ID: 1105039353

View in Genome Browser
Species Human (GRCh38)
Location 12:132949566-132949588
Sequence CAACAGTATCTGCAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039346_1105039353 4 Left 1105039346 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 198
1105039345_1105039353 5 Left 1105039345 12:132949538-132949560 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 198
1105039339_1105039353 22 Left 1105039339 12:132949521-132949543 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 198
1105039341_1105039353 19 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039353 Original CRISPR CAACAGTATCTGCAGGGAGC AGG Intronic
900120397 1:1046383-1046405 CAACAGCCTCTGCAAGGAGAGGG - Exonic
900196227 1:1376972-1376994 CTACAGGAGCTGCATGGAGCCGG + Intergenic
901889849 1:12253347-12253369 CCTCAGTATCAGCAGGGAGTTGG - Intronic
902168584 1:14592659-14592681 CAACATTGGCTGCAGGGAGCAGG + Intergenic
902261309 1:15226860-15226882 CCACGGTATCTGAAGAGAGCTGG - Intergenic
902784246 1:18722712-18722734 CTACAGTGCCAGCAGGGAGCAGG + Intronic
905947934 1:41919352-41919374 CAACAGTGCCTGAAGGGAGTGGG + Intronic
906784331 1:48601073-48601095 CACCAGTCACTGAAGGGAGCAGG - Intronic
907678627 1:56542333-56542355 GAACTGTGGCTGCAGGGAGCAGG - Intronic
908121249 1:60988209-60988231 CCACTGTAACTGGAGGGAGCTGG - Intronic
908248127 1:62243901-62243923 AGACAGTGTCTGGAGGGAGCAGG - Intronic
909639319 1:77854194-77854216 TAACAGCATCTGCAGTGACCTGG - Intronic
909947840 1:81683598-81683620 TAACAGTATTTGCAGTGACCTGG - Intronic
910554853 1:88520155-88520177 GAGCAGTATCTGCAGAGAACTGG - Intergenic
911171323 1:94773744-94773766 CACCAGTATCTGTAGGAGGCCGG + Intergenic
912482110 1:109990933-109990955 AAACAGTACCTGCAGGGATGGGG - Intronic
915199259 1:154214493-154214515 CATCATCATCTGCAAGGAGCTGG + Exonic
916264024 1:162871686-162871708 TAACAGCATTTGCAGTGAGCTGG + Intergenic
917785069 1:178446313-178446335 CAACAGTGTGTGCAGGTAGTGGG - Intronic
919902905 1:202057171-202057193 CAACTGTAACTGCAGAGGGCGGG + Intergenic
921740660 1:218681069-218681091 CAACAATAGATGCAGGGAGTTGG + Intergenic
923648711 1:235851239-235851261 TAACAGCATCTGCAGTGACCTGG + Intronic
924897475 1:248357334-248357356 CAGCAGCAACTGCAGGCAGCAGG - Intergenic
1067663318 10:48252580-48252602 CAGAGGTGTCTGCAGGGAGCTGG - Intronic
1068077457 10:52274429-52274451 TAACAGCATTTGCAGGGAACTGG - Intronic
1068116051 10:52739104-52739126 CAACTGATTCTGCAGGGAGGTGG + Intergenic
1071744959 10:88406884-88406906 TAACAGCATCTGCAGTGACCTGG + Intronic
1074116112 10:110458578-110458600 CAACAATATCTGGAGGGCGGTGG + Intergenic
1074483183 10:113846605-113846627 CCTCAGTATCTGCAGGGGACTGG + Intronic
