ID: 1105039348

View in Genome Browser
Species Human (GRCh38)
Location 12:132949559-132949581
Sequence TGGTCCCCAACAGTATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039339_1105039348 15 Left 1105039339 12:132949521-132949543 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100
1105039341_1105039348 12 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100
1105039345_1105039348 -2 Left 1105039345 12:132949538-132949560 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100
1105039346_1105039348 -3 Left 1105039346 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100
1105039336_1105039348 24 Left 1105039336 12:132949512-132949534 CCTTTGTCGCCACCGGACTTTGG 0: 2
1: 11
2: 17
3: 33
4: 151
Right 1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039348 Original CRISPR TGGTCCCCAACAGTATCTGC AGG Intronic
900099049 1:953211-953233 TGGTCCTCAGCAGAGTCTGCCGG - Exonic
900299817 1:1971497-1971519 TGGTCTCTCACAGGATCTGCAGG - Intronic
900773472 1:4563915-4563937 TGGTACCCAACAGCAGCTGGAGG + Intergenic
906052819 1:42888562-42888584 CGGGCCCCAAGAGTGTCTGCTGG + Intergenic
912968961 1:114262347-114262369 TGGACCCAAACTGTTTCTGCTGG + Intergenic
913352272 1:117874910-117874932 TGGTACCCTACGGTATCTGCTGG + Intronic
913478464 1:119261591-119261613 GGGTCCCCAAATGTATCTTCAGG - Intergenic
919811418 1:201411251-201411273 TGGTCTCCAACAGGAGCTCCTGG + Intronic
920585699 1:207157935-207157957 TGACCCCCAACCCTATCTGCAGG - Intergenic
920673772 1:208024680-208024702 TCGTCTCCAAAAGTAACTGCTGG + Exonic
922169356 1:223142314-223142336 TGCTCAGCAACAGTATCTGAAGG + Intronic
922699514 1:227750645-227750667 TGGACCCTGACAGTGTCTGCAGG + Intronic
924643580 1:245856809-245856831 AGGCCCCCAACAGCAGCTGCTGG - Intronic
1064429728 10:15260507-15260529 TGGTGTCCAACAGTGTCTCCTGG + Intronic
1066654478 10:37685706-37685728 TGGTCCCCAGCAGAATCTCCTGG + Intergenic
1067836627 10:49645556-49645578 TGGCCCCCAACAGGTCCTGCCGG + Intronic
1069735038 10:70648400-70648422 TAGCCCCCCACAGTATCTGTTGG + Intergenic
1072037573 10:91577597-91577619 TGGTACCCTACAGCATCTGCAGG + Intergenic
1073112743 10:101072253-101072275 TGGTCCCCATCAGAAGCTTCCGG - Intergenic
1076939767 10:133594924-133594946 TTGTCCCCAAACTTATCTGCAGG - Intergenic
1077978929 11:7279086-7279108 AGCTCCCCAACTTTATCTGCTGG - Intronic
1078057036 11:8017400-8017422 GGGTCCCCCACAGAAACTGCAGG - Intergenic
1081273223 11:41113330-41113352 TCTTCCCCAACAGCATCAGCAGG - Intronic
1085107761 11:73860601-73860623 TGGCACCCATCATTATCTGCAGG - Intronic
1089337417 11:117734709-117734731 TGTTCCCCAGCCATATCTGCAGG + Intronic
1101982520 12:109420004-109420026 TGGTACCCAACAGCATCTTCAGG - Intronic
1103328645 12:120138415-120138437 TTGTCCCCAACACCCTCTGCAGG - Exonic
1105039348 12:132949559-132949581 TGGTCCCCAACAGTATCTGCAGG + Intronic
1107914353 13:45134071-45134093 ATGTCCACAACATTATCTGCTGG - Intronic
