ID: 1105035136

View in Genome Browser
Species Human (GRCh38)
Location 12:132913874-132913896
Sequence TCATCTATTAAGTTTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105035136 Original CRISPR TCATCTATTAAGTTTGAATA TGG Intronic
906233878 1:44191155-44191177 TCCTTTATTAAATCTGAATATGG + Intergenic
908526013 1:64988275-64988297 TCATCTGTAAAGTAGGAATATGG - Intergenic
908668561 1:66519901-66519923 TCATATATTTACATTGAATATGG - Intergenic
909099111 1:71328868-71328890 TCTTCTATTAATTTTGGATTTGG + Intergenic
909273370 1:73652936-73652958 ACATATATTAAGTTACAATATGG - Intergenic
910801019 1:91146085-91146107 TCTTCTACTAATTTTGAATTTGG + Intergenic
912052445 1:105546340-105546362 TCAGCTATCAATTTTGCATAAGG + Intergenic
912588619 1:110790742-110790764 TCATCTTTTAAATTTGTTTAAGG - Intergenic
914769521 1:150671431-150671453 TCTTCAAGGAAGTTTGAATAAGG - Intronic
916659992 1:166914688-166914710 TGATCTATGAAGCTTGAAGAAGG - Exonic
917055781 1:170979743-170979765 TCCTTTATGAACTTTGAATATGG - Intronic
917328700 1:173860132-173860154 TCATATATAAAGTTGGAAAAGGG + Intergenic
920596390 1:207275764-207275786 TCTTCTATTAACTTTGAGTTTGG + Intergenic
922044641 1:221932532-221932554 TCATCTATTAATTTTGGATTTGG - Intergenic
923178069 1:231487711-231487733 CAATCTATTAAATTTGAATAAGG - Intergenic
923886334 1:238161363-238161385 TCTTCTATTAATTTTGGATTTGG + Intergenic
923941056 1:238827709-238827731 TGATGTATTATGTGTGAATAAGG + Intergenic
923960335 1:239074902-239074924 TCTTCTATTAATTTTGGATTTGG - Intergenic
924018632 1:239755958-239755980 TCATCTATATAGTTTTATTAGGG - Intronic
1063302014 10:4858408-4858430 TCATCTATTCATTTTTAATGGGG - Intergenic
1063469047 10:6269826-6269848 TTATCTATTTATTTTGAAAATGG + Intergenic
1064797220 10:19026223-19026245 TCATTTATTTAATTTGAATTTGG + Intergenic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1065377794 10:25060595-25060617 TCAATTATAAAGTTTGAATGGGG + Intronic
1068888362 10:62121656-62121678 CCATCTATTAATTTTGAGTTTGG + Intergenic
1069415148 10:68193050-68193072 CCATCTACTAATTTTGAATTTGG + Intronic
1070996504 10:80788269-80788291 TCAACTATTAAGTTTGGAGGTGG + Intergenic
1071870197 10:89785571-89785593 TCATCTATTGAGGTAGAATAGGG - Intergenic
1072996172 10:100246268-100246290 TCATCTCTTAAGGCTGAATTAGG - Intronic
1076588273 10:131565454-131565476 ATATCTATTAAGTTTTATTAAGG + Intergenic
1079371063 11:19853065-19853087 TCACATATAAAGTTTGAACACGG - Intronic
1080053791 11:27884259-27884281 TCATGTATTCAGTTTGGATCTGG + Intergenic
1083117556 11:60477025-60477047 TCTTCTTTTAAATTTGAATTAGG - Intergenic
1083192477 11:61062226-61062248 TCCTCTATGAAGTGGGAATAAGG - Intergenic
1085771914 11:79333158-79333180 TCATATATTAACTTTGACTTTGG - Intronic
1086975799 11:93131360-93131382 TCATTAATTAATTTTGAAAATGG + Intergenic
1087511425 11:99100567-99100589 TAATCTATTAAGCTTTAACAAGG + Intronic
1089907840 11:122063077-122063099 TGATCTATTAATTCTGAACAAGG + Intergenic
1090316553 11:125795371-125795393 TCATCTACTAATTTTGAGTTTGG + Intergenic
