ID: 1105044037

View in Genome Browser
Species Human (GRCh38)
Location 12:132986775-132986797
Sequence CGGGCTGCGGAGAGACCGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105044037_1105044042 -4 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044042 12:132986794-132986816 CCCGCGGGTCCTGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 13
4: 251
1105044037_1105044051 18 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044051 12:132986816-132986838 GCAGCGCGCGAACGTGGGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
1105044037_1105044053 20 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044053 12:132986818-132986840 AGCGCGCGAACGTGGGCGTGGGG 0: 1
1: 0
2: 2
3: 2
4: 41
1105044037_1105044050 13 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1105044037_1105044049 12 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044049 12:132986810-132986832 CCGCAGGCAGCGCGCGAACGTGG 0: 1
1: 0
2: 0
3: 6
4: 37
1105044037_1105044054 24 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044054 12:132986822-132986844 CGCGAACGTGGGCGTGGGGATGG 0: 1
1: 0
2: 4
3: 5
4: 98
1105044037_1105044052 19 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105044037 Original CRISPR CGGGCTGCGGAGAGACCGTG AGG (reversed) Exonic
900487259 1:2929073-2929095 CGGGCTCCGGAGAGGCCGACGGG + Intergenic
900489243 1:2938687-2938709 GGGGCTGCGGAGAGGCCTTATGG + Intergenic
901799861 1:11701729-11701751 CGGGCTGCGGGGAGGCGGAGGGG + Intronic
906325491 1:44843054-44843076 CGGGCGTGGGAGAGACTGTGGGG + Exonic
907250225 1:53133151-53133173 ATGGCTGTGGAGAGGCCGTGTGG + Intronic
907837657 1:58126311-58126333 CGGGCTGCGGAGAGCCCTGGGGG - Intronic
907962430 1:59296424-59296446 GGGGCTGCGGAGAGTCCGCCTGG + Intergenic
911450471 1:98054366-98054388 CGGGCTGGGCAGAGCCCGCGGGG - Intergenic
914875584 1:151511180-151511202 CGGGCTGCGGAGCGTCGGGGCGG - Intronic
922036292 1:221851806-221851828 CTGGCTGGGGAGAGAAAGTGAGG - Intergenic
922542391 1:226429191-226429213 GGAGCTGGGGAGAGAGCGTGGGG + Intergenic
923252976 1:232194133-232194155 CGGGCTAAGGAGAGACTCTGTGG + Intergenic
1062809894 10:455313-455335 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809902 10:455368-455390 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809910 10:455425-455447 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809918 10:455482-455504 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809944 10:455653-455675 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809952 10:455710-455732 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1065021977 10:21508930-21508952 AGGGCTGCGGAGAGGCGGAGGGG - Intergenic
1065115236 10:22477513-22477535 TGGGCTGCGGTGAAACCGTTAGG - Intergenic
1073491413 10:103855536-103855558 CGGGCGGCGGAGAGAGCGAGCGG - Intronic
1074865673 10:117543198-117543220 CGGGCGGCGGAGGCAGCGTGCGG + Exonic
1077136351 11:1001253-1001275 AGGGCTGGGGAGAGCACGTGCGG - Intronic
1077899908 11:6479823-6479845 TGGGCTGAGGAGAGTCCATGAGG + Intronic
1079452629 11:20610332-20610354 GGGGCTGCGGAGCGAGCGAGCGG + Intronic
1091714204 12:2765492-2765514 GAGCCTGCAGAGAGACCGTGGGG + Intergenic
