ID: 1105039355

View in Genome Browser
Species Human (GRCh38)
Location 12:132949572-132949594
Sequence TATCTGCAGGGAGCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105039346_1105039355 10 Left 1105039346 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 60
4: 445
1105039341_1105039355 25 Left 1105039341 12:132949524-132949546 CCGGACTTTGGGTACCCTACGGG 0: 9
1: 12
2: 9
3: 12
4: 41
Right 1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 60
4: 445
1105039345_1105039355 11 Left 1105039345 12:132949538-132949560 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 60
4: 445
1105039339_1105039355 28 Left 1105039339 12:132949521-132949543 CCACCGGACTTTGGGTACCCTAC 0: 10
1: 11
2: 17
3: 15
4: 48
Right 1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG 0: 1
1: 0
2: 2
3: 60
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105039355 Original CRISPR TATCTGCAGGGAGCAGGAGG CGG Intronic
900572868 1:3367982-3368004 CATCTGCAGAGAGCTGGAGGAGG + Intronic
900802072 1:4743476-4743498 AATATGCAGGGAGCAGGCGCGGG - Intronic
901079640 1:6576700-6576722 AGTGTACAGGGAGCAGGAGGGGG + Intronic
901366945 1:8760475-8760497 TATCTGCAGGGACCTGGTAGAGG + Intronic
902176491 1:14654642-14654664 TCTGTCCAGGGAGGAGGAGGTGG - Intronic
902784385 1:18723637-18723659 TCTCTGCAGAGACCTGGAGGTGG + Intronic
902842307 1:19082729-19082751 CATCTGCAGGCAGCAGAAGCAGG - Intronic
903502111 1:23806433-23806455 TGTGTTCAGGGATCAGGAGGAGG - Intronic
904002287 1:27345575-27345597 TGTCGGTAGGGAGCAGGATGGGG - Intronic
904264745 1:29311770-29311792 CCTCTGCAGGGAACAGGCGGTGG - Intronic
905224838 1:36472314-36472336 TATCTGCAGGGTGTAGGCCGTGG + Exonic
905528368 1:38656494-38656516 TCTGGTCAGGGAGCAGGAGGAGG + Intergenic
905889331 1:41509753-41509775 TAGGTGCAGGTAGAAGGAGGAGG - Exonic
906036939 1:42756458-42756480 AATCTCCAAGCAGCAGGAGGAGG + Intronic
906542123 1:46595083-46595105 TAGATGCTGAGAGCAGGAGGTGG + Intronic
908470248 1:64437153-64437175 AATCTGCTGGGGGCAGGCGGGGG + Intergenic
908512772 1:64862519-64862541 GCTGTGGAGGGAGCAGGAGGAGG - Intronic
911864128 1:102994428-102994450 TATGTGCTGGGAGCAGGAGCAGG - Intronic
914506910 1:148297263-148297285 TATCTGCAGGGGGCTGAAAGAGG + Intergenic
915331929 1:155118009-155118031 TATCTGCTGGGAGCAAATGGGGG - Intergenic
915360569 1:155284203-155284225 TGGCCACAGGGAGCAGGAGGTGG + Intronic
916360677 1:163963545-163963567 GAGCTGCCTGGAGCAGGAGGAGG - Intergenic
916675962 1:167064760-167064782 TATCTGCAAAGCACAGGAGGAGG - Intronic
916675983 1:167064872-167064894 TATGTGCAGGGTGAAGGATGAGG + Intronic
916880144 1:169012867-169012889 TATCTCCAGGGAGATGGAGAAGG + Intergenic
919941152 1:202287121-202287143 TATCTGTAGGAAGGAGGAGCTGG + Intronic
921282565 1:213581681-213581703 TATCTGCAGCAAGCATGAAGTGG + Intergenic
921364872 1:214364309-214364331 TATCTACACGGAGCAGTGGGAGG + Intronic
921463762 1:215461109-215461131 TATCAGGAGGTAGCAGGAGTCGG - Intergenic
921577079 1:216847868-216847890 TATGTTCAGGGAGCAGAAGAGGG + Intronic
921657363 1:217756652-217756674 TTTCTTCAGAGATCAGGAGGTGG + Intronic
922742702 1:228023107-228023129 CCTCTCCAGGGAGCAGGAGGAGG - Intronic
922853792 1:228756639-228756661 TTTGTGTAGGGAGGAGGAGGAGG + Intergenic
923027774 1:230219611-230219633 TCTATGCAGGGCCCAGGAGGGGG - Intronic
923065085 1:230510140-230510162 GATCTCCAGGGAGAAGAAGGTGG - Intergenic
923399487 1:233602259-233602281 TACATGGAGGGATCAGGAGGAGG - Intergenic
923523213 1:234752270-234752292 TGTCTGGAGGGAGCAGGAGGTGG + Intergenic
923540116 1:234882733-234882755 TGTATGCATGGAGCAGAAGGAGG - Intergenic
1062888610 10:1038691-1038713 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888627 10:1038754-1038776 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888644 10:1038817-1038839 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888661 10:1038880-1038902 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888695 10:1039006-1039028 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888712 10:1039069-1039091 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888729 10:1039132-1039154 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888746 10:1039195-1039217 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1063309429 10:4938417-4938439 TGTTTCTAGGGAGCAGGAGGGGG + Intronic
1063375187 10:5550459-5550481 AAGCTCCAGGGATCAGGAGGAGG - Intergenic
1063629865 10:7723340-7723362 GGTCTACAGGGAGGAGGAGGCGG - Intronic
1063662754 10:8045282-8045304 TCTCTACAGTGAGCAGGAGAAGG + Intergenic
1065116953 10:22492514-22492536 TATCTGCAGCAAGCTGGTGGAGG - Intergenic