1092470846 12:8779262-8779284 TCACCTAATAAGTTTGAATATGG - Intronic
1093138983 12:15485508-15485530 TCATCTATTAAGCAAGCATAAGG - Intronic
1093414025 12:18899667-18899689 TCATTTTATAAGTCTGAATAAGG + Intergenic
1094251517 12:28367814-28367836 ACATCTGTGAACTTTGAATATGG + Intronic
1095322089 12:40840916-40840938 TCATCTGCTAATTTTGAATTTGG - Intronic
1095838603 12:46666984-46667006 TCATCTATTAAATTTGTAATGGG + Intergenic
1098419230 12:70274482-70274504 TCATATTTTAACTTTGAGTATGG + Intronic
1101110170 12:101478796-101478818 TTATGTATTAAGTTTATATAGGG + Intronic
1101384018 12:104240096-104240118 TCATAAAATAAGTTTGAAAATGG + Intronic
1101507044 12:105356832-105356854 TTATGTATTAACTTTGAATAAGG + Intronic
1101540279 12:105658884-105658906 TCATCTGTGAAGTGGGAATAAGG - Intergenic
1101914837 12:108888040-108888062 TCATTTATTAAGTGAGGATAAGG - Intronic
1102635946 12:114324035-114324057 TCATCTCCTATGTTTGAATTGGG - Intergenic
1105035136 12:132913874-132913896 TCATCTATTAAGTTTGAATATGG + Intronic
1105566088 13:21549632-21549654 TCATGTTGTAAGTTTAAATAAGG + Intronic
1106799861 13:33244891-33244913 TCAGCCATTAAATTTGAATTCGG + Intronic
1107259000 13:38468168-38468190 TAATCTATAAAGTTTTAATTTGG + Intergenic
1109204677 13:59468142-59468164 TCATTTATAGATTTTGAATATGG + Intergenic
1109630791 13:65043525-65043547 TCAACTAATAATCTTGAATATGG - Intergenic
1109656908 13:65404454-65404476 TCATCCCTGAAGATTGAATAAGG + Intergenic
1109798692 13:67347135-67347157 TCCTCTCTTAAATTTGGATAAGG + Intergenic
1110070007 13:71163150-71163172 TCTTCTATTAAATTTCAGTAGGG + Intergenic
1110573965 13:77035381-77035403 TCATCTATAAAATGGGAATAAGG + Intergenic
1111041333 13:82752908-82752930 TCATTTAATTAGTTTTAATATGG + Intergenic
1111568305 13:90045928-90045950 TCTTCTATTAATTTTGGATTTGG + Intergenic
1112074795 13:95900279-95900301 TAAGCTATTAAGTTTTATTAGGG + Intronic
1112433432 13:99373216-99373238 TCATTTGTTAATTTTGAGTATGG - Intronic
1114157098 14:20117319-20117341 GTATCTATTAAGTCTGAAAAAGG - Intergenic
1116167537 14:41352060-41352082 TGAAATATTAAGTTAGAATATGG - Intergenic
1116879579 14:50151165-50151187 TCTTATATTTAGTTTGAAAAGGG + Intronic
1117606629 14:57436323-57436345 TCTTCTATTAATTTTGAGTTTGG + Intergenic
1118672531 14:68145110-68145132 TCATCTATTAATATAAAATAGGG - Intronic
1119953788 14:78773302-78773324 TCATCTATTGATATTGAATGTGG + Intronic
1120049510 14:79848976-79848998 TCATCTCTTAAATTTGATTCAGG + Intronic
1124798631 15:32807652-32807674 TGCTCAATTCAGTTTGAATAGGG - Intronic
1126429987 15:48572962-48572984 ACATCTGTTAAGTGTGAAAAGGG + Intronic
1126464604 15:48950558-48950580 TGATCTAATAAGTTTTAAAATGG + Intronic
1130003376 15:80067814-80067836 TGATGTATTAAGTTTGAAATAGG + Intronic
1130786843 15:87107389-87107411 TCTTCTACTAATTTTGAATTTGG - Intergenic
1131626575 15:94126988-94127010 TGATTTATTAAGTCTGAAAAGGG - Intergenic
1132264199 15:100452616-100452638 CCATCTATTAATTTTGCATTTGG - Intronic
1132267811 15:100491734-100491756 TATTCTATTAAGTTTTAGTATGG + Intronic
1135104751 16:19639217-19639239 TCATCTGTAAAGTGGGAATATGG - Intronic