1111531329 13:89541329-89541351 TGGTCCCCACAACCATCTGCTGG - Intergenic
1117117213 14:52526632-52526654 TGGTCCCCAACCCTGTTTGCTGG + Intronic
1124375397 15:29126151-29126173 TGGCCCCAGACAGGATCTGCAGG + Intronic
1126192720 15:45895345-45895367 AGTTTCCCAACAGTAACTGCCGG - Intergenic
1127825450 15:62698762-62698784 TGGTCCCCATCAGGGCCTGCTGG - Exonic
1129185478 15:73903461-73903483 TGTTCCACAGCAGTAGCTGCTGG + Intergenic
1131829676 15:96346008-96346030 TGGACCCCAACAGCAACTGGGGG + Intergenic
1132091375 15:98950328-98950350 TGGTCTCCTACAGTGTCTGTGGG + Intronic
1135656418 16:24254465-24254487 TGGTCCATAACACTGTCTGCAGG + Intergenic
1136927048 16:34384088-34384110 TGGTCCCAAAGCGTTTCTGCAGG + Intergenic
1136977526 16:35027719-35027741 TGGTCCCAAAGCGTTTCTGCAGG - Intergenic
1140536320 16:75713245-75713267 TGGACCAGAGCAGTATCTGCAGG - Intronic
1141308372 16:82888505-82888527 TGCTCCCCCACAGCATCTCCTGG + Intronic
1141467119 16:84213700-84213722 TGGTGCCCAGCTGTACCTGCAGG - Intergenic
1141735105 16:85847088-85847110 AGGGCCCCAGCAATATCTGCTGG - Intergenic
1142000774 16:87662980-87663002 TGGTGCCCAACAGCATGTGACGG - Intronic
1144852960 17:18253300-18253322 TGGTCCCTGAAAGTCTCTGCAGG - Exonic
1145991792 17:29083564-29083586 TGGTCCCCAGAACAATCTGCTGG - Intronic
1146507987 17:33421993-33422015 TTTTTCCCAACTGTATCTGCTGG + Intronic
1149138278 17:53397200-53397222 TCATCACCACCAGTATCTGCAGG + Intergenic
1149473436 17:56938809-56938831 TGGTATACAACAATATCTGCAGG + Exonic
1157481543 18:48058373-48058395 TGGTCCCCCACAGTCTGTTCTGG + Intronic
1160160222 18:76465115-76465137 TGGTCATCCACACTATCTGCTGG + Intronic
1162376062 19:10305899-10305921 GGGCCCCCAACAGCATCTGCAGG + Exonic
929801803 2:45110779-45110801 TGGTCCCCAACAGTGTGAGTTGG - Intergenic
934915430 2:98297753-98297775 TGGTGCCCAAGATTATCTGCTGG + Intronic
935698153 2:105787507-105787529 TGGCCCCCATCAGACTCTGCTGG + Intronic
936617378 2:114061813-114061835 TGGTCAGCAACAGTATCTACTGG - Intergenic
938303173 2:130230318-130230340 TGGTCCTCAGCAGAGTCTGCCGG + Intergenic
938453497 2:131443919-131443941 TGGTCCTCAGCAGAGTCTGCCGG - Intergenic
940790473 2:158025680-158025702 TTGTCCCCAGCATTCTCTGCTGG - Intronic
942546829 2:177074150-177074172 TAGAGCCCAACAGTATCTACTGG - Intergenic
946308663 2:218871050-218871072 TGGACCCTACCAGCATCTGCAGG + Exonic
946928814 2:224652683-224652705 TGTTCCCTAAAAGTATATGCAGG - Intergenic
947472239 2:230410809-230410831 TGGTCTCCACCAGCACCTGCTGG - Intergenic
947507314 2:230718151-230718173 TGGTCCTCAACAATTTTTGCTGG - Intronic
1168785821 20:539430-539452 TGGTCCCCTCCAGTAACGGCAGG + Intronic
1169495817 20:6113811-6113833 CTGTCCCCAACAGTATTTCCTGG + Intronic
1175364913 20:58446379-58446401 TGGTCCCCAACAGTGCCTAGGGG + Exonic
1175493593 20:59396108-59396130 TGGTGCCCAGCAGCAGCTGCAGG + Intergenic
1175955343 20:62606115-62606137 TGGTCCCCACCAGTGGCTTCTGG - Intergenic
1179294138 21:40045523-40045545 TGGTACCTGACAGTCTCTGCTGG - Intronic
