ID: 1105044040

View in Genome Browser
Species Human (GRCh38)
Location 12:132986788-132986810
Sequence GGGGCAGGACCCGCGGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 420}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105044040_1105044049 -1 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044049 12:132986810-132986832 CCGCAGGCAGCGCGCGAACGTGG 0: 1
1: 0
2: 0
3: 6
4: 37
1105044040_1105044051 5 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044051 12:132986816-132986838 GCAGCGCGCGAACGTGGGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
1105044040_1105044052 6 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044040_1105044055 25 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044055 12:132986836-132986858 TGGGGATGGCCACCAGTTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 123
1105044040_1105044053 7 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044053 12:132986818-132986840 AGCGCGCGAACGTGGGCGTGGGG 0: 1
1: 0
2: 2
3: 2
4: 41
1105044040_1105044054 11 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044054 12:132986822-132986844 CGCGAACGTGGGCGTGGGGATGG 0: 1
1: 0
2: 4
3: 5
4: 98
1105044040_1105044050 0 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105044040 Original CRISPR GGGGCAGGACCCGCGGGCTG CGG (reversed) Exonic
900137882 1:1126116-1126138 AGGGCAGGGGCCGCGGGGTGGGG + Intergenic
900322685 1:2092940-2092962 GAGGCAGGGCCCGAGGCCTGGGG - Intronic
900386365 1:2412750-2412772 GGGGCGGGGCCCGCGAGCCGAGG + Intronic
900511346 1:3062574-3062596 GGGGAAGGACCCGAGGGGAGTGG - Intergenic
901251582 1:7783898-7783920 GGGGCGGGACCCGGGCTCTGTGG - Intergenic
901924073 1:12554835-12554857 AGGGCAGGACTTGCAGGCTGGGG + Intergenic
902362232 1:15948191-15948213 GGGGCAGCACCTGCAGGCTGTGG - Intronic
903263316 1:22142786-22142808 GGGGCAGGCCCCGGGGGCAGCGG - Intronic
903281042 1:22250208-22250230 GGAGGAGGAGCCGGGGGCTGTGG + Intergenic
903848140 1:26290610-26290632 GGGGCAAGTCACGCAGGCTGCGG + Intronic
904006649 1:27366528-27366550 CTGGCAGGACCCGCTGGCCGTGG - Exonic
904026115 1:27504731-27504753 GGGGCAGGCCTGGCCGGCTGAGG + Intergenic
904785208 1:32977512-32977534 TGGGCAGGACCCGAGGGTTCTGG + Intergenic
905107612 1:35573761-35573783 GGCGCAGGAGCCTCAGGCTGGGG - Intronic
905171859 1:36114431-36114453 GGGGGAGGAGCCCAGGGCTGTGG - Intronic
905885348 1:41488706-41488728 GGAGCCGGCCCCGCAGGCTGAGG - Intergenic
906640831 1:47439405-47439427 GGGGCAGCACCCCCGGGCGCCGG + Exonic
912624654 1:111197237-111197259 GGGCCAGGGCCGGCAGGCTGGGG + Exonic
913962988 1:143353787-143353809 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
914057343 1:144179372-144179394 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
914121803 1:144786994-144787016 GGGGCCGGGCGCGCGGGCGGAGG - Intergenic
915326459 1:155083434-155083456 TGGGCAGGAGCCTCGGCCTGCGG - Intronic
915354540 1:155248171-155248193 GGTGCAGGGCCCGAGGGCAGGGG + Exonic
916663800 1:166947654-166947676 GGGGGAGGAAACGGGGGCTGGGG - Intronic
916890065 1:169105970-169105992 GGGCCAGGACTGCCGGGCTGGGG + Intronic
917364761 1:174218044-174218066 GGGGCAGGACAAGCAGGCTAGGG - Intronic
919023313 1:192136326-192136348 GGTGCATGACCCGGGGACTGGGG + Intergenic
919752821 1:201048772-201048794 GGGACGGGACACGAGGGCTGGGG + Intronic
923299699 1:232630008-232630030 CGGCCCGGACCCGCTGGCTGCGG + Intergenic
923650189 1:235866707-235866729 GGGCCGGGACCGCCGGGCTGAGG - Intronic
1064628136 10:17282519-17282541 GGGGCAGGTCCAGCGCCCTGCGG + Intergenic
1065099560 10:22320733-22320755 CCGGCCGGCCCCGCGGGCTGCGG - Intronic
1065844912 10:29736199-29736221 GCGGCTGGACCCGCTGGCCGTGG - Intronic
1065883711 10:30059170-30059192 GGGGCGGGCACCGCGGGCCGCGG - Intronic