1138177436 16:54913619-54913641 TCATATATAAAGTTTAAAGATGG + Intergenic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1149765259 17:59270718-59270740 TTATTTATTACTTTTGAATAGGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1154085177 18:11297684-11297706 TCATCTTTTAAGTAAGAGTAAGG - Intergenic
1155210256 18:23594520-23594542 TAATTTATTAAGTTTTAGTAGGG + Intergenic
1156829008 18:41468223-41468245 ACATCTATTAAAATAGAATATGG + Intergenic
1156944056 18:42805795-42805817 TCAGCAATAAAGTTTGAGTAAGG - Intronic
1157124638 18:44944598-44944620 TCATCTCTTAATTTGGAACATGG - Intronic
1157209411 18:45728568-45728590 TCAGCTATGAAATTTGAAGAGGG + Intronic
1157650578 18:49325598-49325620 TTATATATAAAGTTTGAAAAAGG + Intronic
1158433940 18:57420063-57420085 TTTTATTTTAAGTTTGAATAAGG + Intergenic
1158894710 18:61901880-61901902 TAATCTATTAATTTTGGATATGG - Intergenic
1158991332 18:62871973-62871995 TCATTTATTAAGGATGTATAGGG + Intronic
1159222605 18:65484331-65484353 TGATTTTTTAAGTTTTAATAGGG + Intergenic
1159894893 18:73987245-73987267 TAATCTCTCAATTTTGAATATGG - Intergenic
1165276297 19:34754745-34754767 TGATCTATGAAGTTTGATTATGG - Intergenic
1166002709 19:39887352-39887374 TCATCTATCAAGTGGGAATAAGG + Intronic
1166005495 19:39903604-39903626 TCATCTATCAAGTGGGAATAAGG + Intronic
1166929832 19:46295907-46295929 TCATCTATTTAATTTGAATAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927441140 2:23118791-23118813 TCATCTGTAAAGTGGGAATAAGG + Intergenic
932544964 2:72699139-72699161 TCTTCTATTAACTTTGGAGAAGG - Intronic
933116644 2:78481539-78481561 TTATGTATTAACTTTGTATATGG + Intergenic
933521088 2:83374976-83374998 TCATCTGATAAGTTTCTATAGGG - Intergenic
933896941 2:86820064-86820086 TCATGTGTTAAGTTTGATCACGG - Intronic
935818833 2:106873383-106873405 TCATCTATGAAATTTGAAAAAGG - Intronic
936442167 2:112563947-112563969 TCATCCATTCAGTCTGATTATGG + Intronic
936881532 2:117257753-117257775 TTATTCATTAAGTTTGAATCTGG + Intergenic
938922771 2:136010085-136010107 TCATATGTTAAGGTAGAATAGGG - Intergenic
939079735 2:137645537-137645559 TAAGCGATTAAGGTTGAATATGG + Intronic
941040123 2:160611990-160612012 TCATTTATCAAATTTGAACAGGG - Intergenic
942882289 2:180875723-180875745 TCTTCTACTAAATTTGAATTTGG - Intergenic
943326351 2:186502937-186502959 TAATGTATTTAGTTTTAATAGGG + Intronic
943538058 2:189177483-189177505 TTCTCTATTATGTTTGATTAGGG + Intronic
944825736 2:203481546-203481568 TCATCTATTTAAAATGAATAGGG - Intronic
945058354 2:205887572-205887594 TCATGTAATAGTTTTGAATAGGG + Intergenic
946820418 2:223623018-223623040 CCATCTATTAACTTTGCTTATGG + Intergenic
946968251 2:225063197-225063219 TCATTTATTATGATTAAATAAGG + Intergenic
947034557 2:225837480-225837502 TCAGCTATCTAGTTAGAATATGG + Intergenic
947576668 2:231280675-231280697 TCATCTTTTGACTTTGATTATGG - Intronic
1169670136 20:8090264-8090286 TCATTTATTAAATTGCAATAAGG - Intergenic
1177221902 21:18205490-18205512 TCTTCTACTAAGTTTGCATTTGG + Intronic
1177870869 21:26571708-26571730 TCTTTTATTAAATTTGTATAAGG - Intronic