1067190570 10:44064512-44064534 TATCTGCCAGGAGCAGGGAGGGG - Intergenic
1067528952 10:47056391-47056413 TCTCTCCAGGGAGGAGGTGGTGG - Intergenic
1069547299 10:69337947-69337969 GTTCTGTTGGGAGCAGGAGGTGG + Intronic
1069633836 10:69913606-69913628 CATGTGCAGGAGGCAGGAGGCGG - Intronic
1069960612 10:72076960-72076982 CATCTGCACTGAGGAGGAGGAGG + Intronic
1069988006 10:72297433-72297455 TATCTGCGGGGGGAAGTAGGAGG - Intergenic
1070393859 10:75994535-75994557 TAGGTGCCGGGAGCAGGAGAGGG + Intronic
1070587738 10:77779475-77779497 TATCTGCAGAAAGCAGCAGTAGG + Intergenic
1070649985 10:78228418-78228440 TGTGTGCTGGGAGAAGGAGGAGG + Intergenic
1070823377 10:79376044-79376066 TAACAGCAGGAAGCAGCAGGAGG + Intergenic
1071564544 10:86665017-86665039 GATCTGCAGGCAGCAGGGGTGGG + Intronic
1071873211 10:89817319-89817341 TAGGGGCAGGGAGCAGGAGGTGG - Intergenic
1072613637 10:97035359-97035381 TATCTGTGGGCATCAGGAGGAGG - Intronic
1073323930 10:102631725-102631747 GTTCTCCAGGGAGCAGGAGTTGG + Exonic
1075206605 10:120454680-120454702 TAGGTGCAAGGAGCAGAAGGTGG - Intergenic
1075693589 10:124418263-124418285 GATCTGCAGGGCGCAGGAGCAGG + Intronic
1075754259 10:124798561-124798583 GATCAGCAGGGTGCTGGAGGGGG - Intergenic
1075903764 10:126063635-126063657 TTTCTGCAGCCAGCAGGAGGAGG + Intronic
1076442702 10:130491284-130491306 AACCTCCAGGCAGCAGGAGGAGG - Intergenic
1077260743 11:1618666-1618688 TTTCTGCAGGGAAGAGGGGGAGG - Intergenic
1077494475 11:2880226-2880248 CACCTGCTGGGAGCTGGAGGAGG + Intergenic
1077600377 11:3570502-3570524 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1078022990 11:7670984-7671006 AAGGTGCAGGGAGGAGGAGGAGG + Intronic
1078521456 11:12067162-12067184 AATGTGCAGGGAGCGGCAGGTGG + Intergenic
1078528271 11:12117227-12117249 TTTCTGCTGGCAGCAAGAGGAGG + Intronic
1079032669 11:16997257-16997279 TTTCTGATGGGAGGAGGAGGAGG - Intronic
1079059041 11:17231765-17231787 TGTCTGTAGGGAGCAGGATTGGG - Intronic
1080230562 11:30014950-30014972 GATCAGCAAGGAGCAGCAGGTGG - Intronic
1080554330 11:33402296-33402318 GATATGCAGGGTGAAGGAGGAGG - Intergenic
1080770634 11:35338068-35338090 TATCTGCATAGATCAGGAGTTGG + Intronic
1080894162 11:36435194-36435216 TCACTGCAGGGAGGAGGAGGGGG - Intronic
1081814878 11:45933406-45933428 TGGCTGGAGGGAGCAGGGGGTGG - Intronic
1083203292 11:61132651-61132673 TATGGGCAGGGAAGAGGAGGGGG - Intronic
1083782761 11:64926566-64926588 TGTCTGCAAGGAGCAGGAGATGG + Intronic
1083812196 11:65112275-65112297 TGTCGACTGGGAGCAGGAGGAGG + Intronic
1084256290 11:67945123-67945145 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1084816474 11:71650180-71650202 TAACTGCTGGGAGAAGAAGGTGG - Intergenic
1085809137 11:79664782-79664804 TGGTTGCAGGGGGCAGGAGGGGG + Intergenic
1087260025 11:96001051-96001073 TCTCTGCACGGTGCAGGAGAAGG - Intronic
1089300861 11:117497888-117497910 CATCTGCAAGCAGCAGGGGGAGG - Intronic
1089617973 11:119705901-119705923 TGTCTGCAGGGAGAAGGAGTGGG - Intronic
1090003713 11:122982393-122982415 TATAGGCAGTGGGCAGGAGGAGG + Intergenic
1090095822 11:123741252-123741274 TTTCTGCAGGCCCCAGGAGGGGG + Intronic
1090171697 11:124611410-124611432 TCTCTGCTGGGAGCAGGCGATGG - Intergenic
1090751391 11:129749183-129749205 TATGTGCAGGAGGCAGAAGGTGG - Intergenic
1090899168 11:131010952-131010974 AATCTGCAGGGAACAGGAGCAGG - Intergenic
1090912257 11:131131575-131131597 TGTTGGGAGGGAGCAGGAGGAGG + Intergenic
1091832456 12:3559701-3559723 CATCTGCCTGGGGCAGGAGGTGG - Intronic
1091847997 12:3672370-3672392 TATCTGAATGGAGGAGCAGGTGG + Intronic
1091851259 12:3698958-3698980 CATCTCCTGGGAGCAGCAGGTGG - Intronic
1092426523 12:8379850-8379872 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1092522683 12:9290256-9290278 GTTCTGCAAGGAGCAGGAGCAGG + Intergenic
1092544602 12:9441641-9441663 CTTCTGCAAGGAGCAGGAGCAGG - Intergenic
1094508351 12:31080429-31080451 CTTCTGCAAGGAGCAGGAGCAGG + Intronic
1095926671 12:47585720-47585742 TCCCTGCAGGGAGCAGCATGGGG + Intergenic
1096143230 12:49259850-49259872 TGTGTCCTGGGAGCAGGAGGAGG + Intronic
1096489066 12:52003762-52003784 TTCCTGGAGGGAGGAGGAGGGGG + Intergenic
1097947327 12:65385194-65385216 TATTTGGTGGGAGAAGGAGGAGG + Intronic
1098780908 12:74685476-74685498 AATTTGAAGGGAGCAGGAAGGGG + Intergenic
1100000260 12:89826106-89826128 TGTGTGCAGGGTGAAGGAGGAGG - Intergenic
1100393640 12:94165544-94165566 CAGCTGCAGGGACCAGGACGTGG - Intronic
1101400454 12:104382423-104382445 TATCTGCAGGGGGCAGGATCTGG - Intergenic
1101560235 12:105850444-105850466 TAACAGCAGGCAGCATGAGGAGG - Intergenic
1101592208 12:106134558-106134580 TATCTCTAGTGAGCAGTAGGTGG - Intronic