1074903360 10:117839005-117839027 CAACAGCATCGCCAGGGAGCTGG - Intergenic
1075823266 10:125331991-125332013 CAATAGGATCTGAAGGGAGAGGG - Intergenic
1076816729 10:132918756-132918778 CAAGAGCATCTGCAGGGATGTGG - Intronic
1077048752 11:557381-557403 CAAAAGTAACTGCACAGAGCAGG - Exonic
1077078299 11:711044-711066 GAACTGTATCGGGAGGGAGCAGG + Intronic
1077993738 11:7434909-7434931 CCACATTATCTGTAAGGAGCAGG - Intronic
1078055961 11:8009142-8009164 GCACAGTTTCTGCAAGGAGCTGG + Intergenic
1081195730 11:40158099-40158121 TAACAGTATTTGCAGTGACCTGG + Intronic
1083064112 11:59905674-59905696 TAACAGTATTTGCAGAGACCTGG - Intergenic
1083719467 11:64597301-64597323 CTGCAGTATTTGGAGGGAGCTGG - Intronic
1083826473 11:65206765-65206787 CCCCACTCTCTGCAGGGAGCTGG + Exonic
1084043717 11:66557147-66557169 CAACAGGATCTGCAAGGTGCTGG + Exonic
1087219205 11:95527595-95527617 TAACAGTATTTGTAGGGATCTGG - Intergenic
1087677940 11:101183823-101183845 CAACAGCATTTGCAGAGAGCGGG - Intergenic
1099534432 12:83827285-83827307 CAAAAGAATCTGCATGGAGTGGG + Intergenic
1101400455 12:104382429-104382451 TCAAAGTATCTGCAGGGGGCAGG - Intergenic
1101513178 12:105410890-105410912 CCACAGTATCTGGCGAGAGCTGG + Intergenic
1101831428 12:108260306-108260328 CAACAGTAAATCCTGGGAGCAGG + Intergenic
1102393018 12:112564562-112564584 CTACAGATTCTGCAAGGAGCGGG - Intergenic
1103157603 12:118699840-118699862 CTACAGAATCTGCAGGGAAGAGG - Intergenic
1104442172 12:128802572-128802594 CCAAAGTGTCTGCAGGGGGCGGG + Intronic
1104498691 12:129264751-129264773 TAACAGCATTTGCAGTGAGCTGG + Intronic
1105039353 12:132949566-132949588 CAACAGTATCTGCAGGGAGCAGG + Intronic
1106026326 13:25959153-25959175 CAACAGGAGCTGGAAGGAGCAGG + Intronic
1107018766 13:35730744-35730766 CGACAGTATCTACCGGGAGATGG + Intergenic
1107310353 13:39070908-39070930 CCTCAGTATCTGCAGGGGACTGG - Intergenic
1114613098 14:24054795-24054817 CCACAGTGTCTGCGGTGAGCAGG + Exonic
1114960502 14:27882068-27882090 AAACTGTATCTGGAGGGAGGTGG - Intergenic
1116088533 14:40273991-40274013 TAACAGCATTTGCAGGGACCTGG - Intergenic
1116862785 14:50007776-50007798 GCACTGGATCTGCAGGGAGCTGG + Intergenic
1119283129 14:73427542-73427564 CAACAGTATCTCTAAGGAGCAGG + Intronic
1125412388 15:39418790-39418812 CAACAGCATTTGCAGTGACCTGG - Intergenic
1126488072 15:49205005-49205027 TAACAGTATTTGCAGTGACCTGG - Intronic
1126608472 15:50504615-50504637 CCTCAGTATCTGCAGGGAGTTGG - Exonic
1129750564 15:78059920-78059942 CAGCAGCATCTACAGGGAGTCGG + Intronic
1129912648 15:79241112-79241134 AACCAGTAGCAGCAGGGAGCAGG + Intergenic
1131647482 15:94360907-94360929 CAAAAGTATCTCTTGGGAGCTGG + Intronic
