ID: 1105039349

View in Genome Browser
Species Human (GRCh38)
Location 12:132949560-132949582
Sequence GGTCCCCAACAGTATCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039336_1105039349 25 Left 1105039336 12:132949512-132949534 CCTTTGTCGCCACCGGACTTTGG 0: 2
1: 11
2: 17
3: 33
4: 151
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98
1105039339_1105039349 16 Left 1105039339 12:132949521-132949543 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98
1105039346_1105039349 -2 Left 1105039346 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98
1105039345_1105039349 -1 Left 1105039345 12:132949538-132949560 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98
1105039341_1105039349 13 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039349 Original CRISPR GGTCCCCAACAGTATCTGCA GGG Intronic
900773473 1:4563916-4563938 GGTACCCAACAGCAGCTGGAGGG + Intergenic
901887585 1:12233704-12233726 TGTCCCCATCAGTAACTGGAGGG - Intronic
902143409 1:14375991-14376013 GGTCCCCTGGAGTATTTGCAAGG - Intergenic
902534255 1:17110109-17110131 GGCAGCCAACAGGATCTGCAGGG - Intronic
902663630 1:17922363-17922385 GGTCTCCCCCAGTATCTGCATGG + Intergenic
905290795 1:36920608-36920630 GGTGGCCAACAGTAACTGTAGGG - Intronic
910159746 1:84260205-84260227 GGTCCTCAAAAATATCTTCAAGG + Intergenic
913212873 1:116595995-116596017 TATCCCCAACAGAATCTTCAAGG - Intronic
915534177 1:156524857-156524879 TGTCCCCAACAGGAGCTGCCTGG + Intergenic
917587930 1:176446642-176446664 GGTACCCAGCAGTAACTTCAAGG + Intergenic
922699515 1:227750646-227750668 GGACCCTGACAGTGTCTGCAGGG + Intronic
922790496 1:228308396-228308418 GGGCCCCACCAGTGACTGCATGG + Intronic
923057413 1:230437444-230437466 GGTCCCCTACACTAACTTCAAGG + Intergenic
924586673 1:245366872-245366894 GGTCCCCAACACCATCCGGAAGG + Exonic
1066654479 10:37685707-37685729 GGTCCCCAGCAGAATCTCCTGGG + Intergenic
1070511176 10:77162218-77162240 GGTCCACAGCATTATCTGCATGG - Intronic
1071901471 10:90124815-90124837 TTTCCCCACCAGTGTCTGCATGG + Intergenic
1072502607 10:96033194-96033216 AGACCCCAAATGTATCTGCAGGG + Intergenic
1074439560 10:113464228-113464250 GGTCCCCAACATTCTTTGCCTGG - Intergenic
1087697686 11:101398923-101398945 GATCCCCAACACTGTCTTCAAGG - Intergenic
1089337418 11:117734710-117734732 GTTCCCCAGCCATATCTGCAGGG + Intronic
1089500268 11:118927959-118927981 GGTCCAAAACAGTGTTTGCAGGG + Intronic
1089940641 11:122412787-122412809 GATCCCCCACAGGATCTTCAAGG + Intergenic
1097328393 12:58305482-58305504 GGTCCCCACCACTATCTGTGAGG + Intergenic
1097681779 12:62656129-62656151 GGACAGCAACAGAATCTGCAAGG - Intronic
1105039349 12:132949560-132949582 GGTCCCCAACAGTATCTGCAGGG + Intronic
1105216117 13:18286607-18286629 CATCCCCAACAGAATCTTCAAGG - Intergenic