1067037945 10:42933228-42933250 CGGGCAGGGCCAGCGCGCTGCGG + Intergenic
1068828891 10:61470158-61470180 GGAGAAGGACCAGAGGGCTGAGG + Intergenic
1070126417 10:73625795-73625817 GGGGCAGGACCTGGGTCCTGTGG - Intronic
1071813310 10:89206947-89206969 GGGGCAGGAGGGCCGGGCTGCGG + Exonic
1073099430 10:100999215-100999237 GGGGCAGGGCCCGCGTGTTGGGG + Intronic
1073123908 10:101137903-101137925 GGGGCAGGACCCTAAGGCTCTGG + Intergenic
1073578160 10:104641828-104641850 GGTGAAGGCGCCGCGGGCTGGGG + Exonic
1074687224 10:115972134-115972156 TGGACAGGAACCGCAGGCTGTGG + Intergenic
1075924872 10:126243200-126243222 GGGGCAGGATCCTCAGGCTAAGG - Intronic
1076149291 10:128149908-128149930 CGGGCAGGGGGCGCGGGCTGGGG - Intergenic
1076605719 10:131688907-131688929 GAGGCACGACCCGCAGGATGTGG - Intergenic
1076762996 10:132614957-132614979 GGCGTAGGCCCCGCAGGCTGCGG + Intronic
1076875348 10:133213143-133213165 GGGCCAGGCCCAGCGGGCAGTGG - Intronic
1076899878 10:133333300-133333322 GGGGAAGGATCCGAGGGGTGAGG + Intronic
1077006000 11:356312-356334 GGGGCGGGACGCGCTGGGTGCGG - Intergenic
1077024637 11:433736-433758 GGGGCAGGGCCATGGGGCTGGGG - Intronic
1077217786 11:1402227-1402249 GGGGCAGGCACAGCAGGCTGTGG + Intronic
1077281886 11:1749582-1749604 AGGGCAGGACCCAGGGGCGGGGG - Intronic
1077413645 11:2414675-2414697 GGGGCCGGGCCCGCGCGCGGGGG - Intronic
1077539847 11:3141383-3141405 GGGGCTGGACCTGCCTGCTGGGG - Intronic
1078093758 11:8283916-8283938 GGGCCGGGCCCCGGGGGCTGTGG - Intergenic
1078474669 11:11620714-11620736 GGTCCTGGACCCGCGGGCTGTGG + Intronic
1080037290 11:27722627-27722649 GGGGCAGCCCCCGCAGGATGAGG - Intergenic
1081703717 11:45168216-45168238 GGGGCAGGAGCTGTGGGCCGTGG + Intronic
1083039092 11:59668966-59668988 GGTGGAGGACCCGCGCGCGGAGG - Exonic
1083248153 11:61446174-61446196 GAGGCAGGACCAGTGGTCTGGGG - Exonic
1083317843 11:61827629-61827651 GCGGGTGGACCGGCGGGCTGCGG - Intronic
1083329618 11:61891475-61891497 GGGGCCGGAGCAGCGGGCGGCGG - Exonic
1083763263 11:64830135-64830157 GGGGCAGCCCCAGCGGGCAGAGG - Intronic
1083920509 11:65779682-65779704 GGCGCGGGAGCTGCGGGCTGCGG - Exonic
1084062712 11:66686658-66686680 GGAGCAGGAGGCCCGGGCTGGGG - Intronic
1084068831 11:66720794-66720816 GGGACATGACCCGGGGGCTGAGG + Intronic
1084172454 11:67407039-67407061 GGGGCAGGAGCCTTGGGGTGTGG + Intronic
1084178177 11:67434114-67434136 GGGGCAGGGCCCCAGGGCAGAGG + Intronic
1084371801 11:68750243-68750265 GGGGCAACACCGCCGGGCTGCGG + Exonic
1084425290 11:69080977-69080999 GGGGCAGGAACCAGGGGATGGGG + Intronic
1084721276 11:70907103-70907125 GGGCCAGGACCCCCGGCCAGAGG + Intronic
1085530547 11:77189729-77189751 GGGGCAGGCCCTGGGCGCTGGGG + Intronic
1085688870 11:78649670-78649692 TGGGCAGGACGTGGGGGCTGGGG + Intergenic
1087027282 11:93661920-93661942 CGGGCAGGGCCCACGGCCTGCGG - Intronic
1088522230 11:110712304-110712326 GGGCGAGGACGCGCGGGCGGAGG + Exonic
1089067174 11:115670751-115670773 GGGGCAGGGTCCGCGAGCAGCGG - Intergenic
1089300854 11:117497861-117497883 GGGGCAGCACTCAAGGGCTGAGG - Intronic
1089448364 11:118572330-118572352 GGGGCGGGGCCTGTGGGCTGGGG - Intronic
1089838719 11:121394905-121394927 GGGCCAGGACCAGCTGCCTGGGG - Intergenic
1089896519 11:121935641-121935663 GGGGCAGCACCAAGGGGCTGGGG + Intergenic
1091448731 12:559755-559777 GGCGCACTACCCTCGGGCTGGGG - Intronic
1092218920 12:6700164-6700186 GGGGCAGGAGCCTCGGGGTGCGG + Exonic
1092279972 12:7091426-7091448 GGGGCAGGATGGGCGGGCAGAGG - Intronic
1095825510 12:46526422-46526444 GGGGTAGGGCCAGCGGGGTGGGG - Intergenic
1096079152 12:48822459-48822481 GGAGCAGGACCCCGGGGATGTGG - Intronic
1096588839 12:52643941-52643963 GCGACAGGCCCCGGGGGCTGCGG + Intergenic
1096668218 12:53181010-53181032 GCGGCGGGACGCGCGGGCAGGGG - Intronic
1099973813 12:89525822-89525844 GGAGCCTGTCCCGCGGGCTGCGG - Intronic