950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG + Intronic
950240340 3:11364382-11364404 TCATCTATAAAGTAGGAATGAGG - Intronic
950785641 3:15432272-15432294 TTATCTATTCAGTTTTTATAAGG + Intronic
951311925 3:21137648-21137670 TGATCTAGTAAGTTAGAAAATGG - Intergenic
951413930 3:22399643-22399665 TGATCTATTAATTTTTAACAAGG - Intergenic
951644367 3:24871966-24871988 TCATCTCTTGACTTTGAAAAGGG + Intergenic
954774757 3:53006705-53006727 GCATCTATGAATTTTGGATATGG + Intronic
956839769 3:73127696-73127718 TCATGTGTTAAGTTTTAATACGG + Intergenic
957712960 3:83888085-83888107 TTCTCCATTAAGTTTCAATAAGG + Intergenic
958175012 3:89986567-89986589 TCATCTACTAATTTTGAGTTTGG - Intergenic
959776434 3:110169817-110169839 TCATCTATAAAATATGAATAAGG + Intergenic
962064939 3:131969428-131969450 GCATCTCTTAAGCTTGAACAAGG - Intronic
963498848 3:146099840-146099862 TCATCTATTAAATTTGCCTAGGG + Intronic
963970655 3:151426019-151426041 TCATTTATCACATTTGAATAGGG + Intronic
966576069 3:181504061-181504083 TCAGCAATTAAGTTTTATTATGG + Intergenic
966587606 3:181644820-181644842 TAGTCTATAAAGTTTAAATATGG - Intergenic
968240708 3:197082022-197082044 TTATCTATTTAGTTTTACTATGG + Intronic
968388940 4:172655-172677 TCATTTATTTTGTTTGAAGAAGG - Intergenic
969985099 4:11200428-11200450 ACAACTATTAATTTTGAATCTGG + Intergenic
970020810 4:11566421-11566443 TCAAGTATTAAGTTTTAAAATGG - Intergenic
970189610 4:13501184-13501206 TCATCCTTTAACTTTGCATAGGG - Intergenic
971427118 4:26527097-26527119 TCATCTGTTAAATGGGAATAAGG + Intergenic
971518391 4:27517102-27517124 TCATCTATCAAGTTAAAATTTGG - Intergenic
971651078 4:29274937-29274959 TCATATTTTAAAATTGAATATGG + Intergenic
972236856 4:37145221-37145243 TCTTCTATTAACTTTGAGTTTGG + Intergenic
972411390 4:38799081-38799103 TAATCAAATAAGTTTTAATATGG + Intronic
972439017 4:39066820-39066842 TCATCTATAAAATTAGAATTAGG - Intronic
973822203 4:54671633-54671655 TCAACTAATAAATTTAAATAGGG - Intronic
975058380 4:69964970-69964992 TCATCTATTATCTTTGTTTATGG + Intergenic
975318819 4:72986036-72986058 TCATCTTTTAACTTTGTGTATGG + Intergenic
975523943 4:75328902-75328924 TCATTTATTCAGTTTGATTGAGG - Intergenic
976933084 4:90592708-90592730 TCATCTATTGAATTAGAGTAGGG + Intronic
979554269 4:122026909-122026931 ACATCCATTAAGTTAGAATTAGG + Intergenic
979686632 4:123517606-123517628 GCATCTCTTAATCTTGAATATGG + Intergenic
980279441 4:130700360-130700382 TCATCTTTTAATTGTGAATTTGG - Intergenic
982492614 4:156047710-156047732 TTATCTATTGAGTTTGCTTATGG - Intergenic
983579914 4:169298460-169298482 TCTTCTACTAAGTTTGAGTTTGG - Intergenic
983902187 4:173147342-173147364 TCATTTATTAAATTTGGAAATGG + Intergenic
983978903 4:173970177-173970199 TCATAAAATGAGTTTGAATATGG + Intergenic
984054818 4:174914746-174914768 TCATTTATTTATTTTGCATATGG - Intronic
984068460 4:175080855-175080877 TCTTCTATTAATTTTGGATTTGG + Intergenic
987507228 5:18789403-18789425 TCTTCTGTTATGGTTGAATATGG + Intergenic
987660982 5:20875676-20875698 TCATCTATTAAGATATATTATGG - Intergenic