1110808135 13:79782234-79782256 TGTCCTCAACACTATCTTCAGGG + Intergenic
1111917715 13:94378661-94378683 GGACCCCAACAGTATATGTTTGG + Intronic
1120081353 14:80220250-80220272 AGTCCCTATCAGTATCAGCAAGG + Intronic
1122959878 14:105089540-105089562 GGTCCCCCAGTGTGTCTGCACGG - Intergenic
1124375398 15:29126152-29126174 GGCCCCAGACAGGATCTGCAGGG + Intronic
1134342774 16:13360385-13360407 GGTCCCTCCCAGTATCTGTAGGG - Intergenic
1136230298 16:28881889-28881911 GGTCCAGGACAGCATCTGCAGGG + Intronic
1141096253 16:81165176-81165198 GGTCCCCAACAAGATCAGAAAGG - Intergenic
1142174580 16:88639296-88639318 GGTCCTCACCGGTATCTCCAGGG - Exonic
1145209303 17:21001394-21001416 GGTCCCCACCAGCTTCTCCATGG + Exonic
1149138279 17:53397201-53397223 CATCACCACCAGTATCTGCAGGG + Intergenic
1149473437 17:56938810-56938832 GGTATACAACAATATCTGCAGGG + Exonic
1153599589 18:6766617-6766639 GGTCCCCAAAAGTCTCAGCCAGG - Intronic
1160024837 18:75208942-75208964 GGTCACCACCAGCTTCTGCATGG + Exonic
1162376063 19:10305900-10305922 GGCCCCCAACAGCATCTGCAGGG + Exonic
1167981445 19:53279703-53279725 GGACCCCAACACTCTCTCCATGG + Intergenic
1167984647 19:53303982-53304004 GGACCCCAACACTCTCTCCATGG - Intergenic
929625345 2:43401132-43401154 GGTTCTCCACAGAATCTGCAAGG + Intronic
930163673 2:48182941-48182963 GGTCCACAACAGTCTCTTCTCGG + Intergenic
931460607 2:62447286-62447308 GGTCCCCAACAGGCTCTTAAGGG - Intergenic
934105587 2:88691887-88691909 GGACTCCAACAGCATCTGCCCGG + Exonic
934298210 2:91760118-91760140 CATCCCCAACAGAATCTTCAAGG + Intergenic
934778833 2:96956076-96956098 GGCCCCTCACAGTATTTGCAAGG - Intronic
947739192 2:232477207-232477229 TGTCCCCATCAGTATCCTCAGGG - Intergenic
947842703 2:233218608-233218630 TGTTCCCAACAGTGCCTGCAGGG - Intronic
1171395386 20:24829649-24829671 TGAACCTAACAGTATCTGCAAGG - Intergenic
1175240243 20:57542106-57542128 TGTCTCTAACAGTAGCTGCAAGG - Intergenic
1183444983 22:37847678-37847700 GGTCCCCAACAATGTCCTCATGG - Intronic
1183445020 22:37847931-37847953 CTTCCCCATCGGTATCTGCATGG - Intronic
1184746040 22:46456862-46456884 GGTCCCCAACTGTCCCTGCGAGG - Intronic
1184960350 22:47923937-47923959 GGTTCCCATCAGCATCTTCATGG + Intergenic
949348811 3:3102903-3102925 GGTCCAGGACAGCATCTGCAGGG - Intronic
949913112 3:8931485-8931507 GGTCCAGGACAGCATCTGCAGGG - Intronic
952756921 3:36877598-36877620 TTTCCCTAATAGTATCTGCATGG - Intronic
953975643 3:47380292-47380314 GGACGCCCACAGTATCTGGAAGG - Intergenic
954124686 3:48521459-48521481 AGGCCCCTTCAGTATCTGCATGG + Intronic
963363611 3:144306736-144306758 GTTGTCCCACAGTATCTGCAAGG + Intergenic
969538026 4:7768658-7768680 GGTTCCTAACAGGATCTGCGGGG + Intronic
970567257 4:17344035-17344057 AGGCACCAACAGTATATGCAGGG - Intergenic