1099989707 12:89709085-89709107 GGGGCGGGGCCCGCGGGCACCGG + Intronic
1100264078 12:92959125-92959147 GGGTCAGGGCCCAGGGGCTGTGG + Intergenic
1101877110 12:108603316-108603338 GGGGCTGGAGCTGGGGGCTGTGG - Intergenic
1103506212 12:121443594-121443616 GGTGGAGGACCAGCGGGGTGGGG + Intronic
1103536776 12:121638847-121638869 GGGCCAGGAGCAGCGGGCAGTGG - Intronic
1104963970 12:132500863-132500885 GGGGCAGGGGCCAAGGGCTGTGG - Intronic
1105031482 12:132887404-132887426 GGGCCGGGGCCCGCGGGGTGGGG - Intronic
1105044040 12:132986788-132986810 GGGGCAGGACCCGCGGGCTGCGG - Exonic
1105330627 13:19412273-19412295 AGAGCAGAACCCTCGGGCTGAGG + Intergenic
1105918700 13:24941048-24941070 AGAGCAGGACCCTTGGGCTGAGG + Intergenic
1113346699 13:109485315-109485337 GGGGCAGGGGCGGCGGGCGGGGG - Intergenic
1113785931 13:113002098-113002120 GGGGCAGAAGCCCGGGGCTGGGG + Intronic
1113922501 13:113921141-113921163 GGGGTAGGGCCTGGGGGCTGTGG + Intergenic
1114415299 14:22538890-22538912 GGGGCGGGAGCCAGGGGCTGGGG - Intergenic
1118615566 14:67572399-67572421 GGGGCAGGGGGCGTGGGCTGGGG + Intronic
1119219367 14:72893594-72893616 GGGGCGGGGGCCGCGGGCTCGGG + Intronic
1119668103 14:76499075-76499097 GGGGTAGGCCCCGAGGGGTGGGG - Intronic
1122537057 14:102472840-102472862 GGGGCAGCACCTGGGAGCTGGGG - Intronic
1122691972 14:103535793-103535815 AGGGCAGGACGCCCAGGCTGGGG + Exonic
1122781385 14:104145304-104145326 TAGGCAGGACCCGTGGGCTGGGG + Intronic
1122796781 14:104210074-104210096 GAGGCAGGGCCAGTGGGCTGTGG + Intergenic
1122822655 14:104354999-104355021 GGGGCAGGGGCTGGGGGCTGGGG + Intergenic
1122905064 14:104797802-104797824 GGGGCAGGACTCGAGGGCCCTGG + Intergenic
1124606817 15:31175671-31175693 GAGGCAGGGCTCGCTGGCTGGGG - Intergenic
1125621754 15:41069239-41069261 GGGGCAGGGCCAGGGGGGTGAGG - Intronic
1126108995 15:45164903-45164925 TGGGCAGAACCCCCGGGCAGGGG - Exonic
1128635264 15:69298845-69298867 GGGGGAGGAGCCGAGGGCCGTGG - Intergenic
1128878709 15:71223753-71223775 GGGGGATGAGCCGAGGGCTGTGG + Intronic
1129790936 15:78340260-78340282 GGGGCAGGGCCGGCGGGGCGGGG + Intergenic
1129848439 15:78778652-78778674 GAGGCAGGACCCGCGGGACCTGG + Intronic
1130040910 15:80404576-80404598 CGGGCAAGGCCTGCGGGCTGCGG - Intronic
1131117782 15:89805265-89805287 GGGGCAGGCACCCTGGGCTGGGG - Intronic
1131119843 15:89815087-89815109 CCGGCGGGTCCCGCGGGCTGCGG - Intronic
1131199989 15:90388193-90388215 GGGGCGGGGCCTGCGGGGTGGGG + Intergenic
1131837987 15:96409422-96409444 GGGGCAGGGCCGGGGAGCTGGGG + Intergenic
1132604612 16:788482-788504 AGGACAGGACGCGGGGGCTGCGG + Intergenic
1132650586 16:1019810-1019832 GGGAAAGGGCCCGTGGGCTGGGG - Intergenic
1132744907 16:1432541-1432563 GGGGCAGCAGGCGCTGGCTGGGG - Intergenic
1132884891 16:2178332-2178354 TGGGGAGGACCCGCGGGCGCAGG + Exonic
1132888106 16:2191236-2191258 GGGGCAGGAGCTGAGGGCAGGGG + Intronic
1132929401 16:2451228-2451250 GGGGCAGGTGGCGCGGGCGGGGG + Intronic
1134134207 16:11668715-11668737 GGGGCCGCGCCCGCGGGCTGGGG + Intronic
1135401764 16:22170973-22170995 TGGGCAGGACCCGCGGGCCCGGG + Intronic
1136188890 16:28603916-28603938 GGGGCAGGAGCCGTGGGTTCAGG - Intergenic
1136845711 16:33574057-33574079 GGAACAGGACCCTCGGGCTTAGG + Intergenic
1138105102 16:54283914-54283936 GCGTCAGGACCCGAGGTCTGGGG + Intronic
1138475820 16:57270244-57270266 GGGGATGGACTCGGGGGCTGGGG - Intronic
1138475855 16:57270339-57270361 GGGGAAGGACTCGGGGGCTGTGG - Intronic
1139545952 16:67649635-67649657 GGGGTGGGACCAGCGGGCAGGGG + Intronic
1139935626 16:70568901-70568923 GGTGCAGGACACGTGGGCTCAGG + Intronic
1141167805 16:81671990-81672012 TGGGCAGGACCCGGGGGTGGGGG - Exonic
1141633895 16:85303683-85303705 CGGGCAGGAGCCGGGCGCTGGGG + Intergenic
1141989640 16:87602665-87602687 GCGGCGGGGCCCGCGGGCGGCGG - Intronic