988162600 5:27540457-27540479 TGATCTAGTAACTTTGAAAATGG + Intergenic
988762657 5:34330014-34330036 TCATCTATTAAGATCTATTATGG + Intergenic
990095915 5:52112559-52112581 TCATCTACTAATTTTGAGTTTGG + Intergenic
992993719 5:82312136-82312158 TCAGCTGTGAAGTTAGAATAAGG + Intronic
993108466 5:83626682-83626704 GCTTCAATTTAGTTTGAATATGG - Intergenic
993233879 5:85277767-85277789 TAACCTATTAAGATTGAATCAGG + Intergenic
993762719 5:91816399-91816421 TCATTTTTCAAGTATGAATAGGG - Intergenic
993776402 5:92003788-92003810 TCAACAATTAAATTTTAATATGG + Intergenic
993864591 5:93177066-93177088 ACATCTATTAAGTTTGAATTGGG - Intergenic
993893149 5:93499528-93499550 ACATTTATTAAGTTTGCTTATGG - Intergenic
995761598 5:115567609-115567631 TTATCTATTTCGTTGGAATATGG + Intergenic
996079371 5:119239569-119239591 TAATATATGAAGTCTGAATATGG - Intronic
996502402 5:124231165-124231187 CTATCTATCCAGTTTGAATAAGG - Intergenic
997146946 5:131445121-131445143 TCATTTATTACATTTGAGTAAGG - Intronic
999476748 5:151907148-151907170 TCATCTATAAACTAAGAATATGG + Intronic
999742053 5:154563382-154563404 ACATATATTAAGTTTCCATATGG + Intergenic
1000937448 5:167320146-167320168 TCATCTGTTAAGATAGAATGAGG - Intronic
1001996572 5:176165328-176165350 CAATATATTTAGTTTGAATACGG - Intergenic
1003091886 6:3111115-3111137 TCATTTATTTATTTTTAATATGG + Intronic
1004291622 6:14372944-14372966 TTATCTATAAAGTGTGAGTAAGG + Intergenic
1005629018 6:27689927-27689949 TCATCAAAGAGGTTTGAATATGG + Intergenic
1006553745 6:34847823-34847845 TCTTCTATTAATTTTGGATTTGG + Intronic
1007220593 6:40275827-40275849 GCATGTACTAAGTCTGAATATGG - Intergenic
1007289010 6:40770223-40770245 TCATCTTTCAAGCTTGACTATGG + Intergenic
1007528662 6:42520666-42520688 GCATCTATTATGCCTGAATAAGG + Intergenic
1008063367 6:47022387-47022409 TCATCGTTTAATTTTTAATAGGG - Intronic
1008602070 6:53106245-53106267 GCATCTACTAGGTTTGAATTGGG - Intergenic
1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG + Intergenic
1009512275 6:64568403-64568425 TAAACTATTACGTTTGACTAGGG - Intronic
1009722647 6:67493190-67493212 TCTTTTATTAAGTTTGAGGAAGG - Intergenic
1011998839 6:93627935-93627957 TCATCTGTTAAAATTGTATAAGG + Intergenic
1013722502 6:113047618-113047640 GCTTCTACTAAATTTGAATAAGG + Intergenic
1013887230 6:114983741-114983763 TAGTCTATTAACTTTGAATGTGG - Intergenic
1014030969 6:116703875-116703897 TCATTTATTAAATTTCAATTAGG - Intronic
1014329715 6:120047372-120047394 TCATGTATAATGTTTGAAAATGG - Intergenic
1014716453 6:124869931-124869953 ACATCTATTAATTTTTAAAAAGG + Intergenic
1018075066 6:160205380-160205402 TCATCTATTAAATTTGTTTTTGG + Intronic
1018994308 6:168699647-168699669 TCTTCTCTTTACTTTGAATATGG + Intergenic
1019761735 7:2817817-2817839 TCATCTATTAATTGTGAATAAGG + Intronic
1020887706 7:13839790-13839812 TCATCTAAATTGTTTGAATAAGG - Intergenic
1020976680 7:15015399-15015421 TCATCTATCCAGTTTGCAAATGG - Intergenic
1021231365 7:18088903-18088925 TCATCCATTTTGTTTGAATGGGG + Intronic
1021864525 7:24941691-24941713 TCTTCTATTAGGTGTGATTATGG - Intronic