1101826404 12:108223888-108223910 TCACGGCAGGGATCAGGAGGGGG - Intronic
1103892651 12:124251388-124251410 TAGCTGCAGGGAGGCGGTGGTGG + Intronic
1103911958 12:124356801-124356823 TCTCTGCTGAGGGCAGGAGGTGG + Intronic
1104088102 12:125493908-125493930 CATTTCCAGGGAGGAGGAGGAGG - Intronic
1104510630 12:129374549-129374571 GAGCTGAAGGGAGCAGGTGGAGG + Intronic
1104603110 12:130166714-130166736 TATTTGCAGGGCACAGGAGCAGG + Intergenic
1105039248 12:132948878-132948900 CACCTGCAGGGCCCAGGAGGCGG + Intronic
1105039355 12:132949572-132949594 TATCTGCAGGGAGCAGGAGGCGG + Intronic
1108335996 13:49443186-49443208 TCACTTCATGGAGCAGGAGGAGG - Intronic
1110243805 13:73298603-73298625 TACCTGCAAGGAGTAGGAGACGG + Intergenic
1110484132 13:76018052-76018074 AACCTGCAGGGTGTAGGAGGCGG + Intergenic
1110886106 13:80637174-80637196 TATATGTGGGGAGCATGAGGCGG - Intergenic
1110975800 13:81832690-81832712 TGTCTGCAGGGATCAGGATGTGG + Intergenic
1111986261 13:95069887-95069909 TATTTGCAGTGAGCAGTAGGTGG - Intronic
1112435275 13:99387460-99387482 TATTTGCAGGAAGCAAGAGTGGG - Intergenic
1112844443 13:103621822-103621844 CACCTGCTGGTAGCAGGAGGTGG - Intergenic
1113404648 13:110026950-110026972 TGTCTGCAGGGAACAGCATGTGG - Intergenic
1113491600 13:110696831-110696853 GAACTGCAGGAAGGAGGAGGTGG - Intronic
1113601462 13:111572185-111572207 TATCAGGAAGGAGCTGGAGGGGG + Intergenic
1113635309 13:111915176-111915198 GATCTGCAGGCAGGTGGAGGTGG - Intergenic
1113651836 13:112039016-112039038 GATCAGCAGAGAGCAGGAGGAGG - Intergenic
1115082613 14:29475127-29475149 TATCTGAAGGGAGGAGAAGATGG - Intergenic
1116454056 14:45097882-45097904 TATTTGAAGGGAGGTGGAGGTGG - Intronic
1117733941 14:58750982-58751004 TAGGTGCAGGGAGCAGGGAGAGG - Intergenic
1117803931 14:59470644-59470666 TACCTGCAGGGAGCAAGCAGCGG + Intronic
1117978479 14:61320730-61320752 AATCTGCAGGGACCACGGGGTGG + Intronic
1118032688 14:61833856-61833878 TTCCTGCAGGGAGTTGGAGGTGG + Intergenic
1118225778 14:63897793-63897815 CATCTCCTGGGAGCAGGAGCAGG - Intronic
1118260185 14:64239152-64239174 CATGTGCTGGGGGCAGGAGGTGG - Intronic
1118273120 14:64361987-64362009 TATCGCCAGAAAGCAGGAGGAGG - Intergenic
1119195528 14:72714472-72714494 GCTCTGCAGGGGGCAGGAGGAGG - Exonic
1119425693 14:74533502-74533524 TGTCTGCAGTGAGCTGGAGGAGG + Intronic
1119836488 14:77754594-77754616 TATCGGAGGGGAGGAGGAGGAGG + Intronic
1120023641 14:79557307-79557329 TTTTTGCAGGGGGCAGGGGGAGG - Intronic
1120480504 14:85043597-85043619 TATATGGCTGGAGCAGGAGGAGG + Intergenic
1121111227 14:91314483-91314505 TAGGAGCAGTGAGCAGGAGGTGG - Intronic
1121583163 14:95045602-95045624 CATCATCAGGGGGCAGGAGGAGG + Intergenic
1121819783 14:96957072-96957094 TGTCTGCCTGGAGCAGGAGGTGG - Intergenic
1121904083 14:97723773-97723795 TATGGGGAGGGAGCAGGGGGTGG - Intergenic
1122338186 14:101007439-101007461 GTTTTGCAGGGAGCAGGGGGTGG - Intergenic
1122721551 14:103725198-103725220 CATCTGGAGTGAGCAGGAGGCGG + Intronic
1122762140 14:104037147-104037169 CTTCTGCAGCGAGCAGGAGGGGG + Intronic
1122984896 14:105207511-105207533 TCTGAGCAGGCAGCAGGAGGCGG + Intergenic
1123168522 14:106349221-106349243 TCCCTGCAGGGAGGCGGAGGGGG - Intergenic
1124009904 15:25830040-25830062 CATCTGGAGGGAGATGGAGGTGG + Intronic
1125087337 15:35745538-35745560 CATCTGGAGTGAGCAGGAAGTGG + Intergenic
1125979738 15:43989470-43989492 TATCTCCAGGGAGGAGCTGGAGG + Intronic
1127280914 15:57491860-57491882 TGTTTGCAGGAAGGAGGAGGAGG - Intronic
1127417608 15:58772043-58772065 TCTGTGCAAGGAGGAGGAGGGGG + Exonic
1127453383 15:59137454-59137476 GATCTGCAGGGAGAGAGAGGTGG + Exonic
1127673483 15:61217905-61217927 TGACTTCAGGGAGGAGGAGGGGG - Intronic
1127897928 15:63318733-63318755 TCTCTAGAGGGACCAGGAGGAGG + Intergenic
1128103802 15:65028610-65028632 TATCTGTAGGGAAAAGGAGATGG + Intronic
1128152433 15:65371748-65371770 TAGCTACAGGGAGGAGGATGGGG - Intronic
1128498575 15:68211646-68211668 TACAGGCAGGGAGCAGGAGGTGG + Intronic
1129451238 15:75652395-75652417 CCTGTGCAGGCAGCAGGAGGGGG + Intronic
1129496086 15:75982510-75982532 TTTCTGCAGGGAGCTAGAAGTGG - Intronic
1129672157 15:77613399-77613421 TTTTTGCAGGGCGCAGGTGGAGG - Exonic
1129785134 15:78304737-78304759 TTTCTGCTGAGAGCAGCAGGTGG + Intergenic
1131059441 15:89395582-89395604 TGCCTGCTGTGAGCAGGAGGAGG - Intergenic
1131291247 15:91108940-91108962 CAACTGAAGGGAACAGGAGGTGG - Intronic
1131511095 15:93049955-93049977 TGTCTGCAGGGAGCAGGGAAAGG - Intronic
1132050562 15:98604614-98604636 GGAGTGCAGGGAGCAGGAGGGGG + Intergenic
1132353686 15:101156163-101156185 AATCAGCAGGGGGGAGGAGGTGG + Intergenic