1142048132 16:87939166-87939188 GCAGCAGTACCCGTGGGCTGGGG + Intergenic
1142060688 16:88027355-88027377 GGGGCCGGCCTGGCGGGCTGGGG + Intronic
1142080025 16:88144040-88144062 GAGGCAGAACCCGCCTGCTGGGG + Intergenic
1142136320 16:88453481-88453503 GGGGCTGGGCGCGCGGGCTGGGG + Exonic
1142173284 16:88633917-88633939 GGGGGAGGAGCTGCGGGCAGAGG - Intergenic
1142177204 16:88650784-88650806 GGGGCGGGACCCTCAGGCCGCGG - Intronic
1142225870 16:88877402-88877424 GGAGCATGGCCCGAGGGCTGTGG - Intronic
1203107419 16_KI270728v1_random:1422710-1422732 GGAACAGGACCCTCGGGCTTAGG + Intergenic
1142474566 17:181344-181366 GGGGCAGGCCCCGCGGGAAGCGG + Exonic
1142627784 17:1203387-1203409 GGGGCGGGGCCCGCGGGGGGCGG + Intronic
1142978560 17:3658951-3658973 GGGTCAGGTCCCGGGAGCTGGGG + Intronic
1143174612 17:4948953-4948975 AGGGAAGGACCGGCGGGCGGCGG + Exonic
1143202691 17:5123173-5123195 GGGGCAGGTCCCGCGGGAAGTGG + Intronic
1143608243 17:8003128-8003150 GGGGCAGGGCCCGGGGGAGGCGG - Exonic
1143651972 17:8268876-8268898 GGGGGAGGGCCCGAGGGTTGGGG + Intronic
1143719415 17:8799292-8799314 ACGGCAGGACCTGGGGGCTGTGG - Exonic
1144345561 17:14346157-14346179 GGGACAGAACCCTAGGGCTGTGG - Exonic
1144784679 17:17824955-17824977 GAGGGAACACCCGCGGGCTGAGG - Intronic
1145004385 17:19329153-19329175 AGGACAGGACCCACAGGCTGTGG - Intronic
1145093903 17:20008824-20008846 GGGGCGGGCCCCGCAGGATGAGG + Intergenic
1146064195 17:29622372-29622394 GGGGCAGGAGCCACTGGCTGGGG - Intronic
1146912258 17:36656466-36656488 GGGGCAGGACCCTGGAGCTTTGG + Intergenic
1147006375 17:37407048-37407070 GGGGGAGGAGTCGCGGGCTGCGG + Intronic
1147836694 17:43337909-43337931 TGAGCAGGATCAGCGGGCTGTGG + Intergenic
1148652493 17:49260145-49260167 GGGACAGGTCCCGGGGGCGGGGG - Intergenic
1148664064 17:49361818-49361840 CGGGCCGGCCCCGCGGGCGGCGG + Intronic
1148797389 17:50203541-50203563 AGGGCAGGACTAGGGGGCTGAGG + Intergenic
1149849309 17:60025971-60025993 GGGGCAGGTCCCGCGGGAAGTGG - Intergenic
1149860859 17:60120553-60120575 GGGGCAGGTCCCGCGGGAAGTGG + Intergenic
1150267775 17:63842309-63842331 GGGCCGGGACCCTCGGGCTGCGG - Intronic
1151479098 17:74359908-74359930 GGTGGAGGAGCCGGGGGCTGAGG + Intronic
1151768979 17:76147287-76147309 GGGGCAGGACTCCGGAGCTGCGG + Intronic
1152128797 17:78463733-78463755 TGGGCAGGCCCAGAGGGCTGGGG - Intronic
1152190266 17:78883817-78883839 GGGGCAGGGCCCTGGGGTTGGGG - Intronic
1152299804 17:79488552-79488574 GGAGCAGGACCCGCAGGCCTGGG + Intronic
1152392345 17:80010323-80010345 GGGGCGGGAGCCGCGGCCCGAGG - Exonic
1152697354 17:81803849-81803871 GGGCCAGGGTCCGCGGGCTCAGG + Intergenic
1152699482 17:81811972-81811994 GGGGAGGGACCGGGGGGCTGGGG + Intronic
1152748290 17:82051253-82051275 GGGGCAGATCCCGCGGGCGCCGG + Intronic
1152863320 17:82708863-82708885 GGGGCAGGGCACGGGGGCAGTGG - Intergenic
1152863337 17:82708903-82708925 GGGGCAGGGCACGGGGGCAGTGG - Intergenic
1152863354 17:82708943-82708965 GGGGCAGGGCACGGGGGCAGTGG - Intergenic
1152863387 17:82709023-82709045 GGGGCAGGGCACGGGGGCAGTGG - Intergenic
1153834201 18:8949580-8949602 ATGGCAGGACCTGCGCGCTGGGG + Intergenic
1154502683 18:15004506-15004528 GGGACAGGGCCCGCGGGCGGCGG + Intergenic
1157528959 18:48406153-48406175 GCGGAAGGACCAGCTGGCTGAGG - Intronic
1157583444 18:48786796-48786818 GAGGAAGGACCCCTGGGCTGGGG - Intronic
1157706773 18:49813882-49813904 TGGGCAGGAGCCAAGGGCTGAGG + Exonic
1157867139 18:51197065-51197087 GGGCCAGGCCCGGCGGGCGGCGG - Exonic
1158323146 18:56285322-56285344 GCCTCAGGACCTGCGGGCTGGGG - Intergenic
1159100105 18:63949216-63949238 GGGGCGGGTCCCGCAGGCCGCGG - Intergenic
1159910106 18:74138027-74138049 GAGGCAGGAACCGGAGGCTGAGG - Intronic
1160395826 18:78571958-78571980 GCGGCAGGACCCGTGGGTGGTGG + Intergenic
