ID: 1105039354

View in Genome Browser
Species Human (GRCh38)
Location 12:132949569-132949591
Sequence CAGTATCTGCAGGGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039345_1105039354 8 Left 1105039345 12:132949538-132949560 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 371
1105039339_1105039354 25 Left 1105039339 12:132949521-132949543 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 371
1105039341_1105039354 22 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 371
1105039346_1105039354 7 Left 1105039346 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 43
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039354 Original CRISPR CAGTATCTGCAGGGAGCAGG AGG Intronic
900310603 1:2031567-2031589 AAGAATCTGAAGGGAGCAGTTGG + Intergenic
900572867 1:3367979-3368001 CATCATCTGCAGAGAGCTGGAGG + Intronic
901081662 1:6587209-6587231 CATGAACTGCTGGGAGCAGGAGG - Exonic
901220865 1:7583117-7583139 CTTTATCAGCAGGGAGCAGGGGG + Intronic
901674569 1:10875344-10875366 CATTATCTTGAGGGAGCCGGTGG + Intergenic
902784247 1:18722715-18722737 CAGTGCCAGCAGGGAGCAGGAGG + Intronic
903216846 1:21848088-21848110 CACGATCTGCAGGAAGCAGATGG + Exonic
903973754 1:27136286-27136308 CTGGGTCTGCTGGGAGCAGGGGG + Intronic
903975715 1:27148770-27148792 CAGCCTCTGTTGGGAGCAGGTGG - Intronic
904139779 1:28343649-28343671 CAGCATCTGTAGTAAGCAGGAGG + Intergenic
904211491 1:28888996-28889018 CAGAAGCTGAAGGGAGCAGAGGG + Intronic
904264748 1:29311773-29311795 CACCCTCTGCAGGGAACAGGCGG - Intronic
904344300 1:29857843-29857865 CAGCAGTTGCAGGGAGCAGAGGG - Intergenic
904895221 1:33812221-33812243 CAGCAAGTGGAGGGAGCAGGTGG + Intronic
905204329 1:36334417-36334439 CAGTATTTACAGGGAACAGTCGG - Intergenic
905276062 1:36819012-36819034 CAGAGACAGCAGGGAGCAGGAGG - Intronic
905319378 1:37105119-37105141 CAGTAGCAGCAGGTGGCAGGTGG - Intergenic
905974667 1:42165700-42165722 CTGTATCTGCAGGGGCAAGGGGG - Intergenic
906525268 1:46489924-46489946 CAGTCGCTGCAGGGAGGACGCGG + Intergenic
906784329 1:48601070-48601092 CAGTCACTGAAGGGAGCAGGAGG - Intronic
906796503 1:48700388-48700410 CAGCATTTGCATGGAGCATGGGG + Intronic
908470245 1:64437150-64437172 CTGAATCTGCTGGGGGCAGGCGG + Intergenic
911294027 1:96092070-96092092 CAGCATTTGCAGGAAACAGGTGG - Intergenic
912201797 1:107466137-107466159 CAGTATTTGCAGTTAGCAGTGGG + Intronic
912226581 1:107741117-107741139 CAGTATCTGCATGAAGCTGTCGG - Intronic
912552047 1:110490724-110490746 CAGTAGGTGCTGAGAGCAGGAGG + Intergenic
913091102 1:115477156-115477178 CACTGTCGGCAGGGATCAGGTGG + Intergenic
914629031 1:149491136-149491158 CAGGCTCAGCAGGGAGCTGGTGG + Intergenic
914629564 1:149495899-149495921 CAGGCTCAGCAGGGAGCTGGTGG + Intergenic
914630099 1:149500654-149500676 CAGGCTCAGCAGGGAGCTGGTGG + Intergenic
914630633 1:149505415-149505437 CAGGCTCAGCAGGGAGCTGGTGG + Intergenic
914631164 1:149510176-149510198 CAGGCTCAGCAGGGAGCTGGTGG + Intergenic
915117329 1:153609039-153609061 CAGGATATGAGGGGAGCAGGCGG + Intronic
915331932 1:155118012-155118034 CTGTATCTGCTGGGAGCAAATGG - Intergenic
915747602 1:158176656-158176678 CAGCAGCTGCAGGGGGCAGAGGG + Intergenic
917567693 1:176229835-176229857 CAGTATGGGGAGGGAGCAGGTGG - Intergenic
919241125 1:194917852-194917874 CTCTTTATGCAGGGAGCAGGGGG - Intergenic
919988991 1:202695956-202695978 CACTAACTCCAGAGAGCAGGAGG - Intronic
921303224 1:213770299-213770321 CAGTATCTACAGGGGGCGGCTGG - Intergenic
921404611 1:214765138-214765160 CAGTGTAGGGAGGGAGCAGGTGG + Intergenic
921657362 1:217756649-217756671 CAGTTTCTTCAGAGATCAGGAGG + Intronic
922823113 1:228497992-228498014 CTGGGTCTGCAGGGAGCAGGGGG - Intergenic