1132609329 16:807484-807506 TATCGGGAGGCGGCAGGAGGCGG - Exonic
1133097583 16:3458005-3458027 TGCCGGCAGGGAGCGGGAGGCGG + Intronic
1133371765 16:5250708-5250730 TACCTGCTGGGAGAAGAAGGTGG - Intergenic
1133454598 16:5931108-5931130 TACGTGCAGAGAGCAAGAGGTGG - Intergenic
1136224050 16:28846728-28846750 TCTCTGCCGGGCCCAGGAGGAGG - Exonic
1136480997 16:30541738-30541760 CATCTCCTGGGAGTAGGAGGAGG - Intronic
1136998226 16:35206414-35206436 TTTTTGCAGGGGGCAGGAGGTGG - Intergenic
1137381500 16:48003560-48003582 TGTCTGCAGAGGGAAGGAGGTGG + Intergenic
1137401895 16:48160567-48160589 TATGTGAGGGGAGAAGGAGGTGG + Intergenic
1137454737 16:48609789-48609811 GCTCTGCGGGGCGCAGGAGGCGG - Exonic
1138040242 16:53655992-53656014 TATCTGCAAAGAGCAGGTGGAGG + Intronic
1138302566 16:55944759-55944781 TATCTGGAGAGGGCAGTAGGAGG - Intronic
1139283656 16:65791156-65791178 TAGAGGCAGGGAGGAGGAGGAGG + Intergenic
1139683385 16:68582727-68582749 TGTTTGCAGGGAGGCGGAGGCGG + Intergenic
1140280953 16:73555081-73555103 TTTATGAAGGGAGCGGGAGGTGG + Intergenic
1140289731 16:73641985-73642007 TCTCTGCAGGGAGGAGTCGGAGG - Intergenic
1140519156 16:75566762-75566784 TGTACGCAGGGCGCAGGAGGAGG + Intronic
1140821648 16:78668605-78668627 TATCTGCGGGGAACAGGTGAAGG + Intronic
1141165143 16:81655318-81655340 GATCTGGAGGGAGCAGGCAGAGG + Intronic
1141812577 16:86385293-86385315 TTTTTGCAGGGAGGAGGAGAGGG + Intergenic
1142119578 16:88379382-88379404 GCTCTGCAGGGAGCAGGGGCTGG - Intergenic
1142187006 16:88699387-88699409 CAGCTGTGGGGAGCAGGAGGAGG - Intronic
1142484675 17:238979-239001 TGTCTGCAGGGATCAGGTGGAGG + Intronic
1142671881 17:1491379-1491401 TACCTGCGGGGAGCGGGAGGCGG - Intronic
1142764308 17:2057025-2057047 GATCTGCAGGTAGCTGGCGGCGG - Exonic
1142767625 17:2074435-2074457 CATCCCCTGGGAGCAGGAGGAGG + Intronic
1142976326 17:3646871-3646893 TATCTGCGGGGTACTGGAGGAGG - Intronic
1143347488 17:6260706-6260728 CTTCTGCAGGCAGCTGGAGGTGG - Intergenic
1143416736 17:6756179-6756201 TTTCTGAAGGGAGCAGAAAGTGG + Intronic
1143779067 17:9219963-9219985 GAGCTGCAGGGAGCTGCAGGGGG - Intronic
1143858763 17:9872661-9872683 TGTTGGCATGGAGCAGGAGGTGG + Intronic
1144193721 17:12870605-12870627 TGTCTCCAGGGAGCAGGACTAGG - Intronic
1145251218 17:21297983-21298005 TAGCTGCAGGTAGCAGGATGGGG - Intronic
1145898201 17:28473147-28473169 TACCTGGAAGGAGGAGGAGGAGG + Intronic
1146561108 17:33871426-33871448 GATGAGCAGGGAGAAGGAGGTGG - Intronic
1147368389 17:39974515-39974537 GATCTGACGGGGGCAGGAGGTGG + Intronic
1148445191 17:47733358-47733380 GATGGGCAGGGAGCAGGGGGCGG - Exonic
1148627038 17:49077532-49077554 ATTCTTCAGGGAGTAGGAGGTGG + Intergenic
1148753421 17:49959323-49959345 CACCTCCAGGGAGGAGGAGGAGG - Intergenic
1149417939 17:56479820-56479842 ACTCTGCAGGGAGCAGCAGTAGG - Intronic
1151456959 17:74232201-74232223 GAGCTTAAGGGAGCAGGAGGGGG - Intronic
1151457845 17:74237208-74237230 TCTTTGCAGGCAGCAGAAGGTGG - Intronic
1151563778 17:74885626-74885648 TATCTGTGGGGAGAAGGAAGAGG - Intronic
1152049681 17:77962584-77962606 TAGGTTGAGGGAGCAGGAGGCGG + Intergenic
1152132976 17:78488398-78488420 GACCTGGAGGAAGCAGGAGGAGG - Intronic
1152337209 17:79705774-79705796 TTGCTGGAGGGAGCAAGAGGTGG + Intergenic
1152888227 17:82865022-82865044 TGCCTGCAGGGAGCAGCAGCTGG - Intronic
1153047121 18:866375-866397 TACCTGAATGGAGGAGGAGGAGG + Intergenic
1154102787 18:11491350-11491372 CATCTGCAGGGACCCTGAGGAGG - Intergenic
1155381075 18:25223373-25223395 TATCTGCAGGGAGCCACAGGGGG + Intronic
1155403494 18:25463326-25463348 CAACTGCATGGAGCAGGGGGTGG + Intergenic
1155547601 18:26931040-26931062 TAGCTGCAGGGACCTGGAAGGGG + Intronic
1156401553 18:36744619-36744641 TATCTGTGGGGAGCAGGAGCCGG - Intronic
1156873083 18:41970738-41970760 TAACTGCAGGGAGCAGAAAATGG - Intronic
1158192285 18:54844008-54844030 TGGCTGCAGGGAGGAGGAGAAGG + Intronic
1159886482 18:73912290-73912312 TATGTGCAGAGAGTAGGGGGAGG - Intergenic
1160742231 19:692000-692022 TCTCTGCAGGGAGGAGGTGGTGG + Exonic
1160805435 19:990443-990465 TGACAGCAGGGAGCGGGAGGAGG - Intronic
1160843168 19:1155426-1155448 TGACTGCAGGGAGCAGGCAGAGG - Intronic
1160859354 19:1231098-1231120 TACCTGCCGAGAGCAGGGGGCGG + Exonic
1161134789 19:2613423-2613445 TATCTACTGTGAGCAGGAGCGGG - Intronic
1161366081 19:3880625-3880647 TGTGTGCAGGGAGGAGGGGGTGG - Exonic
1161687793 19:5711974-5711996 TATCAGCAGACAGCTGGAGGTGG - Exonic
1161953945 19:7482670-7482692 TCTATGCAGGGAGCATGAGGTGG + Intronic
1162757204 19:12867526-12867548 CAGCTGCAGGGAGCAGCAAGCGG + Exonic
1163654766 19:18539326-18539348 TCTCTGCAGGTCTCAGGAGGGGG - Intronic
1164712936 19:30371674-30371696 TATCTGTAGGGGAAAGGAGGGGG + Intronic
