ID: 1105039341

View in Genome Browser
Species Human (GRCh38)
Location 12:132949524-132949546
Sequence CCCGTAGGGTACCCAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 9, 1: 12, 2: 9, 3: 12, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039341_1105039349 13 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98
1105039341_1105039353 19 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 198
1105039341_1105039355 25 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 60
4: 445
1105039341_1105039348 12 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100
1105039341_1105039347 -8 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 15
3: 10
4: 147
1105039341_1105039354 22 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039341 Original CRISPR CCCGTAGGGTACCCAAAGTC CGG (reversed) Intronic