923772906 1:236952843-236952865 CAGTCTCTACAGGGAACAGGTGG - Intergenic
924384219 1:243487641-243487663 CAGAACCTGCGGGCAGCAGGAGG + Intronic
1063863916 10:10343310-10343332 CAATATCTGCAGTGAAGAGGGGG + Intergenic
1065116954 10:22492517-22492539 AAGTATCTGCAGCAAGCTGGTGG - Intergenic
1065207427 10:23370424-23370446 AAGGATCTTCAGGGTGCAGGGGG + Intergenic
1067222796 10:44356210-44356232 CAGTATCTGGACGTAGCACGTGG + Intergenic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067566185 10:47339631-47339653 CGGAGTATGCAGGGAGCAGGGGG - Intergenic
1069534993 10:69246672-69246694 CAGTTCCTGATGGGAGCAGGTGG - Intronic
1069901754 10:71710529-71710551 TAGGATGTGCAGGGAGCTGGGGG + Intronic
1069960611 10:72076957-72076979 CAGCATCTGCACTGAGGAGGAGG + Intronic
1070735969 10:78863881-78863903 GAGGACCTGCAGGGACCAGGAGG + Intergenic
1071202074 10:83230176-83230198 CAGTCTCTGAAGGGAGCTGTAGG - Intergenic
1072194707 10:93107234-93107256 CAGTATCTCCAGGGACAAGCTGG - Intergenic
1072756613 10:98025724-98025746 CTGTATCTGCAGCCTGCAGGAGG + Intronic
1073099905 10:101000861-101000883 CAGGAGCTGCGGGGAGCTGGGGG - Exonic
1074263339 10:111875807-111875829 CACTGTCTGCAGGGATCTGGGGG + Intergenic
1074966023 10:118491347-118491369 AAGAGTCTGCAGGGAACAGGAGG - Intergenic
1075464997 10:122644627-122644649 CGGCAGCTGCAGGGAACAGGAGG - Intergenic
1075551448 10:123395635-123395657 CAGGGACTGCAGGGAGAAGGGGG - Intergenic
1076480359 10:130781015-130781037 CAGTATCTGCCAGGAGGAGGTGG - Intergenic
1076987970 11:253091-253113 CTGTATGTGCAGGGAGGAGAAGG - Intergenic
1077386247 11:2270831-2270853 AAGCACCTGCCGGGAGCAGGGGG - Exonic
1078452326 11:11449486-11449508 CAGTGTCTGGAAGCAGCAGGAGG - Intronic
1078521455 11:12067159-12067181 CAGAATGTGCAGGGAGCGGCAGG + Intergenic
1078628331 11:12978989-12979011 CAGTATCTACAGTGGGCAGGTGG - Intergenic
1080101605 11:28466224-28466246 GAGTTTCTGCAGGAATCAGGTGG + Intergenic
1080230563 11:30014953-30014975 CAGGATCAGCAAGGAGCAGCAGG - Intronic
1080395272 11:31884282-31884304 CAGTATCTGCACGTGGCTGGTGG - Intronic
1080640531 11:34155849-34155871 CACTATCTGGAGGGAGCAGACGG - Intronic
1080996871 11:37613549-37613571 CAGAATCTGAAGGGAGAAAGAGG + Intergenic
1081630581 11:44686879-44686901 CAGCATGGGCAGGGAGCAGCAGG - Intergenic
1081814879 11:45933409-45933431 GAGTGGCTGGAGGGAGCAGGGGG - Intronic
1081867273 11:46366748-46366770 CGGCATCCGCGGGGAGCAGGTGG - Exonic
1082921866 11:58504326-58504348 CAATTCCTGCAGGGAGCAAGTGG + Intergenic
1082931750 11:58615340-58615362 CAGTATTAACAGGGAGCAGAAGG - Intronic
1083268903 11:61560830-61560852 GAGCTTCTGCAGGGAGCAGAAGG + Intronic
1083380888 11:62267697-62267719 CAGTATTTGCAGGGAGAGAGAGG - Intergenic
1084366538 11:68704987-68705009 CAGTCTCTGCCGGGGGCCGGGGG + Intergenic
1084373501 11:68760489-68760511 GCGTATCTGCAGAGAGCATGCGG + Intronic
1084605189 11:70168185-70168207 CAGCATGTGCAGAGTGCAGGAGG - Intronic
1084694138 11:70743949-70743971 GAGTCTCTGCAGGCAGAAGGAGG - Intronic
1084754152 11:71224125-71224147 CACTTTCTGCATGGAGCTGGTGG + Intronic
1084779193 11:71397494-71397516 GTGCCTCTGCAGGGAGCAGGTGG + Intergenic
1085331472 11:75655486-75655508 GAGTGTGTGCAGGGAGCAGTGGG + Intronic
1087619867 11:100528890-100528912 CAATATGGGGAGGGAGCAGGTGG - Intergenic
1088425492 11:109696994-109697016 CAGTCTCTGCAGAGAAAAGGTGG - Intergenic
1088712458 11:112520910-112520932 CAGTATCTGCAGTCAGGAAGTGG + Intergenic
1089126963 11:116183318-116183340 CATTAACTGCCTGGAGCAGGAGG + Intergenic
1089300862 11:117497891-117497913 CTGCATCTGCAAGCAGCAGGGGG - Intronic
1089301680 11:117502692-117502714 CAGTCCCTCCAGGGTGCAGGTGG - Intronic
1089333234 11:117704576-117704598 CAGGAGCTGCGGGGAGGAGGGGG + Intronic