1184402149 22:44280507-44280529 TGGTTCCCAGCACTCTCTGCTGG + Intronic
952529682 3:34250477-34250499 TGGCCCCCAATAGTCTCTACTGG - Intergenic
956308754 3:67855826-67855848 TGGTCCCAAACTGCATCAGCTGG + Intergenic
959927364 3:111938639-111938661 TGGTACACAACACAATCTGCTGG - Intronic
962344295 3:134608205-134608227 AGGTCCCCAACAGAAGCTACTGG - Intronic
966266250 3:178048083-178048105 TGTTTCCCAACAGCATCTTCTGG + Intergenic
969538025 4:7768657-7768679 CGGTTCCTAACAGGATCTGCGGG + Intronic
973167496 4:47095477-47095499 TGGTCCCCATCTGCATGTGCCGG - Intronic
978837938 4:113175936-113175958 TTATTCCCAAAAGTATCTGCAGG - Intronic
979046813 4:115877018-115877040 GGTTCCCCAAGAGTATCTTCAGG + Intergenic
980892299 4:138829037-138829059 TGCTACCCAGTAGTATCTGCTGG + Intergenic
981401205 4:144315387-144315409 TGGTCTCCTACAGTACCTTCAGG - Intergenic
982757732 4:159243155-159243177 TTTTCCCTAAAAGTATCTGCTGG - Intronic
984300522 4:177911827-177911849 TGGTGCCCAACAGCAGCTTCTGG + Intronic
990401953 5:55446943-55446965 TGGTCCTTGAAAGTATCTGCCGG - Intronic
992173328 5:74125194-74125216 TGGTCCCCACCACAAGCTGCAGG + Intergenic
995479885 5:112583246-112583268 TGGTCACCACCAATATCAGCGGG - Intergenic
995921431 5:117318717-117318739 AGGTGCCCAAGAGTATCTGAGGG + Intergenic
999555504 5:152738120-152738142 TACTCCCCAACTGGATCTGCAGG - Intergenic
1010525812 6:76899061-76899083 TGTTCCCCAAAAGTATGTGTTGG + Intergenic
1016841029 6:148525751-148525773 TGGTCCCCAAGAGTATGTGCTGG + Intronic
1017780420 6:157711348-157711370 TAGGCCCCAACAGCATCTGCGGG + Intronic
1020844025 7:13260047-13260069 TGGGCACAAACAGTATCTACTGG - Intergenic
1021763851 7:23927514-23927536 GGGTGGCCAAGAGTATCTGCTGG + Intergenic
1032507012 7:132443140-132443162 TGTTCCCCAAGAGAATCTGAGGG - Intronic
1040983932 8:53272579-53272601 TGGTCAACCACAGTATCTGTAGG + Intergenic
1041606273 8:59785805-59785827 CTGTCACCATCAGTATCTGCTGG + Intergenic
1042197967 8:66249707-66249729 TGGTCTCCTGCAGTATCTTCAGG + Intergenic
1044197671 8:89396916-89396938 TGGACATCAACAGTGTCTGCTGG + Intergenic
1047096836 8:121634872-121634894 TGGTCCCCAAGAGCATTTACAGG + Intronic
1048972892 8:139655126-139655148 TGGTCCCAAGCAGTATCTGAGGG - Intronic
1049682932 8:143927757-143927779 CTGTCCCCAACAGAAGCTGCGGG - Exonic
1051478208 9:17531955-17531977 ATTTCCCCAACAGTGTCTGCTGG + Intergenic
1052103395 9:24479855-24479877 TGCTCACCGACAGCATCTGCTGG - Intergenic
1052767631 9:32657807-32657829 GGGTCCACAACAGTGTCTGTTGG + Intergenic
1055517589 9:77048936-77048958 TTCTCCCCAACAAAATCTGCTGG + Intergenic
1056328986 9:85506012-85506034 GGGGCCCCAACAGTGTGTGCTGG + Intergenic
1058255015 9:102750978-102751000 TAGTCCCTAACAGTCTCAGCTGG + Intergenic
1060780292 9:126407261-126407283 TAGTCACCAACAGTAACTGCTGG + Intronic
1189263387 X:39694268-39694290 TTGGCACCAACAGCATCTGCTGG - Intergenic
1194535537 X:95102123-95102145 AAGTGCCCAACAGAATCTGCTGG + Intergenic