1165775020 19:38399232-38399254 TCTCAGCAGGGAGCAGGACTGGG - Intergenic
1165852908 19:38860898-38860920 TTTCTGCTTGGAGCCGGAGGAGG - Intergenic
1166067190 19:40366753-40366775 TTTCTGTGGGGAGGAGGAGGTGG - Exonic
1166863496 19:45822844-45822866 TTTCTACAGGGAGAAGGTGGTGG + Exonic
1167056103 19:47112425-47112447 TGTCGTCAGGGAGCGGGAGGCGG + Exonic
1167566468 19:50260626-50260648 TATCTGCAATGAGCAGGGAGGGG - Exonic
1167615113 19:50528761-50528783 TATTTGCAGGGAGCTGGTGGGGG + Intronic
1168185962 19:54699438-54699460 TGTCTACAGGGTGGAGGAGGAGG - Intronic
1168242761 19:55095598-55095620 AAGCTGCTGGGAGAAGGAGGAGG + Exonic
925132531 2:1503784-1503806 GATGTGCCGGGAGCAGGGGGCGG + Intronic
925237207 2:2290250-2290272 TATCTGCAAGGAGAGGGAGCTGG + Intronic
926220327 2:10931904-10931926 CATCTGCCAGGAGCAGCAGGTGG - Intergenic
926361074 2:12087931-12087953 TATCTGAAGGCAGGAGAAGGTGG + Intergenic
927502199 2:23590407-23590429 AATCTGGGGAGAGCAGGAGGTGG - Intronic
929059351 2:37907173-37907195 TCTCTGGAGGTAGCAGGAAGTGG + Intergenic
929341592 2:40825465-40825487 AATCTGCAGGGAGGAACAGGAGG - Intergenic
930053432 2:47234493-47234515 CATCTGCAGGGAGGAGGGGGAGG + Intergenic
931721296 2:65069516-65069538 GAGCTGCAGGGAGCGGGAGCTGG + Exonic
932793483 2:74675284-74675306 TATCTGTAGTGACCAGCAGGGGG - Exonic
933724773 2:85420549-85420571 GATCTTCAGGGAGCAGGAATGGG - Intronic
934501987 2:94869284-94869306 CATCTCCAGAAAGCAGGAGGTGG - Intergenic
934578670 2:95420372-95420394 TATTTGCAGGAAGGAGGAGGAGG + Intergenic
934600772 2:95656337-95656359 TATTCGCAGGAAGGAGGAGGAGG - Intergenic
934766253 2:96881728-96881750 AATCTGCAGGGGGCAGGGAGGGG + Intronic
934983351 2:98865986-98866008 CAGCTTCAGAGAGCAGGAGGTGG - Intronic
935313207 2:101805949-101805971 CATCTTAAGGGAGCAGGGGGAGG - Intronic
936234639 2:110732572-110732594 CACCTGCTGGGAGCTGGAGGAGG + Exonic
936437737 2:112522708-112522730 TCTCTGGGGGGAGCAGGGGGTGG - Intronic
937298756 2:120825750-120825772 TGTCTGCAGGAAGCACCAGGAGG - Intronic
937535734 2:122884467-122884489 TATCTGCAAGGATAAAGAGGAGG + Intergenic
937853850 2:126658408-126658430 CATCTGCAGTGAGTAGGAAGAGG + Intronic
938097967 2:128475613-128475635 GCTTGGCAGGGAGCAGGAGGAGG + Intergenic
940752412 2:157641173-157641195 TATGTTAAGGGAGGAGGAGGAGG + Intergenic
942042149 2:172078015-172078037 TATGTGCAGGGGGCAGGGGAGGG + Intronic
942498222 2:176561543-176561565 AATGTGCAGGGAGCATGATGAGG + Intergenic
943040490 2:182798755-182798777 TATCTGTTGGGGGCGGGAGGTGG - Intergenic
943639606 2:190343884-190343906 AAGCGGCGGGGAGCAGGAGGAGG - Exonic
943642476 2:190374511-190374533 TATCTGATGGGAACAGGAGTTGG + Intergenic
944890776 2:204115239-204115261 TATGTGTATGGAGCATGAGGAGG + Intergenic
945142054 2:206697428-206697450 GATCTGCAGGTAGCAGGAAGAGG - Intronic
946248782 2:218400956-218400978 TAGTTGCAGGGGGCCGGAGGGGG + Intronic
946305527 2:218855044-218855066 GTCCTGCAGGGAGGAGGAGGCGG - Intergenic
946331401 2:219010994-219011016 AATCTGCAGGGGGCAGGAATAGG + Exonic
946505394 2:220295099-220295121 TAACTGCAGGAATCAGGAGAGGG - Intergenic
947890837 2:233617851-233617873 TATCCTCAGGGGGCATGAGGTGG + Exonic
947892450 2:233636666-233636688 TATCCTCAGGGGGCATGAGGTGG + Exonic
948510261 2:238459155-238459177 GATCTGCAGGCTGGAGGAGGAGG + Intergenic
1169311731 20:4548273-4548295 TATCTACAGGGAACAGGAGCTGG - Intergenic
1171406562 20:24915765-24915787 AATCTGCAGGGAGCTGGGGATGG - Intergenic
1172846318 20:37931719-37931741 GATCTCCAGCGAGTAGGAGGGGG - Exonic
1173918250 20:46725579-46725601 TACCAGCAGGGAGGAAGAGGAGG - Exonic
1174240094 20:49126848-49126870 TATCTGCATGGAGCGGGGTGGGG + Intronic
1174965434 20:55208690-55208712 TACATGGATGGAGCAGGAGGAGG - Intergenic
1175336954 20:58202823-58202845 TGGCTGCAGGGACCAGGAGGAGG + Intergenic
1178137188 21:29640819-29640841 TCACTGCAGGGAAAAGGAGGTGG + Intronic
1178811170 21:35882838-35882860 AATTTGCAGGGGGTAGGAGGAGG - Intronic
1179502987 21:41821511-41821533 CCTCAGCAGGGAGGAGGAGGGGG + Intronic
1179660142 21:42869077-42869099 CATCTGCAGAGAGGAGGAGGAGG + Intronic
1179791826 21:43760132-43760154 CATCTGCAGGTGGAAGGAGGTGG + Exonic
1180657424 22:17434647-17434669 TAGCTACGGGGAGCAGCAGGGGG - Intronic
1180852263 22:19027605-19027627 TCTCTGGAAGGTGCAGGAGGAGG - Intergenic
1181220687 22:21363214-21363236 TCTCTGGAAGGTGCAGGAGGAGG + Intergenic
1181573162 22:23778798-23778820 TTTCTGTGGGGAGCAGGAGGAGG + Intronic
1181898659 22:26133682-26133704 GATGTGCAGGGAGAAGGTGGGGG - Intergenic
1181985251 22:26796219-26796241 TGTCTGCAGGGAGAAAGATGGGG - Intergenic
1183220787 22:36511626-36511648 CATCTGCATGAAGCTGGAGGAGG - Exonic