1132995975 16:2822911-2822933 CCTCAGTGCCTGCAGGGAGCAGG + Intronic
1133471669 16:6081814-6081836 CAAGCGTAGCTGCAGGTAGCTGG - Intronic
1134880587 16:17742334-17742356 CAAATGTCTCTGCAGGCAGCTGG - Intergenic
1135741633 16:24980379-24980401 CACCAGTTTCTGCAGGAAACTGG + Intronic
1138197520 16:55062439-55062461 CAACAGTGTCTGGAGGAAGGAGG - Intergenic
1138874547 16:60933848-60933870 CACCAGTATGTGCAATGAGCAGG - Intergenic
1139346888 16:66309581-66309603 CTGCAGTATCTGCAGGAACCTGG + Intergenic
1139383404 16:66548844-66548866 CAAGAGGATCTCCAGGGAGAAGG - Intronic
1140620215 16:76720721-76720743 TAACAGCATTTGCAGGGACCTGG + Intergenic
1140971957 16:80022026-80022048 CAACAGTATCTGCTGAATGCAGG - Intergenic
1142413989 16:89931453-89931475 GAGCAGTGTCTGCAGGCAGCAGG - Intronic
1144193722 17:12870611-12870633 AAAAAGTGTCTCCAGGGAGCAGG - Intronic
1147496296 17:40919322-40919344 CAACAGTATGTGGAGGGAAGAGG - Intergenic
1148064511 17:44859054-44859076 CAGCAGTATCTGCCGGGAGCTGG - Intronic
1152279403 17:79376418-79376440 CCCCAGTATCTGCAGAGAGAGGG - Intronic
1152549319 17:81021424-81021446 CCAAAGCGTCTGCAGGGAGCAGG + Intergenic
1153923062 18:9808128-9808150 CAACAGTACCAGGAGGAAGCTGG - Intronic
1153945816 18:10016282-10016304 CAGGAGCATCTGCAGGAAGCAGG + Intergenic
1155547598 18:26931034-26931056 CCACAATAGCTGCAGGGACCTGG + Intronic
1155641844 18:28026923-28026945 CAACAGAATCAGCAGGTAGAAGG + Intronic
1157606448 18:48928978-48929000 CAGCAGTGGCTGCAGGCAGCTGG - Intronic
1160100406 18:75915501-75915523 CAGCAGTATCTGAGGGGTGCAGG - Intergenic
1161053987 19:2180814-2180836 CAACAGAATCTGCAGGGCACGGG - Intronic
1161427595 19:4212485-4212507 CTCCAGGATGTGCAGGGAGCTGG - Exonic
1161611642 19:5246477-5246499 CAGCAGTGGCTTCAGGGAGCAGG + Intronic
1164864432 19:31592181-31592203 CAACATCACCTGCAGGCAGCTGG + Intergenic
1164867973 19:31620620-31620642 GACCAGCATCTTCAGGGAGCAGG - Intergenic
929129128 2:38548970-38548992 AAACAGACTATGCAGGGAGCAGG - Intergenic
931548392 2:63414562-63414584 TAACAGTATTTGCAGTGACCTGG + Intronic
933846024 2:86327953-86327975 CAACAGTATTTGGTTGGAGCAGG + Intronic
934038701 2:88110032-88110054 CACTAGTATCTGCAGGGGCCAGG + Intronic
934562160 2:95318990-95319012 CCACAGCATCTCCAGGGACCAGG + Intronic
938611894 2:132956713-132956735 CAACAGTTTCTGATGGGAGTGGG - Intronic
938984435 2:136560283-136560305 CAACAGAATCTGCACGTAGAAGG + Intergenic
940147417 2:150561252-150561274 CCACAGTCTCTGCAAAGAGCTGG - Intergenic
941705146 2:168650311-168650333 CAACAGTCCCAGGAGGGAGCTGG + Intronic
943354680 2:186837192-186837214 AAACAGTATATGCAGGAAGAGGG + Intronic
943754325 2:191542169-191542191 CAGCAGTAAGTGCAGGGGGCAGG + Intergenic