1160395845 18:78572015-78572037 GTGGCAGGACCCGTGGGTGGTGG + Intergenic
1160678096 19:401065-401087 GGTGCAGGTGCCGTGGGCTGGGG + Intergenic
1160858971 19:1229697-1229719 GGGGCCAGGCGCGCGGGCTGCGG + Exonic
1160863794 19:1248672-1248694 GGGGGGGGACCTGCGGGCCGAGG + Intronic
1161297250 19:3526317-3526339 GGTGCAGGACCCGCAGACTGAGG + Exonic
1161594472 19:5144177-5144199 GGGGCGGGAGCCAGGGGCTGGGG - Intronic
1161793433 19:6373810-6373832 GGGGCGGGACCTGGGGGATGAGG + Intronic
1161962485 19:7530225-7530247 TGGCCAGGAACCGGGGGCTGGGG - Intronic
1161979887 19:7624868-7624890 GGTGGAGGACAGGCGGGCTGGGG - Intronic
1161982419 19:7637050-7637072 GGGACAGGGCCCGCGGGGCGGGG + Intronic
1162932515 19:13964047-13964069 GGGCCAGGGCTGGCGGGCTGGGG - Intronic
1163028635 19:14529143-14529165 GGGGCTGGGGTCGCGGGCTGCGG - Intronic
1163034971 19:14564896-14564918 AGGGGAGGACCCGCTGGGTGGGG - Intronic
1163427173 19:17245970-17245992 GGGGCGCGCGCCGCGGGCTGGGG + Intronic
1163712490 19:18855050-18855072 GGGCGAGGCCCCGCGCGCTGAGG - Intronic
1164137657 19:22428396-22428418 GGGGAGGGACCAGCGGGCGGAGG - Intronic
1164160545 19:22623280-22623302 GGGGAGGGACCAGCGGGCGGTGG + Intergenic
1165092220 19:33393258-33393280 GGGGGAGGGCCCGGGGTCTGGGG + Intronic
1165461431 19:35946197-35946219 GGTGCAGGACCCCTGGTCTGAGG + Intergenic
1165829719 19:38724366-38724388 GGGGCAGGACGGCGGGGCTGGGG + Intronic
1166039255 19:40192009-40192031 GGGGGAGGGGCCGGGGGCTGCGG - Exonic
1166042960 19:40214197-40214219 GGGCCATGGCCCGCGGGCTCGGG - Exonic
1166215369 19:41331201-41331223 GGGCCAGGACCTGCGGGCGGCGG + Exonic
1166367208 19:42283925-42283947 GGGGCCTGACCCGCGCGCGGCGG + Intronic
1166733604 19:45071874-45071896 GGGGCAAGAGCCGCGGGCCCGGG - Exonic
1166836658 19:45671345-45671367 GGGGCAGGACGCACGGGCAGTGG - Exonic
1166871318 19:45872756-45872778 GGGGCTGGAGGCGGGGGCTGGGG - Exonic
1166885895 19:45960835-45960857 CGGCCAGGCCCCTCGGGCTGGGG + Intronic
1167040308 19:47019864-47019886 GCAGCGGGACGCGCGGGCTGTGG - Exonic
1167698252 19:51027274-51027296 GGGGCAGGACCGGAGGGTGGGGG + Intronic
1167775211 19:51550155-51550177 GGTGCAGGATCCTGGGGCTGAGG - Intergenic
1167780316 19:51594660-51594682 GGGCCAGGACCGGCCGGCCGCGG - Intergenic
1168272643 19:55258494-55258516 GGGGCCGGAGCCGCCGGCGGCGG - Exonic
1168315587 19:55483464-55483486 AAGGCAGGGCCCGCGGGCAGTGG + Exonic
1168404074 19:56101877-56101899 GGGGCAGCCCTCGAGGGCTGTGG + Intronic
1202696827 1_KI270712v1_random:132045-132067 GGGGCCGGGCGCGCGGGCAGAGG + Intergenic
925141070 2:1550214-1550236 TGAGCTGGACCCGTGGGCTGGGG + Intergenic
925159800 2:1676129-1676151 GGGGCAGGACCTGGGTGCAGGGG - Intronic
926692314 2:15746040-15746062 GGGGCAGGACACTCGAGGTGGGG - Intergenic
927142473 2:20139772-20139794 GGGGCTGGGGCTGCGGGCTGAGG + Intergenic
927606435 2:24491061-24491083 CCGGCAGGCCCGGCGGGCTGGGG + Intergenic
927638387 2:24831986-24832008 GGGGCAGGGGCCGGGGGCAGGGG + Intronic
927783195 2:25955368-25955390 GAGGCAGGAGGCGGGGGCTGGGG - Intronic
930096447 2:47570301-47570323 GGGGCGGGGGCCGGGGGCTGCGG + Exonic
931515825 2:63050371-63050393 GCGCCAGGACCCGGGGGCGGCGG - Intronic
931867319 2:66426506-66426528 GCGCGAGGACCCGCGGACTGGGG - Intergenic
932708285 2:74043728-74043750 GAGACAGGAACTGCGGGCTGGGG + Intronic
934277983 2:91589059-91589081 GGGGCCGGGCGCGCGGGCGGAGG + Intergenic
936144122 2:109967790-109967812 GGGGCTGCACCAGCAGGCTGAGG - Intergenic
936180804 2:110265751-110265773 GGGGCTGCACCAGCAGGCTGAGG - Intergenic
936200565 2:110403679-110403701 GGGGCTGCACCAGCAGGCTGAGG + Intronic
938501852 2:131834676-131834698 GGGACGGGGCCCGCGGGCGGCGG + Intergenic
939613065 2:144332708-144332730 GGAGCCGAGCCCGCGGGCTGGGG - Intergenic
940830143 2:158457296-158457318 GGGCCAGGACCTGCGCGCCGGGG + Intronic