1184110716 22:42392542-42392564 AAACGGCAGGGAGCTGGAGGGGG + Intronic
1184429016 22:44430387-44430409 TGGCTGCAGGGACCAGGAGAGGG - Intergenic
1184655082 22:45937026-45937048 TAACTGCACGGAGGAGGAGGTGG + Intronic
1184935999 22:47721399-47721421 TATCCACAGGAAGGAGGAGGAGG - Intergenic
1185066184 22:48632774-48632796 TCTCTGCAGGGATGACGAGGAGG - Intronic
949828225 3:8185428-8185450 GATCTGTGGTGAGCAGGAGGAGG - Intergenic
951545879 3:23824800-23824822 TTTCTTAAGGGAGCAGGAAGGGG - Intronic
952862060 3:37821209-37821231 TAGCTACAGGGAGCAGGACGAGG + Exonic
952959814 3:38582197-38582219 ATTCTGCAGGGAGCCGGGGGAGG + Intronic
953856394 3:46502688-46502710 TGTCTGCAGGGAAGAGGAAGGGG + Intergenic
954417454 3:50400330-50400352 CACCTGCTTGGAGCAGGAGGTGG - Intronic
954699092 3:52442302-52442324 TGTCTGCGGGGAGAAGGAGGGGG + Exonic
954833014 3:53439222-53439244 GATCCGAAGGGAGCAGTAGGAGG - Intergenic
954924097 3:54217278-54217300 AGGCTGCAGGGAGGAGGAGGCGG - Intronic
956119758 3:65954583-65954605 TATCTACAGAGAGAAGGAGGAGG + Intronic
956895556 3:73656224-73656246 TCACTGCAGGGAGCAGGAGAGGG - Intergenic
957071198 3:75569154-75569176 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
961061458 3:123832287-123832309 TGTCTGAAGGGAGGAGAAGGGGG - Intronic
961234830 3:125357276-125357298 CCTCTGCAGGGAGGAGGAGGAGG - Intronic
961319106 3:126060775-126060797 CAGCTGCACGGAGCAGCAGGTGG + Intronic
961430901 3:126882192-126882214 TATCAGCAGGTAGCAGGAAGCGG + Intronic
961455210 3:127020602-127020624 TACCTCCAGAGGGCAGGAGGAGG + Intronic
961733300 3:128983764-128983786 TGTCTGCAGGGACCAGGAGGTGG + Intronic
961987843 3:131156982-131157004 GATCTGCTGGGAGGAGGATGAGG + Intronic
962783894 3:138748317-138748339 TGGCAGCAGGGAGCTGGAGGTGG - Intronic
962796985 3:138858154-138858176 TAGGTGCAGGGAGCTGGAGAGGG - Intergenic
964118612 3:153160953-153160975 TTTTTGCAGGGAGTGGGAGGGGG - Intergenic
965397414 3:168175591-168175613 TACATGATGGGAGCAGGAGGAGG + Intergenic
966666747 3:182480155-182480177 TATCTGAAGGGAGGAGGAAGTGG + Intergenic
966935714 3:184707417-184707439 TGTCTGAAGGGGGCAGGATGGGG + Intergenic
967440595 3:189503332-189503354 TGCCTGCAGTGAGCTGGAGGTGG + Intergenic
967972595 3:195010583-195010605 TATCTGCAAGGAGAAAGAGAGGG + Intergenic
968518672 4:1025357-1025379 TATCTGCAGTGGGCACGGGGGGG + Exonic
968835990 4:2964266-2964288 GATCTGCACGGAGCCGGAGCCGG + Intronic
969014809 4:4096858-4096880 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
969335221 4:6504037-6504059 TCTCTGAATGGTGCAGGAGGAGG - Intronic
969348124 4:6581837-6581859 TGACTGCCGGGAGCAGGAGTTGG - Intronic
969659334 4:8517453-8517475 TGTCTCCAGGGTTCAGGAGGGGG + Intergenic
969798326 4:9543102-9543124 TAACTGCTGGGAGAAGAAGGTGG - Intergenic
971028058 4:22607759-22607781 TAGCTGCAGGGACCTGGAAGGGG + Intergenic
971695569 4:29898651-29898673 TATATGCAGGGTGCTGTAGGTGG - Intergenic
973771775 4:54213440-54213462 GAGCTGCAGGGTGCAGGCGGGGG + Intronic
974877706 4:67718106-67718128 AAACTGGAGGGAGGAGGAGGAGG - Intergenic
976972028 4:91115773-91115795 GATAGGCAGGGAGCAAGAGGAGG - Intronic
977280566 4:95034568-95034590 AATCTGGATGGAGCTGGAGGCGG - Intronic
977380231 4:96263792-96263814 TATCTTTAGGTATCAGGAGGGGG - Intergenic
978393235 4:108250012-108250034 TGTCTGCAGAGAGAGGGAGGGGG + Intergenic
978826593 4:113031689-113031711 TAACTGCAGGGTTCAGCAGGAGG + Intronic
981010722 4:139922186-139922208 AAGCTGAAGGGAGCAGAAGGGGG - Intronic
981544062 4:145876245-145876267 AATCTGCTGGGAGCAGTTGGGGG + Intronic
981559068 4:146027203-146027225 AATATGGAGGGAGGAGGAGGAGG - Intergenic
981725901 4:147846942-147846964 TATTTTCAGGGAAGAGGAGGTGG - Intronic
982072603 4:151708639-151708661 TACCTGGAGGAAGGAGGAGGGGG - Intronic
983112730 4:163772915-163772937 TATATGGAAGGAGAAGGAGGTGG + Intronic
983216443 4:165007026-165007048 GAGGGGCAGGGAGCAGGAGGTGG + Intergenic
985099808 4:186447633-186447655 TATTTTGAGAGAGCAGGAGGTGG - Intronic
985107877 4:186516387-186516409 GATCTGCATGGAGCAAGGGGTGG + Intronic
985476437 5:81913-81935 GTTCTGCAGGGAGCCGGAGCTGG + Intergenic
985531005 5:433844-433866 TCTCTGCAGGGACAGGGAGGAGG + Exonic
985708315 5:1414277-1414299 CATCTGCAGGGAGCAGTCGAGGG + Intronic
986002838 5:3643517-3643539 CATCTGGAGGGGGCAGGTGGGGG - Intergenic
986136311 5:4982358-4982380 TGTGTGCAGGGGGCAGGCGGGGG + Intergenic
986492300 5:8306012-8306034 TCTCTTCAGGGTGAAGGAGGGGG - Intergenic
986827754 5:11540211-11540233 TAACTGAAGTGAGCAGCAGGAGG - Intronic
988538623 5:32089954-32089976 TGTTTGAAGGGAGGAGGAGGAGG - Exonic
989089524 5:37715498-37715520 TATCTGTAGAGATCAGGAGGTGG + Intronic
989417465 5:41196431-41196453 GATGTCCAGGGAGAAGGAGGGGG + Intronic
989535803 5:42562406-42562428 TAAGTGCAGGGGCCAGGAGGAGG - Intronic
992137606 5:73763159-73763181 TATCTGGAGGGAGGAAGGGGAGG - Intronic
992869985 5:80996076-80996098 TAACTATAGGGAGGAGGAGGAGG - Intronic
993602558 5:89946707-89946729 TATCTGGAGGCAGGAGGCGGAGG - Intergenic
993854672 5:93058830-93058852 TAAGTGCAGGGAGAAGGAGTAGG - Intergenic
996550364 5:124723722-124723744 TATTTGCACGGAGTAGGGGGAGG + Intronic
997634965 5:135398518-135398540 TATCTGCAGGGAGGGGAAGGCGG - Intronic
999217171 5:149944956-149944978 TGTCTGCACAGAGCAGGAGGTGG + Intergenic
999825042 5:155265788-155265810 TATTAGCAGGGAGAAGGAAGGGG - Intergenic
1000202036 5:159020526-159020548 GAACTGCAGGAAGGAGGAGGTGG - Intronic
1000283259 5:159800985-159801007 TATCTCCCGGGTCCAGGAGGAGG - Intergenic
1001594043 5:172886350-172886372 TGTGTGCACAGAGCAGGAGGGGG - Intronic
1002689088 5:181037822-181037844 TGTCTGCTGAGAGCAGCAGGTGG + Intergenic
1002800301 6:515830-515852 TATCTGCAGTGAGCACCAAGTGG + Intronic
1002858349 6:1057660-1057682 CAGCTGCAGGGAGCAGCAGCGGG - Intergenic
1003615085 6:7647882-7647904 TCTGAACAGGGAGCAGGAGGAGG + Intergenic
1005898334 6:30196744-30196766 CTTCTGCAGGGGGCAGGAAGGGG + Exonic
1006080081 6:31560011-31560033 GATGTTCAGGGTGCAGGAGGGGG + Intergenic
1006628196 6:35412470-35412492 TGACTGCATGGAGCAGGAGGAGG + Intronic
1009381303 6:63033978-63034000 TATTTGGAGGGAGCAGGTAGGGG - Intergenic
1009808808 6:68635431-68635453 TACCTGCAGGGGGGAGGAGGAGG + Exonic
1009867707 6:69418049-69418071 TAACTGCAGTTATCAGGAGGGGG - Intergenic
1010002060 6:70957484-70957506 CAGCAGCTGGGAGCAGGAGGAGG - Intergenic
1012628389 6:101432102-101432124 TATCTGCAGGGAGCAGGGCAGGG - Intronic
1013288617 6:108700694-108700716 TTTCTGGAGGGGGCAGGTGGGGG + Intergenic
1016009550 6:139125123-139125145 TATCTGCATGCAACAGGAAGTGG + Intergenic
1016849606 6:148603623-148603645 TAGCTGCCAGGAGCTGGAGGTGG - Intergenic
1017905091 6:158752637-158752659 TATCTGCAGAGAGCTGGCTGTGG + Intronic
1018975000 6:168557943-168557965 AATCTGCGGGCCGCAGGAGGAGG - Intronic
1019082261 6:169442835-169442857 AATCCCCAGGCAGCAGGAGGAGG - Intergenic
1019586418 7:1806632-1806654 GATCGCCAGGGAGCGGGAGGAGG - Intergenic
1020000392 7:4752475-4752497 TAACTGCTGGGAACAGGAGCAGG + Intronic
1020087010 7:5315965-5315987 TATAGTCAGGGGGCAGGAGGCGG + Exonic
1020121596 7:5507152-5507174 TATGTACAGGAAGCAGGAGCAGG - Intronic
1020782220 7:12531912-12531934 TATAGGCAGGGTGGAGGAGGCGG + Intergenic
1022044730 7:26613795-26613817 CAGCTACAGGGAGCACGAGGGGG + Intergenic
1022714882 7:32890911-32890933 AATCCGTAGGGAGAAGGAGGTGG + Intronic
1022799480 7:33761927-33761949 TTGCTGCAGGCAGCAGTAGGTGG + Intergenic
1023163372 7:37319829-37319851 TATCTGCAGGGACCTGGTGATGG - Intronic
1023939304 7:44759728-44759750 CCTGTGCAGGGAGCAGCAGGTGG + Intronic
1023941229 7:44769345-44769367 AGGCTGCAGGGAGGAGGAGGAGG + Exonic
1025207296 7:57001188-57001210 TATAGTCAGGGGGCAGGAGGCGG - Intergenic
1025996638 7:66531512-66531534 GAGCTGCAGGGAGCTGGTGGCGG - Intergenic
1026897145 7:74016220-74016242 TGTCTGCTGGGAGCAAGAAGTGG - Intergenic
1028292253 7:89079851-89079873 TATATTCAGGGAGCAGCAAGAGG + Intronic
1029073481 7:97918487-97918509 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1029217968 7:98965490-98965512 TCTCTGCAGGGAGAGGGATGAGG - Intronic
1029271828 7:99381681-99381703 GATCTGGAGTGAGCAGGAGGTGG + Intronic
1030059971 7:105614342-105614364 TGTCTGCAAGGAAGAGGAGGAGG + Exonic
1030136644 7:106258054-106258076 AGTCTGCAGGGAGAAGGGGGAGG - Intronic
1030785093 7:113650272-113650294 TATAGTCAAGGAGCAGGAGGGGG - Intergenic
1030789684 7:113708280-113708302 TATCTGCAGAGTGCAGTTGGTGG - Intergenic
1031768092 7:125806446-125806468 CATCTGCAAGGTGCAGGAGTAGG - Intergenic
1031992425 7:128206972-128206994 GCTCTGCAGGGAACTGGAGGCGG + Intergenic
1032151833 7:129435221-129435243 TATCTGGAGGGAGCAGTCGCAGG + Intronic
1032249524 7:130242712-130242734 TGTCTGCTGGGGGCAGGAGGGGG + Intergenic
1032582465 7:133116055-133116077 TATGTGGCAGGAGCAGGAGGAGG - Intergenic
1032736107 7:134694004-134694026 TATCTGATGGGAATAGGAGGTGG - Intergenic
1032750246 7:134832378-134832400 CATGAGCAGGGAGCAGGAGAGGG - Intronic
1033101350 7:138475328-138475350 TATTGGCAGGGGGAAGGAGGTGG + Intronic
1034860610 7:154591892-154591914 AGTCTGAAGGGAGCAGGATGAGG + Intronic
1035745059 8:1955903-1955925 AGTCTGCAGGGAGCAGGAGCTGG - Intronic
1035817472 8:2556916-2556938 TTTCTGGAGGGAGCAGAAAGGGG + Intergenic
1036244214 8:7102803-7102825 TAACTGCTGGGAGAAGAAGGTGG - Intergenic