971964673 4:33537972-33537994 GGTCTTCAACTGTATCTGCCTGG - Intergenic
986366831 5:7041052-7041074 GGTCCTCATCAGTAGCTTCATGG + Intergenic
986859289 5:11906461-11906483 CAGCCCCAACAGTATCTGTAGGG - Intergenic
987301359 5:16600503-16600525 GGTCCCCATCAGAATGTGCCTGG - Intronic
990663645 5:58047417-58047439 GGTCCCCAGCAGTAACACCAGGG - Intergenic
992173329 5:74125195-74125217 GGTCCCCACCACAAGCTGCAGGG + Intergenic
993693656 5:91034570-91034592 TGTCCTCACCAGTATCTCCATGG + Intronic
997710412 5:135999417-135999439 TGTCCCCATCACTATCTTCAAGG - Intergenic
1002875109 6:1203357-1203379 GCTCCCTAACATGATCTGCAGGG + Intergenic
1003876518 6:10442492-10442514 GTTGTCCATCAGTATCTGCAGGG + Intergenic
1004004708 6:11628223-11628245 GCTCCCCAACATGTTCTGCAAGG - Intergenic
1006671584 6:35732623-35732645 GACCCCCAACAGTATCTGTCTGG + Intergenic
1007176059 6:39898406-39898428 GGGCACCAACAGCATCTGCTAGG + Intronic
1011495878 6:87936263-87936285 GGTCCCCAGCAGGAGCTGCAAGG - Intergenic
1017780421 6:157711349-157711371 AGGCCCCAACAGCATCTGCGGGG + Intronic
1018383449 6:163281366-163281388 AGTCCTCAAAGGTATCTGCATGG + Intronic
1023861966 7:44222027-44222049 GGTCCCTAGCCGTATCTGCGAGG + Intronic
1024377459 7:48655865-48655887 TGGTCCCACCAGTATCTGCAGGG + Intergenic
1025700983 7:63820169-63820191 AGACCCCAGCAGAATCTGCAAGG - Intergenic
1027267232 7:76501130-76501152 CTCCCCCAACAGTATCTCCAGGG - Intronic
1032472671 7:132189768-132189790 GGTCCCCATGAGTCTCCGCAGGG - Intronic
1036689932 8:10939018-10939040 GTCCCCGAACACTATCTGCAAGG + Intronic
1046556428 8:115779125-115779147 GGTCTCAAACTGTATCTGGAAGG + Intronic
1047096837 8:121634873-121634895 GGTCCCCAAGAGCATTTACAGGG + Intronic
1049179116 8:141212074-141212096 GGTCGGCCACAGCATCTGCAGGG + Intronic
1051030904 9:12677125-12677147 TGTCCTCAACAATATCTCCAAGG - Intergenic
1051455196 9:17247484-17247506 ATCCCCCAACAGTAGCTGCATGG - Intronic
1052612776 9:30797678-30797700 GATCCCCAACAATATTTGTATGG - Intergenic
1052745221 9:32433952-32433974 TTTCCCCAGCAGTATCTGCTTGG - Intronic
1055980584 9:81996180-81996202 GGACTTAAACAGTATCTGCAGGG + Intergenic
1056832015 9:89924832-89924854 GGGCCCCTGCAGTATCTGCCTGG + Intergenic
1058841920 9:108918179-108918201 GTTTCCCACCAGTATCTGAATGG - Intronic
1059733549 9:117079487-117079509 GGTTCCCAACCCTATCTGCATGG - Intronic
1060542922 9:124443105-124443127 AGTCACCAACAGTATCTGCCAGG + Intergenic
1060780293 9:126407262-126407284 AGTCACCAACAGTAACTGCTGGG + Intronic
1185751619 X:2614730-2614752 GGTCCCCAACACCTTCAGCAAGG - Intergenic
1188026813 X:25218496-25218518 GGTATCCCTCAGTATCTGCAAGG - Intergenic
1192417822 X:70999846-70999868 GGTCACCAAAAGAATCTACAAGG + Intergenic
1194531435 X:95054509-95054531 GATTCCCAACAGTATTTGTATGG + Intergenic