943989617 2:194671208-194671230 TGGGCAGGACTCGCTGGCTTGGG + Intergenic
944221698 2:197310335-197310357 GGGGCAGGGCCCGTGGGCGCTGG - Intronic
946277588 2:218643009-218643031 GGGCCGGGGCCCACGGGCTGGGG + Exonic
946431034 2:219627581-219627603 GGAGGTGGAGCCGCGGGCTGCGG + Exonic
946691622 2:222312514-222312536 GGGGCAGGGCGCGCGGACCGAGG - Intergenic
947869002 2:233422068-233422090 GGGGCATGGCCAGTGGGCTGTGG + Intronic
948953951 2:241272768-241272790 GCGGCAGGACCAGCGGGCGGGGG - Exonic
1169113046 20:3045687-3045709 GGGGCGGGGCTCTCGGGCTGCGG - Exonic
1169375769 20:5065711-5065733 GGAGCAGGACCCGGGTTCTGTGG + Intergenic
1170766272 20:19292073-19292095 TGGGGAGGACCCATGGGCTGTGG + Intronic
1172117966 20:32583296-32583318 CGGGCCGGGCCCGCGGGGTGAGG - Intronic
1172162934 20:32880853-32880875 AGGGCAGGACTCTGGGGCTGTGG + Intronic
1172174939 20:32966543-32966565 GGGGAAGGACACTGGGGCTGGGG + Intergenic
1173658995 20:44720077-44720099 GGGGCAGGACCCGGTGGCCGGGG + Exonic
1174175556 20:48642325-48642347 GGCCCATGACCCGGGGGCTGTGG - Intronic
1174366626 20:50060548-50060570 TGTGCAGGGCCCGCGGGGTGTGG + Intergenic
1175216570 20:57394476-57394498 GTGGGAGGAGCCGCTGGCTGAGG + Intronic
1175777492 20:61662516-61662538 GGGACAGGAGCTGGGGGCTGGGG + Intronic
1175877797 20:62238650-62238672 GGGGCCTGGGCCGCGGGCTGGGG + Intronic
1175954811 20:62603843-62603865 GGGGCAGCAGCAGCGGGGTGGGG - Intergenic
1175994326 20:62805376-62805398 TGCGCAGGCCCCGCGGCCTGGGG + Intronic
1176025338 20:62982667-62982689 GGGGCAGTGGCCGTGGGCTGTGG - Intergenic
1176044534 20:63085513-63085535 TGGGCAGACCCCGCGGGCAGAGG + Intergenic
1176101751 20:63367641-63367663 GGGGCAAGCCCCGGGGGCCGTGG + Intronic
1176742384 21:10616354-10616376 AGAGCAGGACCCTCGGGCTGAGG - Intergenic
1178977959 21:37236237-37236259 TGGTCTGGACCCGCAGGCTGAGG + Intronic
1179198031 21:39183782-39183804 GGGGCCGGACGCGGTGGCTGAGG - Exonic
1179642364 21:42756127-42756149 TGGGCAGGAGCCACGGGCCGTGG - Intronic
1179893543 21:44349732-44349754 GAGGCAGGACCCCAAGGCTGGGG - Intergenic
1179984832 21:44914389-44914411 GGGGCAGGACCAGGGGGACGAGG + Intronic
1180064241 21:45404926-45404948 GGGCCGGGACCCGGGGGCGGCGG - Intergenic
1180101525 21:45590030-45590052 GGCGCGGGACCCGCAGCCTGGGG - Intergenic
1180141002 21:45893305-45893327 GGGGCAGGAGCTGGGGGCAGTGG + Intronic
1180161256 21:45999565-45999587 GGGGCAGGGCCCTGGGGGTGGGG + Intronic
1180564262 22:16649563-16649585 AGAGCAGGACCCTCGGGCTGAGG - Intergenic
1180621405 22:17164948-17164970 TGGGCAGGTCCCCCTGGCTGGGG + Intronic
1180649926 22:17369422-17369444 GGGGCCGGACGCGGGGCCTGGGG - Exonic
1181307582 22:21925686-21925708 GGGGCAGGGCCGGGGGGATGGGG + Intronic
1181317875 22:21982618-21982640 GGCGGAGGACCCGCGAGCTCGGG - Exonic
1181745459 22:24952711-24952733 AGGGCAGGTGCCGCGGGCTGCGG + Intronic
1181774019 22:25146888-25146910 GGGGCAGGAGACCAGGGCTGAGG - Intronic
1181851783 22:25754791-25754813 GGGGCAGGACATGAGGGGTGAGG + Intronic
1182129968 22:27843687-27843709 AGGGCAGGGCCCTGGGGCTGAGG + Intergenic
1182426254 22:30274508-30274530 TGGGCAGGACCTGGTGGCTGTGG - Intergenic
1182586553 22:31346841-31346863 GGGGCAGGAACTGAGGGGTGCGG + Intergenic
1183108230 22:35629800-35629822 GGGGCAGGTTCCAGGGGCTGGGG + Intronic
1183264465 22:36816851-36816873 TGGGGAGGATCCGCCGGCTGCGG + Intronic
1183279265 22:36923381-36923403 GGGGCAGGGGCCACGGGCAGGGG + Intronic
1183409851 22:37648434-37648456 GGGTGAGGGGCCGCGGGCTGGGG + Exonic
1183581466 22:38729001-38729023 GGGGCAGCAGCAGCGTGCTGGGG + Intronic
1183587660 22:38762416-38762438 GGGGCAGGAACCTGGCGCTGAGG - Intronic
1183689927 22:39382755-39382777 GGGGTAGGACCAGGGGGATGTGG - Exonic
1184096697 22:42319947-42319969 GGGGCAGGATCTGGGGGCTCAGG - Intronic