1092843098 12:12562021-12562043 CGCGCTGCGGAGCGTCCATGCGG + Intronic
1097901180 12:64875250-64875272 CGGGCTGTGGGGACACCGTAGGG + Exonic
1101365178 12:104064401-104064423 CGGGCAGTGGAGAGACGCTGGGG - Intergenic
1104928804 12:132327819-132327841 TGGGCTGCAGACAGGCCGTGGGG - Intronic
1105044037 12:132986775-132986797 CGGGCTGCGGAGAGACCGTGAGG - Exonic
1105969353 13:25413964-25413986 AGGGCAGCGGAGTGAGCGTGAGG + Intronic
1106157468 13:27171705-27171727 CGGGCTGCGGTGCGAGCGGGCGG - Exonic
1106907392 13:34423114-34423136 TGGGCTGAGGAGAGGCCGTGAGG - Intergenic
1108541971 13:51453307-51453329 CGGACTGCGGAAGGACCGCGAGG + Intronic
1113368126 13:109697046-109697068 CAGGCTATGGAGAGACTGTGAGG + Intergenic
1113881480 13:113629125-113629147 AGTGCTGCGGAGACACAGTGAGG + Intronic
1122037603 14:98960224-98960246 CGGGCTGCAGGCAGACCCTGGGG - Intergenic
1123787381 15:23687055-23687077 CGGCCTGCGGAGCGGCCGTCGGG + Exonic
1124922201 15:34038544-34038566 CGGGCTGGCGCGAGACAGTGGGG - Intronic
1126467709 15:48975974-48975996 CGGGCGGCGGGGAGAGCGTCTGG + Intergenic
1128841706 15:70855614-70855636 AGGGCTGGGGAGAGACCCAGGGG + Intronic
1138415691 16:56870201-56870223 TGGGCTTTGCAGAGACCGTGCGG + Exonic
1141316262 16:82965253-82965275 CAGGCTTTGGAGAGATCGTGTGG - Intronic
1141599076 16:85114366-85114388 GGGGCTCTGGAGAGACCCTGTGG - Intergenic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1143539649 17:7561617-7561639 CGGGCTGAGGCGAGGCAGTGGGG - Intergenic
1143706067 17:8698431-8698453 CGGGCTGAGGAGAGAAAGCGGGG + Intergenic
1148123880 17:45227113-45227135 CGGGCTGAGGAAAGCCTGTGGGG + Intronic
1151354666 17:73551261-73551283 CGGGCTGGGGTGGGAGCGTGTGG - Intronic
1152754586 17:82081923-82081945 AGGGCTGCGGGGAGAAGGTGGGG + Intronic
1153226794 18:2906309-2906331 AGGGCTGCGCGGAGGCCGTGAGG - Intronic
1158630696 18:59111757-59111779 TGGGCTGCAGAGAGCCCCTGTGG + Intergenic
1160443986 18:78913319-78913341 AGGGCGGAGGAGAGACTGTGGGG - Intergenic
1160819614 19:1051982-1052004 AGAGCTGCTGGGAGACCGTGTGG + Exonic
1160871067 19:1278286-1278308 CGGGCTGCGCAGATGCCGGGCGG + Intronic
1165242803 19:34481546-34481568 CGGGCGGCGGAGGCACCGCGGGG - Intergenic
1165940729 19:39413579-39413601 CGGGGTTCGGAGAGACCGGCCGG + Intronic
1167505246 19:49867653-49867675 AGGGCTGCCGAGAGACCCTGGGG - Intronic
1167894890 19:52572741-52572763 AGGGCTGTGGAGTGACAGTGAGG - Intronic
929934435 2:46284347-46284369 CAGGCTGTGGAGAGTCAGTGGGG + Intergenic
932591616 2:73071093-73071115 AGGGCTGGGGAGTGACCGCGGGG + Intronic
932722407 2:74147759-74147781 GGAGCTGCGGAGGGACCGCGGGG - Intronic
932750916 2:74371191-74371213 TGGGCTGTGCACAGACCGTGAGG - Intronic
934650082 2:96085648-96085670 GGGGCTGCTGAGAGGCCCTGGGG + Intergenic
934815962 2:97326763-97326785 GGGGCTGTGAAAAGACCGTGGGG - Intergenic
934821734 2:97381721-97381743 GGGGCTGTGAAAAGACCGTGGGG + Intergenic
934891138 2:98070297-98070319 CTGGCTGTGGAGATGCCGTGAGG + Intergenic
938081534 2:128372962-128372984 AGGGCTGCGGTGGGACCCTGCGG + Intergenic
938414545 2:131093398-131093420 CGGGCTGCGGAGAGGCGGGCCGG - Exonic
940420789 2:153477860-153477882 CGGGCAGGGGAGAGACCCAGCGG - Exonic