947989741 2:234477309-234477331 CCTCAGTATCGGCAGGGAGCTGG - Intergenic
948571270 2:238918980-238919002 CAACAGCATTTGCAGTGACCTGG + Intergenic
1170114374 20:12840743-12840765 CATCAGTATATGCAGGGAATTGG + Intergenic
1170442642 20:16394881-16394903 AAACAGAATCTGCTGGTAGCTGG - Intronic
1171406565 20:24915771-24915793 CTGCAGAATCTGCAGGGAGCTGG - Intergenic
1172525061 20:35595746-35595768 CAAAACTGTCTGCAGTGAGCAGG + Intergenic
1172530920 20:35630852-35630874 CTGAAGCATCTGCAGGGAGCGGG + Intronic
1173194762 20:40905173-40905195 CTACAGCCTCTGCAGGGAGTGGG - Intergenic
1174068420 20:47882856-47882878 CAGCAGTACCTGAAGGCAGCTGG - Intergenic
1175240241 20:57542100-57542122 TAACAGTAGCTGCAAGGAGTGGG - Intergenic
1175402104 20:58706835-58706857 AAACAGTAACTGCACGGAGGGGG - Intronic
1175840396 20:62022869-62022891 CAATAGTATCTGCAATGTGCGGG - Intronic
1176096222 20:63345717-63345739 CTACAGTAGCTGTGGGGAGCTGG - Exonic
1178059926 21:28841503-28841525 TAACAGCATCTGCAGTGACCTGG + Intergenic
1179053155 21:37906575-37906597 CAGCAGCATCACCAGGGAGCTGG - Intronic
1179359664 21:40694043-40694065 CAACAGTGTCTGCTAGAAGCAGG + Intronic
1180694632 22:17743914-17743936 CAACAGCTTCCGCAGAGAGCTGG - Exonic
1183343231 22:37293662-37293684 CCCCAGGATCTGCAGGGTGCTGG - Intronic
1185153131 22:49177918-49177940 CCATAGTATCTGCACGGGGCTGG - Intergenic
950971283 3:17190818-17190840 CAACACTAACTGTAGGCAGCAGG + Intronic
952113698 3:30154615-30154637 CACCTGCAGCTGCAGGGAGCAGG - Intergenic
952586174 3:34895049-34895071 TAAAAGTATTTGCAAGGAGCTGG + Intergenic
952780071 3:37087941-37087963 CAACAGCATCTCCTGGGAACTGG + Intronic
953485547 3:43291161-43291183 CAACAATATATGCAGAGCGCAGG - Intronic
953726045 3:45399935-45399957 TAACAGTATTTGCAGTGACCTGG - Intronic
957003138 3:74910071-74910093 GAACAGTACCTGCAGGAAACTGG - Intergenic
959833558 3:110892575-110892597 TTACAGTATCTGCAGGAAGAGGG - Exonic
960698258 3:120416455-120416477 GAACAGGATCACCAGGGAGCTGG + Intronic
960986829 3:123286325-123286347 CAAAGATGTCTGCAGGGAGCAGG - Intronic
967124761 3:186413619-186413641 GAACTGTAGCTGCAGGGAGTGGG + Intergenic
971028055 4:22607753-22607775 CCACAATAGCTGCAGGGACCTGG + Intergenic
971624842 4:28906220-28906242 CATGATTATCTGCTGGGAGCTGG + Intergenic
971808392 4:31391018-31391040 CCATCTTATCTGCAGGGAGCTGG + Intergenic
975811330 4:78173263-78173285 CAAAGGTATCTGCTGGGAACTGG - Intronic
977091796 4:92687271-92687293 CAACAGTATCTTCATTGAGTTGG - Intronic
978775692 4:112504606-112504628 GAACAGTATTTGCGAGGAGCTGG + Intergenic
979227578 4:118306514-118306536 CAACAGTAGCAGCAGAAAGCGGG + Intronic
981825314 4:148934104-148934126 TAACAGCATCTGCAGTGACCTGG + Intergenic