1089769901 11:120795323-120795345 CAGTTTACCCAGGGAGCAGGAGG + Intronic
1090451575 11:126810955-126810977 GAGTGTGTGCAGGGAGGAGGTGG + Intronic
1091338482 11:134792306-134792328 CAGCTTCTGCAGAGGGCAGGAGG - Intergenic
1091678249 12:2507209-2507231 CAGGAGCTGCAAGGAGCAGACGG - Intronic
1094684598 12:32698569-32698591 CAGGGTCTGCAGGAAGCAGATGG - Intronic
1098394920 12:70006759-70006781 CAGTGTCAGCAGTAAGCAGGAGG - Intergenic
1098450365 12:70611911-70611933 CAGTATCTGTGGAGAGCAGGAGG - Intronic
1099316599 12:81090853-81090875 TGGTATCTGCAGGGAGTGGGTGG - Intronic
1101329514 12:103746137-103746159 CAGTGCATGCAGGCAGCAGGAGG - Intronic
1102220649 12:111192078-111192100 CAGGTTCTGCAGTGAGAAGGTGG + Intronic
1102393017 12:112564559-112564581 CAGATTCTGCAAGGAGCGGGAGG - Intergenic
1102785862 12:115604364-115604386 CAGTCTCCTCATGGAGCAGGTGG - Intergenic
1104510629 12:129374546-129374568 CTGGAGCTGAAGGGAGCAGGTGG + Intronic
1104866560 12:131959412-131959434 CAGTATCTACAGGGGAAAGGAGG - Intronic
1105039264 12:132948959-132948981 TGGCACCTGCAGGGAGCAGGAGG + Intronic
1105039354 12:132949569-132949591 CAGTATCTGCAGGGAGCAGGAGG + Intronic
1105688078 13:22806033-22806055 CAGAGTTTGCAGGGAGCAGTGGG + Intergenic
1106922042 13:34574244-34574266 CAGTAGCTGCAGTCAGCTGGTGG + Intergenic
1107416877 13:40209237-40209259 ATGTATCTGCATGGAGCATGAGG - Intergenic
1108179546 13:47827245-47827267 CAGTATCTCCAACAAGCAGGAGG - Intergenic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1111526361 13:89476324-89476346 CAGTATGGGGAGGGAGTAGGTGG + Intergenic
1111986262 13:95069890-95069912 CATTATTTGCAGTGAGCAGTAGG - Intronic
1113237633 13:108298196-108298218 GAGTATCTGTAGGGAGTATGAGG + Intronic
1113721701 13:112562385-112562407 CAGCAGCTGCAGGGTCCAGGAGG + Intronic
1113902218 13:113803706-113803728 CAGACCCTGCAGAGAGCAGGGGG - Intronic
1114667910 14:24391532-24391554 GAGTATCTGCAGGAGGCTGGAGG - Intergenic
1115137317 14:30126777-30126799 CAGTGTCTGCAGGAAGGATGAGG - Intronic
1117978478 14:61320727-61320749 CAAAATCTGCAGGGACCACGGGG + Intronic
1118478554 14:66141517-66141539 CAGTGTGGGAAGGGAGCAGGTGG - Intergenic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119328118 14:73774295-73774317 CAGTAATTGCAGGGTGCAGTGGG - Intronic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1121904084 14:97723776-97723798 CAGTATGGGGAGGGAGCAGGGGG - Intergenic
1122718741 14:103710278-103710300 AAGTATGGGCAGGGAGCTGGGGG + Intronic
1122849979 14:104522849-104522871 CAGAAGCTGGAGGAAGCAGGAGG - Intronic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1123804380 15:23855938-23855960 CTTTATCTGCAGGGAGTTGGAGG - Intergenic
1124148552 15:27155718-27155740 CACTATCTGCAGGGACCTAGAGG - Intronic
1124607398 15:31179890-31179912 CAGTACCTGCAGGGACCAGTAGG + Intergenic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1125744560 15:41989616-41989638 CAGTGGCTGCAGGCAGGAGGGGG - Intronic
1126492641 15:49256326-49256348 GAGCTTCTGCAGGGAACAGGTGG + Intronic
1126928738 15:53622618-53622640 CAGTCTGAGGAGGGAGCAGGGGG + Intronic
1128252651 15:66173825-66173847 TGGTCTCTGCAGGAAGCAGGTGG - Intronic
1128285901 15:66436871-66436893 CAGTATCTGCATGGAGCACATGG + Exonic
1128755599 15:70181572-70181594 CAATATCTGCAGGGGGCCTGCGG - Intergenic
1129300921 15:74625021-74625043 GAGTATCTGCAAGGAGTGGGAGG + Intronic
1130915234 15:88299708-88299730 CAGAATCTGCAGGAGGCCGGGGG - Intergenic
1131777301 15:95816189-95816211 CAGAATCTGCAGGGTGCATGAGG + Intergenic
1131873122 15:96780586-96780608 CAGGGGCAGCAGGGAGCAGGGGG + Intergenic
1133043254 16:3072086-3072108 CAGCTTCAGCAGGGGGCAGGGGG + Intronic
1133247841 16:4461177-4461199 CAGGCTCTGCAGGGAGGCGGGGG - Intergenic
1133401683 16:5492193-5492215 CTGTATCTGCAGAGAGGAGTAGG - Intergenic
