X:52097865-52097887 AATTATCTGAGGATAATGGCAGG + Intergenic
1190901763 X:54681829-54681851 AAAAATCTGCAGCCAATATCAGG - Intergenic
1191189786 X:57654760-57654782 AATTATCTGCAGATCCTGCCAGG + Intergenic
1191631292 X:63324848-63324870 ATTTATCTTCAGATAATGACAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192549370 X:72041859-72041881 AATTCTCTGCAGGCCATGGCTGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195124735 X:101796430-101796452 GATGAACTGTAGACAATGTCTGG + Intergenic
1195742688 X:108081486-108081508 AATTCTCTGCAGACACTGACTGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196915250 X:120527654-120527676 AATTATCTTCAGGCTATGTAAGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic