ID: 1105040293

View in Genome Browser
Species Human (GRCh38)
Location 12:132956061-132956083
Sequence TTCCGCGCATGCGCCCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 188}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105040281_1105040293 4 Left 1105040281 12:132956034-132956056 CCCCAGAGCCCCCGCCTGAGGCC 0: 1
1: 0
2: 1
3: 41
4: 379
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040276_1105040293 14 Left 1105040276 12:132956024-132956046 CCCCGCGCGCCCCCAGAGCCCCC 0: 1
1: 1
2: 5
3: 57
4: 572
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040284_1105040293 -4 Left 1105040284 12:132956042-132956064 CCCCCGCCTGAGGCCCGCCTTCC 0: 1
1: 0
2: 0
3: 27
4: 270
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040272_1105040293 22 Left 1105040272 12:132956016-132956038 CCTCCCACCCCCGCGCGCCCCCA 0: 1
1: 0
2: 6
3: 162
4: 1678
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040285_1105040293 -5 Left 1105040285 12:132956043-132956065 CCCCGCCTGAGGCCCGCCTTCCG 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040283_1105040293 2 Left 1105040283 12:132956036-132956058 CCAGAGCCCCCGCCTGAGGCCCG 0: 1
1: 0
2: 3
3: 24
4: 317
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040273_1105040293 19 Left 1105040273 12:132956019-132956041 CCCACCCCCGCGCGCCCCCAGAG 0: 1
1: 0
2: 2
3: 35
4: 327
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040287_1105040293 -7 Left 1105040287 12:132956045-132956067 CCGCCTGAGGCCCGCCTTCCGCG 0: 1
1: 1
2: 0
3: 11
4: 132
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040288_1105040293 -10 Left 1105040288 12:132956048-132956070 CCTGAGGCCCGCCTTCCGCGCAT 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040271_1105040293 28 Left 1105040271 12:132956010-132956032 CCTCTGCCTCCCACCCCCGCGCG 0: 1
1: 0
2: 2
3: 64
4: 691
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040278_1105040293 12 Left 1105040278 12:132956026-132956048 CCGCGCGCCCCCAGAGCCCCCGC 0: 1
1: 1
2: 9
3: 65
4: 679
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040280_1105040293 5 Left 1105040280 12:132956033-132956055 CCCCCAGAGCCCCCGCCTGAGGC 0: 1
1: 0
2: 3
3: 31
4: 338
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040270_1105040293 29 Left 1105040270 12:132956009-132956031 CCCTCTGCCTCCCACCCCCGCGC 0: 1
1: 0
2: 6
3: 73
4: 792
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040274_1105040293 18 Left 1105040274 12:132956020-132956042 CCACCCCCGCGCGCCCCCAGAGC 0: 1
1: 2
2: 3
3: 61
4: 555
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040277_1105040293 13 Left 1105040277 12:132956025-132956047 CCCGCGCGCCCCCAGAGCCCCCG 0: 1
1: 2
2: 6
3: 54
4: 416
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040275_1105040293 15 Left 1105040275 12:132956023-132956045 CCCCCGCGCGCCCCCAGAGCCCC 0: 1
1: 1
2: 4
3: 45
4: 613
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040282_1105040293 3 Left 1105040282 12:132956035-132956057 CCCAGAGCCCCCGCCTGAGGCCC 0: 1
1: 0
2: 4
3: 33
4: 319
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188
1105040286_1105040293 -6 Left 1105040286 12:132956044-132956066 CCCGCCTGAGGCCCGCCTTCCGC 0: 1
1: 0
2: 1
3: 22
4: 245
Right 1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG 0: 1
1: 0
2: 2
3: 7
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105040293 Original CRISPR TTCCGCGCATGCGCCCAGGC CGG Intronic