1136064011 16:27746746-27746768 CAGCCTGTCCAGGGAGCAGGAGG + Intronic
1138311700 16:56029218-56029240 CAGTACCAGCAGGGACCAGTGGG + Intergenic
1140144627 16:72294707-72294729 CAGTGTCTGGGGGGAGGAGGGGG - Intergenic
1140505829 16:75471749-75471771 GAGAATCTGCTGGGGGCAGGTGG + Intergenic
1140671816 16:77286997-77287019 CAGTATGGGCAGGGATCTGGGGG + Intronic
1141353635 16:83322622-83322644 AGGTCTCTGCAGTGAGCAGGGGG + Intronic
1141570747 16:84932203-84932225 CAGTGGCTGCAGGGAGCTGCGGG + Intergenic
1142253011 16:89001396-89001418 CTGCATCTCCAGGGAGGAGGAGG + Intergenic
1142484674 17:238976-238998 CACTGTCTGCAGGGATCAGGTGG + Intronic
1142767624 17:2074432-2074454 CAGCATCCCCTGGGAGCAGGAGG + Intronic
1143101444 17:4506750-4506772 CAGTCTCTGCAGAGACCATGAGG - Intronic
1143460164 17:7098365-7098387 CAGTTTCTCCAGGCAGCAAGAGG + Intergenic
1144233959 17:13238675-13238697 CAGCATCTAGAGAGAGCAGGAGG + Intergenic
1144837994 17:18167573-18167595 CAGGACCTGCAGGGAGCACCTGG - Exonic
1145092417 17:19996844-19996866 CAGTACTTGCCTGGAGCAGGCGG - Intergenic
1145271967 17:21409599-21409621 CAGTGACTGATGGGAGCAGGTGG - Intronic
1145310175 17:21697064-21697086 CAGTGACTGATGGGAGCAGGTGG - Intronic
1147130250 17:38403431-38403453 CAGTTTCTGCAGGGAGCAGAGGG - Exonic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147746080 17:42695504-42695526 CAATATCTGCAGGTAGAAGCAGG - Exonic
1147907341 17:43831924-43831946 CAGAATCTGCAGGGAGAGGTCGG - Exonic
1148395322 17:47303663-47303685 CAGTGCCTTCTGGGAGCAGGAGG + Intronic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1149656320 17:58311208-58311230 CATGATCTGCAGGGTGGAGGGGG + Exonic
1151429093 17:74050591-74050613 CAGAAACTCCAGGTAGCAGGTGG + Intergenic
1151448134 17:74180636-74180658 CAGCTTCTCCAGGCAGCAGGTGG + Intergenic
1151674562 17:75590860-75590882 CAGAGTGTGGAGGGAGCAGGGGG - Intergenic
1151851201 17:76691104-76691126 CAGTCTCTGGAGGAAGCTGGGGG - Intronic
1152077999 17:78170303-78170325 GAGAATCTGCAGGCACCAGGGGG - Intronic
1152246723 17:79188347-79188369 CAGTCTCTGCTGGGGCCAGGGGG - Intronic
1152249027 17:79201959-79201981 CAGTAACTGTAGAGAGAAGGTGG - Intronic
1152549320 17:81021427-81021449 AAGCGTCTGCAGGGAGCAGGTGG + Intergenic
1153454174 18:5261987-5262009 CAGTATGAGCGGGGAGCATGTGG - Intergenic
1153753855 18:8260713-8260735 CGATCTCTGCAGAGAGCAGGTGG - Intronic
1154162437 18:11990262-11990284 CAGTCACTGCAGTGTGCAGGCGG + Intronic
1154466177 18:14643920-14643942 GAGTGTCTGCAGGGGCCAGGTGG + Intergenic
1155553324 18:26990698-26990720 CAGATTCTGCAGGGTGCATGAGG - Intronic
1156445415 18:37233221-37233243 CAGTATCTGTAGGGATCTGATGG + Intergenic
1156518939 18:37705205-37705227 CAGCCCCTGCCGGGAGCAGGTGG - Intergenic
1157337500 18:46752314-46752336 CAGGGTCTCCAGGGAGCCGGTGG - Intronic
1158306408 18:56110817-56110839 CAGTCTCTAAAGGCAGCAGGTGG + Intergenic
1158544251 18:58382234-58382256 CAGGATCTCCTGGGTGCAGGTGG + Intronic
1158626790 18:59078519-59078541 CTGAAACTGGAGGGAGCAGGAGG + Intergenic
1158757973 18:60349511-60349533 CAGTATATGTAGGGAGGCGGGGG + Intergenic
1159886483 18:73912293-73912315 GAGTATGTGCAGAGAGTAGGGGG - Intergenic
1160430964 18:78812285-78812307 CTGTGCCTGCAGGGAGGAGGTGG - Intergenic
1160742230 19:691997-692019 AGGTCTCTGCAGGGAGGAGGTGG + Exonic
1160965980 19:1747179-1747201 CTGTACCTGCAGGGAGCTAGGGG - Intergenic
1161286124 19:3469288-3469310 CAGAGGCTGCAGGGAGCTGGGGG + Intergenic
1161572419 19:5037830-5037852 CAGCAGCCGCAGCGAGCAGGTGG - Intronic
1161606123 19:5215812-5215834 CAGCCTCTGCACGGAGCAGAGGG - Intronic
1161611643 19:5246480-5246502 CAGTGGCTTCAGGGAGCAGGTGG + Intronic
1161625221 19:5322549-5322571 CAGTGCTTGCGGGGAGCAGGTGG - Intronic
1161915652 19:7225947-7225969 CAGTATCCGCAGGCCCCAGGTGG + Intronic
1161953366 19:7479622-7479644 CTGGATTTGCAGTGAGCAGGGGG - Intronic
1162792238 19:13069166-13069188 CAGTATCTCCAGGGAGCGCTGGG + Intronic
1163186969 19:15645644-15645666 AAGGATCTGCAGGGAAGAGGTGG - Intronic
1163294476 19:16403483-16403505 CAGCATCTTCAAGGAGTAGGCGG - Intronic
1163585595 19:18161840-18161862 CAGTATGTGCAGGGCGGAGGAGG - Intronic
1163643669 19:18476187-18476209 CAGCAGCTGCAGAGAGCAGGTGG + Intronic
1165351764 19:35279573-35279595 CAGTACCTCCAGAGAGCAGGAGG - Exonic
1165889429 19:39101527-39101549 CAGGATCTGCTGTGAGCAGGGGG + Exonic
1166812240 19:45521550-45521572 AGGAATCTGCAGGGACCAGGAGG - Intronic
1166834540 19:45659252-45659274 CAGACCCTGCGGGGAGCAGGCGG - Intergenic
1166989326 19:46681743-46681765 CAGGATCTGAGGGGAGCAGATGG + Exonic
1167615110 19:50528758-50528780 ATGTATTTGCAGGGAGCTGGTGG + Intronic
1167873770 19:52394922-52394944 CAATATCAGAAGGGTGCAGGTGG - Intergenic
925182972 2:1829075-1829097 CAGTAGATGCAGGGAGGATGGGG - Intronic
926743154 2:16128825-16128847 CAGCAACCCCAGGGAGCAGGAGG + Intergenic
927104688 2:19813009-19813031 CAGTATCTGCTAGGAGGATGAGG - Intergenic
927272391 2:21226041-21226063 CAGTATCTGCAGGGCCCTTGAGG + Intergenic
929440681 2:41963959-41963981 CAGGATGTGCAGAGAGCAGTGGG + Intergenic
930053431 2:47234490-47234512 TGGCATCTGCAGGGAGGAGGGGG + Intergenic
930713862 2:54574397-54574419 CAGGATCTGGAGGGAGCAGTTGG + Intronic
930744600 2:54869118-54869140 CAGCAAATGCATGGAGCAGGAGG - Intronic
931198153 2:60072764-60072786 CGGTGTCTGCTGGGAGAAGGGGG - Intergenic
932127186 2:69155020-69155042 CAGGACCAGCAGGAAGCAGGAGG - Intronic
932892376 2:75608365-75608387 CAGTCACTGAAGGGAGCAGAGGG - Intergenic
933217714 2:79649526-79649548 CAGTGTCTGCAGGAAGCATCTGG + Intronic
934578669 2:95420369-95420391 AAGTATTTGCAGGAAGGAGGAGG + Intergenic
934723100 2:96595603-96595625 CAGCATCTTCAGGGTGCTGGAGG + Exonic
935313209 2:101805952-101805974 CACCATCTTAAGGGAGCAGGGGG - Intronic
936437738 2:112522711-112522733 TAGTCTCTGGGGGGAGCAGGGGG - Intronic
936733063 2:115407165-115407187 CTGTCTCTGCAGTGCGCAGGTGG + Intronic
937468280 2:122153935-122153957 CAGTAGCTGAGGGGTGCAGGGGG + Intergenic
937866036 2:126752589-126752611 GAGTGTCTGAAGGGAGCAGGAGG - Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
946153303 2:217790530-217790552 CAGCATCAGTAGGGGGCAGGAGG - Intergenic
946613849 2:221488061-221488083 TAGTTGCTGCAGGGAGCAGATGG - Intronic
947020931 2:225674759-225674781 CAGTATGTTGAGGGAACAGGAGG + Intergenic
947793983 2:232882941-232882963 AAGTGGCAGCAGGGAGCAGGAGG + Intronic
948015919 2:234690430-234690452 CAGTGTCTGCAGGGAAAGGGGGG + Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
1169305940 20:4490425-4490447 CAGTATCTGCAGGCTGCCAGAGG - Intergenic
1169424427 20:5485229-5485251 CAGCAGCTGCAGGGAGGGGGCGG - Intergenic
1169432676 20:5553064-5553086 CAGTATCTGAAAAGCGCAGGTGG - Intronic
1169971823 20:11276895-11276917 CAGGTGCTGCAGGGAGTAGGGGG + Intergenic
1170569527 20:17625065-17625087 CAGCCTCTGCAGGGAGCAACAGG + Intronic
1171412983 20:24958911-24958933 CACTATCTGGAGGGAGCAAAGGG - Exonic
1173883932 20:46440142-46440164 CAGTTTCTCCCAGGAGCAGGAGG + Intergenic
1174762797 20:53223045-53223067 CAGTATCTACAGGAGGCTGGTGG + Intronic
1174872288 20:54194124-54194146 AAGTGTCTCCAGGAAGCAGGCGG - Intergenic
1175064275 20:56272218-56272240 CTGAGTCTGCAGGGGGCAGGGGG - Intergenic
1175336953 20:58202820-58202842 TAGTGGCTGCAGGGACCAGGAGG + Intergenic
1175407791 20:58745944-58745966 GAGTCTCTGCAGAGAGCAGGAGG + Intergenic
1175619557 20:60431750-60431772 AAGTTTCAGGAGGGAGCAGGTGG - Intergenic