1036256532 8:7210936-7210958 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1036308582 8:7669521-7669543 TAACTGCTGGGAGAAGAAGGTGG + Intergenic
1036360953 8:8076556-8076578 TAACTGCAGGGAGAAGAAGGTGG - Intergenic
1036407436 8:8467934-8467956 TATCACGAGGCAGCAGGAGGAGG - Intergenic
1036890012 8:12590445-12590467 TAACTGCAGGGAGAAGAAGGTGG + Intergenic
1037418484 8:18676787-18676809 GCTCTGCAGGAAGCAGCAGGGGG - Intronic
1037452282 8:19027553-19027575 ACTTTGCAGGGAGCATGAGGAGG - Intronic
1037903299 8:22700875-22700897 GGTCTTCAGGGAGAAGGAGGAGG + Intergenic
1038993597 8:32896723-32896745 TATCTGCAGGGAGCAAGGGCCGG + Intergenic
1039432260 8:37534135-37534157 TCTCTGCAGAGACCAGCAGGAGG - Intergenic
1041094237 8:54333221-54333243 TGGCTGGAGGGAGCAGGAAGGGG + Intergenic
1041127615 8:54660541-54660563 TATGTGCTGGGGGTAGGAGGGGG + Intergenic
1042865887 8:73356604-73356626 GAGCTGGAGGGAGGAGGAGGGGG - Intergenic
1042893755 8:73642902-73642924 GAACAGCAGGGAGCAGCAGGTGG + Intronic
1043632558 8:82354526-82354548 TACCTGCAGAGGGCAGGAGAAGG - Intergenic
1044351482 8:91171422-91171444 TTTAATCAGGGAGCAGGAGGGGG - Intronic
1044651979 8:94505373-94505395 TATTTGCTGGGAGAAGGAAGAGG - Intronic
1045287314 8:100803520-100803542 TGTCTGCTGGGAGCAGGGGTGGG - Intergenic
1045714578 8:105026422-105026444 TAGCTGCATGGAGCAGGACTTGG - Intronic
1047606730 8:126481977-126481999 TGTTTGCAGGGAGCTGGAGGGGG + Intergenic
1048391715 8:133973175-133973197 TGTGTGCTGGGGGCAGGAGGGGG + Intergenic
1048632319 8:136257451-136257473 TATCTGGATGGGGCAGGATGTGG + Intergenic
1049684664 8:143934473-143934495 TATAGGCAGGGGGCAGGGGGTGG + Intronic
1053282704 9:36831318-36831340 TCTGTGCTGGGTGCAGGAGGAGG - Intergenic
1053319077 9:37079584-37079606 AAGCTCCAGGGAGAAGGAGGCGG + Intergenic
1053326608 9:37158491-37158513 TATCTGGAGGGAACATGAAGGGG + Intronic
1053565390 9:39244404-39244426 TACCTGGGGTGAGCAGGAGGTGG + Intronic
1053831158 9:42082251-42082273 TACCTGGGGTGAGCAGGAGGTGG + Intronic
1054599389 9:67105187-67105209 TACCTGGGGTGAGCAGGAGGTGG - Intergenic
1055551307 9:77434453-77434475 GCTCTCCAGGGAGCAGGTGGAGG - Exonic
1055604818 9:77957651-77957673 TATCTGCAAGCTGAAGGAGGAGG + Intronic
1055708772 9:79036546-79036568 TTTCAGCAGGCAGCAGTAGGTGG + Intergenic
1056962179 9:91135244-91135266 TATTTGCAAGAAGCAGAAGGTGG + Intergenic
1057125237 9:92611351-92611373 GATCCCCATGGAGCAGGAGGAGG - Exonic
1057230885 9:93320687-93320709 TCTCTGCAGGGCCCTGGAGGTGG + Intronic
1057354394 9:94322100-94322122 TCTCAGCATGGAGCATGAGGAGG - Intronic
1057415033 9:94854190-94854212 TATTTTCAGAGAGCAGGTGGTGG + Intronic
1057905363 9:98978446-98978468 TTCCTGCTGGGAACAGGAGGGGG - Intronic
1058798347 9:108519981-108520003 TATCTGCAGAGAGGAGGAACTGG + Intergenic
1060405455 9:123370814-123370836 GATCCTCAGGCAGCAGGAGGTGG - Exonic
1061670539 9:132185814-132185836 TGTGTGCAGGGAGGAGGAGGAGG + Intronic
1061674599 9:132208590-132208612 TAGCTGATGGGAGCAGGCGGTGG + Intronic
1061674652 9:132208894-132208916 GATTTTCAGGGAGCAGGATGGGG - Intronic
1061868893 9:133509712-133509734 GAGCTGCCGGGAGCTGGAGGTGG + Intergenic
1062173121 9:135146304-135146326 CATCTGCAGTGAGGAGGAAGGGG - Intergenic
1062483557 9:136763384-136763406 CATCTACAAGGAGCTGGAGGGGG - Exonic
1185745255 X:2567375-2567397 TCTCTAAAGAGAGCAGGAGGCGG - Intergenic
1186523025 X:10222353-10222375 TATGGGCTGGGAGTAGGAGGCGG + Intronic
1187274271 X:17804784-17804806 TGTGTGCAAGGAGCAGGTGGAGG - Intronic
1188036467 X:25323053-25323075 TATCAGCAGAGAGATGGAGGAGG + Intergenic
1188654137 X:32669437-32669459 TATCTGTAGGGAACTAGAGGTGG - Intronic
1194725109 X:97386709-97386731 TATGTGCAGGGAGGAGTAGTCGG + Intronic
1195129395 X:101839049-101839071 GCTCTGCAGGGAGCAGGAAATGG + Intronic
1195176843 X:102320780-102320802 GCTCTGCAGGGAGCAGGAAATGG - Intronic
1195182021 X:102366313-102366335 GCTCTGCAGGGAGCAGGAAATGG + Intronic
1196018777 X:110967301-110967323 TATCTTCAGTGAGCTGGAGGGGG + Intronic
1197829358 X:130625564-130625586 AATGCGCAAGGAGCAGGAGGAGG - Intronic
1198063916 X:133076788-133076810 TATCTGCAGGGAGCACCTTGAGG - Intronic
1198179282 X:134189549-134189571 CAGCTGCAGGGATAAGGAGGTGG - Intergenic
1198224321 X:134631460-134631482 CTTCTGCAGGGAGCACAAGGAGG + Intronic
1198243128 X:134803717-134803739 TTTGAGCAGGGAGTAGGAGGTGG - Intronic
1198292052 X:135249195-135249217 CATCTGCATGGAGCATCAGGAGG - Intronic
1198306869 X:135392092-135392114 CATCTGCACGGAGCATCAGGAGG - Intergenic
1198837200 X:140817454-140817476 TATCTGGAGGCTGGAGGAGGTGG + Intergenic
1200088864 X:153625211-153625233 TTCCTGCAGGGAGCAGAGGGTGG + Intergenic