1184399012 22:44262761-44262783 GGAGCAGGGCCCACGGGGTGAGG + Intronic
1184679242 22:46061569-46061591 GGGTCAGGAGTCGCGGGCTGCGG - Intronic
1184759888 22:46537988-46538010 CGGGTAGGACCCGGGGGCGGAGG + Intergenic
1185020085 22:48369376-48369398 GGGGCAAGTCCAGCTGGCTGAGG - Intergenic
1185036387 22:48479340-48479362 CGGCCAGGACCCGTGAGCTGAGG + Intergenic
1185036455 22:48479604-48479626 CGGCCAGGACCCGTGAGCTGAGG + Intergenic
1185271150 22:49929756-49929778 GGGGCAGGTGCAGCGGGCAGGGG - Intergenic
1185309480 22:50146143-50146165 GGGGGAGGCCTGGCGGGCTGTGG + Intronic
950004308 3:9681875-9681897 GGGGCAGGAACTACAGGCTGGGG - Intronic
950612124 3:14133481-14133503 GGGGCAGGACAGGCTGGCAGGGG + Intronic
952924806 3:38313143-38313165 GGGGCCGGAGCAGTGGGCTGTGG + Intronic
954449817 3:50565777-50565799 GTGGCAGGAACCACAGGCTGGGG - Exonic
954664998 3:52246858-52246880 GGGCCACGACCTGCAGGCTGAGG + Intronic
960582627 3:119294102-119294124 GGGGCAGGAAGCGGCGGCTGCGG + Intergenic
961739984 3:129027239-129027261 CGGGGAGGCCCCGCGGGCGGCGG + Intronic
961827603 3:129606923-129606945 GCGGCGGGACCCGCGGACGGCGG - Intergenic
962583748 3:136820220-136820242 GGGGTAGGTCCAGAGGGCTGGGG + Intronic
967120246 3:186376292-186376314 GGAGCAGGACTCGTGGGCAGAGG + Intergenic
968133081 3:196203570-196203592 GAGGCAGGTGCTGCGGGCTGCGG + Intronic
968178172 3:196568990-196569012 GGCGCCGGCCCCGGGGGCTGGGG + Exonic
968434149 4:576317-576339 GGGAGGGGCCCCGCGGGCTGGGG - Intergenic
968479183 4:826252-826274 GGGGGTGGACCCGGGGGCGGGGG + Intergenic
968479228 4:826326-826348 GGGGGTGGACCCGGGGGCGGGGG + Intergenic
968479282 4:826411-826433 GGGGGTGGACCCGGGGGCGGGGG + Intergenic
968479325 4:826478-826500 GGGGGTGGACCCGGGGGCGGGGG + Intergenic
968502510 4:957481-957503 TGGGCAGGACCAGCCTGCTGTGG - Intronic
968505984 4:971740-971762 AGGGCAGGAACCCTGGGCTGGGG + Intronic
968545269 4:1194908-1194930 GGGGTTGGAGCCGCCGGCTGCGG - Intronic
968545299 4:1195012-1195034 GGGGTTGGAGCCGCCGGCTGCGG - Intronic
968545306 4:1195033-1195055 GGGGTTGGAGCCGCCGGCTGCGG - Intronic
968545319 4:1195075-1195097 GGGGTTGGAGCCGCCGGCTGCGG - Intronic
968545326 4:1195096-1195118 GGGGTTGGAGCCGCCGGCTGCGG - Intronic
968816169 4:2823072-2823094 TGGGAGGGACCCGCTGGCTGTGG - Intronic
968819997 4:2843473-2843495 GGGGCAGGGCCCGTCTGCTGGGG + Intergenic
968902057 4:3436496-3436518 GGGGCAGGAAGGGCGGGCAGTGG + Intronic
969032754 4:4227277-4227299 GGGGCCGGGCGCGCGGGCGGAGG - Intergenic
969413359 4:7043493-7043515 GCGGCGGGTCCCGCGGGCGGCGG + Exonic
969714296 4:8860985-8861007 GGGGCCGGAACCGCGGGGAGGGG + Intronic
970446125 4:16124539-16124561 GGGGCCGGACCCTCCGTCTGTGG - Intergenic
970980942 4:22096296-22096318 GGGGCAGGACCCTGGAGCTGAGG - Intergenic
971019063 4:22516078-22516100 TGGCCAGGACCCGCGCGCGGCGG + Intergenic
972817018 4:42656474-42656496 GAGGCAGGGGCGGCGGGCTGGGG + Intronic
974047133 4:56907855-56907877 GGGGCGTGTCCCGCGGGCGGTGG + Intronic
974156292 4:58077540-58077562 GGGGCAGGACCAGGAGGCTCAGG + Intergenic
975118676 4:70705520-70705542 CAGGCAGGAGCCGCGGCCTGGGG - Intronic
980130463 4:128811962-128811984 GGGGCGGCACCTTCGGGCTGGGG - Intronic
980721887 4:136708326-136708348 GGGGCAGGACCCTCCTGCTTGGG - Intergenic
981617371 4:146655497-146655519 GGGGCAGACCGCGCGGGCTTGGG - Intergenic
984684383 4:182649776-182649798 GGGGCAGTACTTGGGGGCTGGGG - Intronic
985611702 5:892896-892918 AGGGCGGGGCCCGCGGGCTGAGG + Exonic
985646766 5:1088653-1088675 GGGGCGGCACCCGGGGGCTGAGG - Intronic
985666418 5:1183685-1183707 GGGGCAGGGCCAGCGGCCTTTGG + Intergenic
985737769 5:1594533-1594555 GGGGCAGGAACCGCGGCGGGTGG + Intergenic
985749737 5:1667341-1667363 GGGGCGAGACCCGCGGGGAGGGG - Intergenic
985827986 5:2206916-2206938 GGGGCAGGGGCCGCAGGCTCAGG - Intergenic