1175801057 20:61801197-61801219 CAGTGTCTGCAGGCTGCAGCGGG + Intronic
1175851754 20:62097543-62097565 CAGTGGGTGCAGTGAGCAGGGGG - Intergenic
1176096221 20:63345714-63345736 CAGTAGCTGTGGGGAGCTGGTGG - Exonic
1176267669 20:64219099-64219121 CATTTTGTGCAGAGAGCAGGTGG - Intronic
1177188268 21:17821360-17821382 CAGTATGTGCAGAGATCATGTGG + Intergenic
1178035681 21:28580172-28580194 CAGTGTCTGTAGGCAGCAGGTGG + Intergenic
1178265436 21:31138416-31138438 CAGTATCTGCTGGTAACAGCAGG - Intronic
1179710839 21:43212091-43212113 CAGTCACTGCAGGGAGCTGAGGG + Intergenic
1179722675 21:43324505-43324527 CAGGAGCTGCAGGAGGCAGGAGG - Intergenic
1179778925 21:43687176-43687198 CAGGAGCTGCAGGGAGCACTGGG + Intronic
1180918957 22:19508680-19508702 CAGCCTCTCCAGGTAGCAGGAGG + Exonic
1181527545 22:23498895-23498917 CAGTTCCTGGAAGGAGCAGGGGG + Intergenic
1181573161 22:23778795-23778817 AAGTTTCTGTGGGGAGCAGGAGG + Intronic
1181898662 22:26133685-26133707 AAGGATGTGCAGGGAGAAGGTGG - Intergenic
1182427509 22:30282771-30282793 CAGCATCTGCAGGGAGGATGTGG - Intergenic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1183477184 22:38042204-38042226 CATGACCTGCAGGGACCAGGAGG - Intergenic
1183883341 22:40856238-40856260 CAGGAGCCGCGGGGAGCAGGAGG - Intronic
1184974073 22:48048353-48048375 CAGATCCTGCAGGGAGCAAGTGG + Intergenic
1185006205 22:48278320-48278342 AAATACCTGCAGAGAGCAGGAGG + Intergenic
1185018260 22:48358237-48358259 CATCATGTGCAGGGAGCAGGTGG - Intergenic
1185161561 22:49232948-49232970 CAGGAGGTGCAGGGAGCAGACGG + Intergenic
1185372124 22:50465763-50465785 CTGCATCTTCAGGGAGGAGGTGG + Exonic
949201261 3:1382260-1382282 TAGTATCTGCAGAGTACAGGGGG + Intronic
949984222 3:9526853-9526875 CAGAGTCTGCAGGGGGCATGAGG + Intronic
950747574 3:15102573-15102595 CAGTGTCTGAGGGAAGCAGGTGG + Intergenic
950886752 3:16368837-16368859 CAGTAGCCGCAGGCAGCCGGTGG + Intronic
952326824 3:32327791-32327813 AAGAATCTGCATGGAGAAGGTGG - Intronic
952847627 3:37701543-37701565 CAACAGCTGCTGGGAGCAGGTGG - Intronic
953035426 3:39206635-39206657 CAGTAACTGCAGGGGGTATGGGG - Intergenic
953078410 3:39592890-39592912 AAGTATCTGCAGGAAACACGTGG - Intergenic
953511010 3:43539144-43539166 CAGTACCAGGAGGGAGCAGGAGG - Intronic
954404697 3:50338914-50338936 CAGGAGCTGCAGGGGGTAGGAGG - Intronic
955891645 3:63656402-63656424 CAGTATCTACATGAAGCTGGTGG - Intronic
956026472 3:64987955-64987977 CTGTAACAGCAGTGAGCAGGAGG - Intergenic
957419463 3:79950316-79950338 CAGTTTCTCCAGGTAGCAGGTGG - Intergenic
957819371 3:85350624-85350646 GAGTTTCGGCATGGAGCAGGAGG + Intronic
958624737 3:96609658-96609680 CAGTGTCTGAAGGCAGCAGCAGG + Intergenic
959862015 3:111227114-111227136 CAGTATTGGCTGGGAGCTGGGGG + Intronic
960449619 3:117790458-117790480 CAGAATTAGCAGGGAGGAGGAGG - Intergenic
960698259 3:120416458-120416480 CAGGATCACCAGGGAGCTGGAGG + Intronic
961204407 3:125069397-125069419 CAGGCTCTGCAGCGAGCAGCAGG - Intergenic
961733299 3:128983761-128983783 ACGTGTCTGCAGGGACCAGGAGG + Intronic
962853697 3:139326310-139326332 CAGTCTCTACAGGGAGGAAGAGG + Intronic
964004612 3:151812480-151812502 GAGTATTTGCAGGGAACAGCTGG - Intergenic
968298139 3:197593039-197593061 CCGTATCTCCAGGCAGCAGAGGG + Intergenic
968518669 4:1025354-1025376 CCGTATCTGCAGTGGGCACGGGG + Exonic
969511265 4:7619351-7619373 CAGTAAGTCCAGGGAGCAGAGGG + Intronic
969523443 4:7692144-7692166 GAGCATCTGCTGGGAGCAGGAGG + Intronic
971624843 4:28906223-28906245 GATTATCTGCTGGGAGCTGGAGG + Intergenic
973771772 4:54213437-54213459 CTGGAGCTGCAGGGTGCAGGCGG + Intronic
974043566 4:56878513-56878535 CAGTATCTGTAGGGAGGGGTGGG - Intergenic
976704969 4:88010495-88010517 CAGTATCCAAAGGGGGCAGGGGG - Intronic