940446753 2:153785848-153785870 CAGGCTCCGGAGAGTCCTTGGGG + Intergenic
942448356 2:176092920-176092942 CGGGCTGCGGGCAGACGGCGGGG + Exonic
943223117 2:185135206-185135228 AGGGCTGCAGAGAGAGGGTGAGG - Intergenic
945251432 2:207768949-207768971 AGGGCTGGGGAGAGACGGTTAGG + Exonic
947877301 2:233476253-233476275 GGGGCTGACGAGAAACCGTGAGG + Exonic
948700947 2:239759573-239759595 AGGGCTGTGGAGAGTCAGTGCGG - Intergenic
1172389867 20:34559182-34559204 CGGACAGCGGCCAGACCGTGAGG - Intronic
1172702868 20:36863501-36863523 AGAGCAGCGGAGAGACCGCGCGG - Exonic
1174302122 20:49589981-49590003 CTGGCTGTGGGGAGACCATGGGG - Intergenic
1179720967 21:43315835-43315857 CAGGCTGCCCAGAGACTGTGGGG + Intergenic
1180007200 21:45028233-45028255 CGTCCTGCGGAGGGACCGTCTGG + Intergenic
1184199804 22:42960439-42960461 CGTGCTGCTGAGAGACCATGGGG - Intronic
1184421650 22:44385793-44385815 CTGGCTGCAGGGAGACCGAGAGG - Intergenic
1185066263 22:48633101-48633123 CGGGCTGCTGGGAGACCCTGTGG - Intronic
961443108 3:126964535-126964557 CAGGCTGGGAAGAGCCCGTGAGG - Intergenic
970195007 4:13544146-13544168 CGGACTGCGGAGAGCCCGGAAGG - Exonic
978530080 4:109703584-109703606 CGGGCTCCGGAGCGACTGGGAGG - Intergenic
986813096 5:11380981-11381003 TGGGCTGCAGAGGGACCGGGTGG - Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002616835 5:180461356-180461378 CAGGCTGGAGAGAGGCCGTGGGG + Intergenic
1003126987 6:3363431-3363453 CAGGCTGAGGAGAGGCTGTGAGG + Intronic
1003179482 6:3779829-3779851 GGGGCTGGGGAGAGGCCGGGTGG + Intergenic
1007264684 6:40587568-40587590 CGGGCTGCGGAGACAGCGCAGGG + Intergenic
1010794868 6:80106907-80106929 CGGGCTGCAGCGGGACCGAGTGG - Intronic
1014104641 6:117548127-117548149 CGCTCTGCGCAGAGAACGTGTGG - Intronic
1019504309 7:1383197-1383219 AGGGCTGGGCACAGACCGTGGGG + Intergenic
1019565542 7:1677031-1677053 CTGGCAGCGGAGAGACAGAGAGG + Intergenic
1020106659 7:5425243-5425265 GGGGCTGCAGAGAGAGGGTGCGG - Intronic
1024219561 7:47277337-47277359 TGGGCTGGGGAGAGCCTGTGAGG - Exonic
1026828402 7:73597390-73597412 TGGGCTGGGGACAGACTGTGGGG + Exonic
1037748722 8:21666238-21666260 CGGGCTGTGCTGAGACCTTGCGG + Intergenic
1037947747 8:22999778-22999800 CGGGCTGCGGAGGCAGCGGGCGG - Intronic
1038544132 8:28412376-28412398 CGGGCCCCGGAGAGGCCGTGGGG - Intronic
1044182907 8:89218039-89218061 TGGGCTGAGGAGAGACCAGGAGG + Intergenic
1046953090 8:120036466-120036488 CTGGCTGTGGAGTGACTGTGTGG - Intronic
1057208025 9:93184801-93184823 CCGGCCGCGGAGAGAGCCTGCGG - Intergenic
1057936896 9:99247860-99247882 AGGGCTGGGGAGAGACAGTGTGG - Intergenic
1060529831 9:124341670-124341692 TGGGCTGTGGAGAGACAGGGAGG - Intronic
1060536133 9:124389592-124389614 CGGGCTGTGGAGAGACAGGGAGG + Intronic
1061579996 9:131530847-131530869 CGGCCGGCGGAGAGGCTGTGGGG + Intronic
1187051799 X:15703166-15703188 CAGGCTGCGGACAGGCTGTGGGG - Intronic
1198369111 X:135974050-135974072 GGGCCTGCGTAGAGAACGTGTGG + Exonic
1200704357 Y:6428930-6428952 CAGGCTGAAGAGAGACAGTGAGG - Intergenic
1200771346 Y:7128308-7128330 CAGGCTGCAGAGAGGCCTTGGGG - Intergenic
1201029754 Y:9735778-9735800 CAGGCTGAAGAGAGACAGTGAGG + Intergenic