1022552101 7:31250724-31250746 TCATCTAAAAAGTTCCAATATGG + Intergenic
1022972077 7:35527746-35527768 TCATATTTTATGTTAGAATATGG - Intergenic
1023411038 7:39889505-39889527 TAATCAATGAAATTTGAATATGG + Intergenic
1024347117 7:48324353-48324375 TCATCAATTAAGTTAAAATGAGG - Intronic
1027441733 7:78226423-78226445 TCAGCTATAAAGTTGAAATAAGG - Intronic
1027824478 7:83093223-83093245 ACATTTATTGATTTTGAATATGG - Intronic
1028591311 7:92498535-92498557 TTATAAATCAAGTTTGAATAAGG + Intronic
1028733768 7:94183148-94183170 TTATCAAGTAAGTTTAAATAGGG - Intergenic
1028943098 7:96547306-96547328 TAGTCTCTTAAGTATGAATAGGG + Intronic
1030160296 7:106501068-106501090 TCATCTATTAACTGGGAATGGGG + Intergenic
1030455502 7:109767996-109768018 TCATCTATTAAGACTGAATCAGG - Intergenic
1030930083 7:115511989-115512011 TAATTTCTTAAGTTTGACTATGG + Intergenic
1038953805 8:32445723-32445745 TCATCTATTAAGATTAAGTAAGG + Intronic
1039602288 8:38850276-38850298 GCATCTGTTAAGTTCGAATGGGG - Exonic
1040483463 8:47848623-47848645 TCAACTTTTATTTTTGAATAAGG - Intronic
1043935985 8:86143128-86143150 CCAACTCTTAAGTTGGAATATGG + Intronic
1044133253 8:88553120-88553142 TCATCTAATTAAATTGAATATGG - Intergenic
1044162606 8:88938253-88938275 TCATATATTAACTTTGCTTAAGG - Intergenic
1046206490 8:111005448-111005470 TCATCCATAAAGTTCAAATAAGG + Intergenic
1047163402 8:122407839-122407861 TCATCTATGAAGTTTGGGCAGGG - Intergenic
1047729401 8:127714413-127714435 TCATCTATAAAATTAGAATCAGG + Intergenic
1049044874 8:140141748-140141770 TCATCTTTTGATTTTGAATATGG - Intronic
1049173342 8:141175607-141175629 TCATCTGTAAAGTAGGAATAAGG + Intronic
1050436586 9:5617188-5617210 TTATCTGTCAAGTTTGAATGGGG - Intergenic
1050880051 9:10688220-10688242 TCATCGAATAATGTTGAATAAGG - Intergenic
1051753973 9:20375308-20375330 GCAACTATTAACTTTGAAAAAGG + Intronic
1052036841 9:23692351-23692373 ATATCTTTTATGTTTGAATATGG - Exonic
1052494464 9:29210726-29210748 GCATCTATTATTTTTGATTAAGG - Intergenic
1054852796 9:69865776-69865798 TTATCTATTAAGTTTGAGTTGGG + Intronic
1055682228 9:78727647-78727669 CCATCTACTAACTTTGAATTTGG - Intergenic
1057783714 9:98071360-98071382 TCAGATTTTAAGTTTGAATATGG + Intronic
1186680515 X:11868743-11868765 TCATCTATGCAGTTTGCATCAGG + Intergenic
1187753779 X:22497168-22497190 TCAACTCTTGAGTTTGAATTTGG + Intergenic
1188667027 X:32836743-32836765 TTATAAATTAAGTTTGATTAAGG - Intronic
1191135925 X:57065115-57065137 TCATCTAGTTAGTTTGAAGATGG - Intergenic
1191695238 X:63983158-63983180 TCTTCTACTAATTTTGAATTTGG - Intergenic
1192713098 X:73612333-73612355 TCATCTATTAATTTTGTGTTTGG + Intronic
1194783517 X:98054301-98054323 TCTTCTACTAATTTTGAATTTGG + Intergenic
1194942562 X:100029034-100029056 TTAAATATTAAATTTGAATATGG - Intergenic
1195110485 X:101643226-101643248 TCATCTATTAACTTTGTTTATGG + Intergenic
1198302995 X:135349672-135349694 TAAAGTATTAAGTTTGAATAAGG - Intronic
1198955765 X:142128550-142128572 TAATCTGATAAGTTTGGATATGG - Intergenic
1201717333 Y:17060272-17060294 TTATATATTAAGTTTAAATTTGG + Intergenic