978775693 4:112504609-112504631 CAGTATTTGCGAGGAGCTGGAGG + Intergenic
979158590 4:117429628-117429650 CAGTATAGGGAGGGAGCATGTGG + Intergenic
979561462 4:122106540-122106562 GAGCACCTGGAGGGAGCAGGGGG + Intergenic
980136488 4:128863223-128863245 AACTACCTACAGGGAGCAGGAGG - Intronic
981336155 4:143570736-143570758 CATTCTCTGCAAGGAGAAGGGGG - Intergenic
982072606 4:151708642-151708664 CAGTACCTGGAGGAAGGAGGAGG - Intronic
982321007 4:154077710-154077732 CTGTATTTCCAGGGATCAGGTGG - Intergenic
985649832 5:1102293-1102315 TAGTTTCTGCAGGGAGAAGCTGG + Intronic
985692092 5:1319193-1319215 CAGGCTCTGCAGGGGGCAGGCGG + Intronic
985819344 5:2149005-2149027 ATGTCTCTGCAGGGTGCAGGGGG - Intergenic
986002841 5:3643520-3643542 CAGCATCTGGAGGGGGCAGGTGG - Intergenic
986170801 5:5312959-5312981 AAGTCTCTGCAGTAAGCAGGAGG - Intronic
990468426 5:56090816-56090838 CAGTATATACAGGGATGAGGAGG + Intergenic
990734090 5:58841095-58841117 CCATGTCTGCAGGGGGCAGGGGG + Intronic
992473222 5:77077650-77077672 CCGTCTGTGCGGGGAGCAGGTGG - Exonic
994296000 5:98089330-98089352 CAGCCTCTGGAGGGAGGAGGGGG - Intergenic
996485242 5:124026219-124026241 CAGTGTCTGCATATAGCAGGTGG - Intergenic
996606526 5:125329556-125329578 CATTATCCACAGAGAGCAGGAGG + Intergenic
1000302104 5:159965632-159965654 CAGTAGCTGCTGGGATTAGGGGG - Intronic
1001413858 5:171529364-171529386 CAGTGTCTGCTGGGATGAGGAGG - Intergenic
1001939288 5:175729308-175729330 CGGAACCTGCAGGGAGCAGCAGG - Intergenic
1002543104 5:179919397-179919419 TGGTATCTGCAGCGAGAAGGGGG + Intronic
1002963937 6:1943493-1943515 CATTTTCTGCAGGGAGAGGGAGG + Intronic
1003032903 6:2618212-2618234 ATGTGTTTGCAGGGAGCAGGAGG + Intergenic
1004207489 6:13605819-13605841 CTGTCGCTGCAGGGAGCTGGTGG + Intronic
1004619611 6:17321466-17321488 GAGTATTTGCAGGGAACAGCTGG + Intergenic
1005942818 6:30573551-30573573 CAGCAATTGCAGGAAGCAGGTGG + Intronic
1006628195 6:35412467-35412489 CTGTGACTGCATGGAGCAGGAGG + Intronic
1007487898 6:42194966-42194988 CAGTCGGTGCAGGGGGCAGGTGG + Intergenic
1009808807 6:68635428-68635450 CAGTACCTGCAGGGGGGAGGAGG + Exonic
1010798538 6:80146615-80146637 CAGAATCTGGAGTGAGCAGTGGG + Intronic
1015011843 6:128358829-128358851 AAGTATCTGCAGGCAGCAGCTGG + Intronic
1016310298 6:142726939-142726961 CAGTCTCTGCGGGGACCATGAGG + Intergenic
1016990532 6:149925145-149925167 CAGAATCTGGAGTGTGCAGGAGG + Intergenic
1017054291 6:150424004-150424026 CAGTGGCTGCTGGGAGCAGCAGG + Intergenic
1017254388 6:152316539-152316561 AATTATCTGCAGGGATCTGGTGG - Intronic
1017306755 6:152927139-152927161 CAGTAGAGGGAGGGAGCAGGTGG + Intergenic
1017529997 6:155280347-155280369 CAGTCTTTGCAGGGAGCAGTGGG - Intronic
1017820829 6:158048141-158048163 CCCTACCTTCAGGGAGCAGGGGG + Intronic
1018992573 6:168685258-168685280 CAGTATCTGCACTGAGCCGGGGG + Intergenic
1019082262 6:169442838-169442860 CAGAATCCCCAGGCAGCAGGAGG - Intergenic
1019082818 6:169446539-169446561 GAGCATCTGCAGGGGGCAGGAGG + Intergenic
1019211440 6:170408497-170408519 AAGTATCTGAAGAGCGCAGGGGG - Intergenic
1019452330 7:1106265-1106287 GAGTCTGTGCAGGGACCAGGTGG - Intronic
1019536771 7:1533486-1533508 CACCATCTGCAGAGAGCACGTGG - Intronic
1020111827 7:5451896-5451918 CAGGGTCTGCAGGGAGCAGCTGG + Intronic
1020119469 7:5495087-5495109 CAGCGTCTGCAGGGAGGATGGGG + Intronic
1020906789 7:14073537-14073559 CAGTATGAACAGGGAGCAGTGGG - Intergenic
1021777072 7:24064418-24064440 CAGTCTCTCCAAGCAGCAGGTGG - Intergenic
1022044727 7:26613792-26613814 CAGCAGCTACAGGGAGCACGAGG + Intergenic
1022419434 7:30206566-30206588 CAGTCACTGAAGGGAGCAGAGGG + Intergenic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1023941228 7:44769342-44769364 CAGAGGCTGCAGGGAGGAGGAGG + Exonic