982321008 4:154077713-154077735 CAACTGTATTTCCAGGGATCAGG - Intergenic
983185214 4:164692616-164692638 CTAGAGTCTCTGCAGGGAGCAGG - Intergenic
984348382 4:178560641-178560663 CAGCAGAATTTGCAGTGAGCTGG + Intergenic
988902708 5:35751154-35751176 TAACAGTATTTGCAGTGACCTGG + Intronic
989022981 5:37031923-37031945 GAAGAGTGGCTGCAGGGAGCTGG + Intronic
991973384 5:72162539-72162561 TACCTGTAACTGCAGGGAGCAGG - Intronic
992507779 5:77405304-77405326 CAACTGGATTTGCAGGGAGATGG + Intronic
992796820 5:80260829-80260851 CATCTGTTTCTGCATGGAGCTGG + Intergenic
996897922 5:128507286-128507308 CCTTAGTATCTGCAGGGAACTGG + Intronic
998451096 5:142235423-142235445 CAACAGTATCTTCAGTGTGCAGG - Intergenic
1001820041 5:174703383-174703405 CACCATGATCTGCAGGGAGCTGG - Intergenic
1002963936 6:1943490-1943512 CAACATTTTCTGCAGGGAGAGGG + Intronic
1003632764 6:7802929-7802951 CCACAGCACCTGCAGGGAGCAGG - Intronic
1003876521 6:10442498-10442520 CATCAGTATCTGCAGGGGACTGG + Intergenic
1004706545 6:18129186-18129208 CCACAGTATCGACTGGGAGCAGG + Exonic
1007571035 6:42890944-42890966 AAAGCGTTTCTGCAGGGAGCTGG - Intergenic
1009199801 6:60730434-60730456 CATCAGAAACTGCAAGGAGCTGG - Intergenic
1009454187 6:63835406-63835428 TAACAGTATTTGCAGTGACCTGG + Intronic
1009808806 6:68635425-68635447 CATCAGTACCTGCAGGGGGGAGG + Exonic
1009864951 6:69385934-69385956 GAACAAGATCTGCAGGGAGTAGG - Intronic
1011267020 6:85532770-85532792 TAACAGTATCTGTATGTAGCAGG - Intronic
1012191633 6:96287256-96287278 GAACAGTTTGTGCAGGGAGTGGG - Intergenic
1013253680 6:108361020-108361042 TAACAGGAAATGCAGGGAGCTGG + Intronic
1014777625 6:125528864-125528886 CCACAGTGTCTGCAAGGACCAGG - Intergenic
1015381221 6:132571593-132571615 AAAAAGTGTCTGCAGGGAGTGGG - Intergenic
1019275093 7:172076-172098 GCACAGCATCTGCACGGAGCCGG + Intergenic
1023503906 7:40880083-40880105 CAAAAGAATGTGCAGTGAGCTGG - Intergenic
1026579369 7:71601066-71601088 TAACAGCATTTGCAGTGAGCTGG - Intronic
1026965974 7:74440436-74440458 CTACAGTATCTGCCTAGAGCAGG - Intergenic
1027132197 7:75599047-75599069 CATCAGAAGCTGCAGGGACCTGG + Intronic
1029739464 7:102483358-102483380 CTACAGCGTCTGTAGGGAGCTGG + Exonic
1029757465 7:102582537-102582559 CTACAGCGTCTGTAGGGAGCTGG + Exonic
1029775405 7:102681598-102681620 CTACAGCGTCTGTAGGGAGCTGG + Intergenic
1032281598 7:130507433-130507455 CACCAGTGTATGCTGGGAGCTGG + Intronic
1032407298 7:131665813-131665835 CAACAGTATCTTCAGGAAGGAGG + Intergenic
1033022057 7:137735464-137735486 CACCAGTATCTTCAGGGTCCTGG - Intronic
1033172371 7:139095494-139095516 CACCATTTTCTGCAGTGAGCTGG - Intronic
1034452401 7:151143993-151144015 CCACAGTGCCTGCAGGGAGGAGG - Exonic
1035607327 8:938569-938591 GAACTGCTTCTGCAGGGAGCAGG - Intergenic
1036063794 8:5355991-5356013 CTGGAGTATATGCAGGGAGCTGG + Intergenic
1044194691 8:89360918-89360940 CACCAGTATCTCCAGGCAGAAGG - Intergenic
1044469309 8:92547712-92547734 CATCAATAACTGCAGGGAGTGGG - Intergenic
1045154061 8:99446294-99446316 CAACAGTATCTTTAATGAGCTGG - Intronic
1049593921 8:143474864-143474886 CAACTGTGTCTGGAGGCAGCCGG - Intronic
1049674808 8:143884712-143884734 GAACAGGAGGTGCAGGGAGCGGG - Intergenic
1049743322 8:144251272-144251294 CAACAGTACCAGGAAGGAGCAGG - Intronic
1050620433 9:7446682-7446704 CTCCAATATCTACAGGGAGCAGG - Intergenic
1051210789 9:14740387-14740409 AAAAAGTATCTGCAGGGTGGGGG + Intronic
1052972732 9:34386886-34386908 CACAGGTATCTGCAGGCAGCTGG + Intronic
1053029195 9:34759610-34759632 CAGCAGCAGCTGCAGGGAGCCGG - Intergenic
1053242118 9:36504587-36504609 CAACAGCCTCTGCAGGGAGGGGG - Intergenic
1053282794 9:36831885-36831907 CACCAGTCTCTGCAGTAAGCAGG - Intergenic
1054921871 9:70551451-70551473 GAACAGCAACTGCATGGAGCTGG + Intronic
1055345840 9:75337685-75337707 TAACAGCATTTGCAGGGACCTGG - Intergenic
1056491859 9:87116466-87116488 CATCAGCACCTGCAGGAAGCTGG - Intergenic
1057207292 9:93181175-93181197 GAACTGCATCTGCATGGAGCAGG + Intergenic
1058553017 9:106135865-106135887 CAACACTATCTTCAGCGGGCGGG - Intergenic
1058699306 9:107587720-107587742 CAGCAGTATCAGCCTGGAGCCGG + Intergenic
1058963075 9:110009802-110009824 CATGAGGATCTGCAGGGAGAGGG - Intronic
1059339989 9:113592206-113592228 CAACAGTTGCTGCAGAAAGCTGG - Intronic
1060258543 9:122053670-122053692 AAAAAGTATGCGCAGGGAGCAGG + Intronic
1062211276 9:135365626-135365648 AAACCTTATCTGCAGGGAGAGGG - Intergenic
1190894988 X:54608659-54608681 TAACAGTATTTGCAGTGACCTGG - Intergenic
1191227133 X:58055121-58055143 CAACAGCATCTGTTGGGAACAGG + Intergenic
1194412000 X:93568569-93568591 TAACAGTATTTGCAGTGACCTGG - Intergenic
1194557859 X:95384439-95384461 CAACAATTTCTGAAAGGAGCAGG - Intergenic
1195598738 X:106722428-106722450 CATCAGCATCATCAGGGAGCTGG - Intronic
1196049173 X:111287313-111287335 CAACAGCATCTTCAGATAGCAGG + Intergenic
1196919586 X:120571936-120571958 CCAACGTATCTGCAGGGAACTGG - Intronic
1197525493 X:127556998-127557020 TAACAGTATTTGCAGTGACCTGG - Intergenic
1197527760 X:127583181-127583203 CTAAAGTATCTTCAGTGAGCAGG + Intergenic
1197645477 X:129012159-129012181 AAATAGCCTCTGCAGGGAGCTGG + Intergenic
1198953179 X:142096498-142096520 TCACAGTAGCTGCAGAGAGCTGG - Intergenic
1199057592 X:143316535-143316557 TAACAGTATTTGCAGTGACCTGG - Intergenic
1202358292 Y:24074979-24075001 CCACAGTATCTGCTGAAAGCTGG + Intergenic
1202512486 Y:25595134-25595156 CCACAGTATCTGCTGAAAGCTGG - Intergenic