1025996639 7:66531515-66531537 GAGGAGCTGCAGGGAGCTGGTGG - Intergenic
1026104997 7:67413825-67413847 GAGTATCTGCTTGCAGCAGGTGG - Intergenic
1026805157 7:73424708-73424730 TGGGTTCTGCAGGGAGCAGGTGG - Intergenic
1027219846 7:76206833-76206855 CAGCCTCTGCAGTGGGCAGGAGG - Intronic
1027288719 7:76678249-76678271 CAGTGGCTGAGGGGAGCAGGAGG + Intergenic
1027418971 7:78001620-78001642 CATTCTCTTCAGTGAGCAGGTGG - Intergenic
1028783345 7:94763358-94763380 AAGTATCTGCAATGAGGAGGTGG + Intergenic
1029375700 7:100175898-100175920 CAGCAAATGCAGGGAACAGGTGG + Intronic
1029458701 7:100683627-100683649 CACCACCTGCAGGGGGCAGGGGG + Exonic
1031439990 7:121782350-121782372 CAGGAGCTCCGGGGAGCAGGAGG - Intergenic
1032117150 7:129126943-129126965 CAGCATCTGCATGGAGCACATGG + Intergenic
1033006813 7:137574048-137574070 CAGAATTTGCAGGGAGCTTGGGG - Intronic
1035101837 7:156403955-156403977 GAGTATCTACAGGGAGGACGCGG - Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035754942 8:2023906-2023928 GAGGCTCTGCAGGGAGGAGGAGG + Intergenic
1036063795 8:5355994-5356016 GAGTATATGCAGGGAGCTGGAGG + Intergenic
1037293856 8:17380431-17380453 CAGATCCTGCAGGGAACAGGTGG + Intronic
1037308805 8:17533670-17533692 AAGTATGTGCATGGACCAGGAGG - Intronic
1037503407 8:19506745-19506767 CATTATATGGTGGGAGCAGGAGG - Intronic
1038720180 8:30028134-30028156 CAGTATCTGCAGGTAGCACATGG + Intergenic
1039143737 8:34421871-34421893 CAGAAAGAGCAGGGAGCAGGAGG + Intergenic
1040988946 8:53328353-53328375 GAGTAACTGCAGGGAAGAGGGGG - Intergenic
1046889235 8:119403000-119403022 GAGTAACTGCATGGAGCACGAGG - Intergenic
1049674805 8:143884709-143884731 CAGGAGGTGCAGGGAGCGGGGGG - Intergenic
1052883770 9:33623694-33623716 AAGAATATGCAGGGAGCAGTTGG + Intergenic
1052986338 9:34490791-34490813 CAGTGTGTTCAGGGAACAGGAGG + Intronic
1053231465 9:36413553-36413575 CAGTGGTTGCTGGGAGCAGGGGG + Intronic
1054808315 9:69413339-69413361 CAGAACCTGCAGGGAGCTTGGGG - Intergenic
1055551308 9:77434456-77434478 CATGCTCTCCAGGGAGCAGGTGG - Exonic
1055943698 9:81673882-81673904 CTGTATCTGCAGGCTGCATGGGG + Intronic
1056224576 9:84482661-84482683 CTGGACCTGCAGGGAGCTGGGGG + Intergenic
1060234624 9:121853609-121853631 CAGTGACTGCAGGCAGCTGGGGG + Intronic
1060309524 9:122446849-122446871 CAGTAACTGGAAGGAGCTGGAGG - Intergenic
1060771610 9:126336085-126336107 CAACAACTGCAGGGGGCAGGGGG - Intronic
1061134177 9:128723894-128723916 CAGGATCTCCAGGGATTAGGCGG + Intronic
1061382087 9:130264856-130264878 CTGGATCTGCCCGGAGCAGGAGG + Intergenic
1061502921 9:131013964-131013986 CAGAACCCCCAGGGAGCAGGAGG - Intronic
1061670538 9:132185811-132185833 CTGTGTGTGCAGGGAGGAGGAGG + Intronic
1061674598 9:132208587-132208609 GAGTAGCTGATGGGAGCAGGCGG + Intronic
1061940803 9:133882856-133882878 CAGGACCCCCAGGGAGCAGGGGG + Intronic
1062290939 9:135794053-135794075 CAGCACCTGCAGGGAGGAGAAGG + Intergenic
1062332338 9:136050276-136050298 CAGGATCTGCTGGAAGCAGGCGG + Exonic
1062715992 9:138010328-138010350 CAGGGTGTGCTGGGAGCAGGAGG + Intronic
1185510533 X:660785-660807 GAGTCTCTGGAGGGAGCATGGGG + Intergenic
1188022659 X:25175563-25175585 CAGCATCTCCAGGGAGCCTGTGG + Intergenic
1188895173 X:35658828-35658850 CAGGATCTGCTGTGAGAAGGAGG + Intergenic
1191139586 X:57102974-57102996 CAATATCTGTAGGGAGCTGAAGG + Intergenic
1191933846 X:66404928-66404950 CAGTATGGGGAGGGAGCATGTGG + Intergenic
1194144649 X:90247159-90247181 CAGTATCAGGAGGGAACATGTGG - Intergenic
1196018774 X:110967298-110967320 TAGTATCTTCAGTGAGCTGGAGG + Intronic
1196613731 X:117743413-117743435 CAGTCTCTGCATGGAAAAGGTGG - Intergenic
1198885197 X:141327569-141327591 CAGTATGGGGAGGGAGCAGGTGG - Intergenic
1200490405 Y:3816464-3816486 CAGTATCAGGAGGGAACATGTGG - Intergenic