985904600 5:2823498-2823520 GGGGTAGGAGCCCCGGCCTGGGG + Intergenic
989368221 5:40679739-40679761 GGGGCTGGGCGCGCGGGGTGGGG - Exonic
990410296 5:55534907-55534929 GGGGCAGGCCGTGCCGGCTGAGG - Exonic
991351200 5:65722131-65722153 GGGGCCGGACGCGAGGGCTGGGG + Intronic
991351207 5:65722155-65722177 GGGGCCAGACACGCGAGCTGGGG + Intronic
992527942 5:77630073-77630095 AGGGGAGGCCTCGCGGGCTGGGG + Exonic
993900160 5:93579593-93579615 GGGACTGCACCCGGGGGCTGGGG - Intergenic
995528154 5:113067206-113067228 GGCACAGGATCCCCGGGCTGGGG + Intronic
997297538 5:132777312-132777334 GAGGCCGGTCCCGCGGGCGGGGG - Exonic
997505285 5:134412034-134412056 AGGGCAGGAGCCACGGGCTGCGG - Intergenic
998018838 5:138753366-138753388 GGGGCGGGGGCCGCGGGCGGGGG + Intronic
998150210 5:139752875-139752897 GGGGCAGCCCACGCGGGCAGGGG - Intergenic
999129389 5:149271604-149271626 GGGGCAGGCCGCGCGGGCGCGGG + Intergenic
999375065 5:151081002-151081024 GGGGCAGGGCACCCGGGCCGAGG + Intronic
1002180134 5:177426989-177427011 GGCGCAGGGCCCGCGGGCCTAGG - Intronic
1002418740 5:179134778-179134800 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002418748 5:179134798-179134820 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002418756 5:179134818-179134840 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002418782 5:179134891-179134913 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002418790 5:179134911-179134933 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002418853 5:179135090-179135112 GGGGCTGGAGCCGGGAGCTGGGG - Intronic
1002499753 5:179640391-179640413 GGGGCCAGACCCGGTGGCTGAGG + Intergenic
1002696879 5:181098043-181098065 CGGGCAGGAGCCCCGGGCCGGGG - Intergenic
1002697743 5:181101330-181101352 CGGGCAGGAGCCCCGGGCCGGGG + Intergenic
1002777340 6:340390-340412 GGGGCAGGGCCTGTGGGTTGGGG + Intronic
1003012245 6:2436687-2436709 GGGGCTGGAACCGTGGGCTTTGG + Intergenic
1003426865 6:6003515-6003537 GGGCCAGGAGCCCCGGGCCGCGG - Intronic
1003516814 6:6824882-6824904 GGCTCAGGACACGCGGGGTGGGG + Intergenic
1005987740 6:30884723-30884745 GCGGCGGAACCCGCGGGCGGAGG + Intronic
1006171780 6:32097289-32097311 TGGGCAGGACCCCGAGGCTGAGG + Intronic
1006247212 6:32747886-32747908 GGGGGAGGAGCAGGGGGCTGGGG - Intergenic
1007422852 6:41729898-41729920 GCGGCAGGACCCGAAGGCAGTGG + Intronic
1007689222 6:43687849-43687871 GGGGCAGGAACGGCGGGGCGGGG + Intergenic
1017647263 6:156550919-156550941 GGGGCAGGACCCGACTGCAGTGG + Intergenic
1018013597 6:159693332-159693354 GGGGCGGGGCCCGCGGGGGGGGG - Intronic
1018966859 6:168496568-168496590 GGGACAGAACTCGAGGGCTGGGG - Intronic
1019145000 6:169970753-169970775 GGGGCAGGCTCACCGGGCTGTGG + Intergenic
1019289295 7:242519-242541 GGGGCAGGGCCAGTGAGCTGGGG + Intronic
1019484565 7:1283542-1283564 GGGGCAGGAGATGTGGGCTGGGG + Intergenic
1019505009 7:1386355-1386377 GGAGCAGGACCCTGGGGGTGGGG - Intergenic
1019520768 7:1459654-1459676 GAGGCAGGACCCGGCGGCTGGGG - Intergenic
1019932969 7:4235850-4235872 GGGGCAGGACACCCTGGCTGCGG - Intronic
1020125533 7:5530834-5530856 GGTGCTGGGCCCGGGGGCTGGGG + Intronic
1020212504 7:6166986-6167008 GGGGCAGGGTCTGAGGGCTGGGG - Intronic
1020244882 7:6422349-6422371 GCAGCAGGACCCGCTGGCTGGGG + Intronic
1020252912 7:6483866-6483888 GGCGCAGGCCCCGCGAGCCGTGG + Intronic
1021740377 7:23680325-23680347 GGGCCAGGATCCCTGGGCTGGGG + Intronic
1022091434 7:27110336-27110358 GGGGCAGGGGGCGCGGCCTGGGG + Exonic
1024262597 7:47583119-47583141 AGGGCAGGACCCCAGGGCTGCGG - Intergenic
1025824495 7:64999266-64999288 GGGACTGGAGCCCCGGGCTGGGG - Intronic
1029423939 7:100485284-100485306 GGGGCAGGAGGTGGGGGCTGGGG - Exonic
1029465118 7:100720604-100720626 GGGGCAGGACGCCTGGGTTGAGG - Intergenic
1029547612 7:101218600-101218622 ACGCCAGGACCCGAGGGCTGAGG - Intronic
1029657600 7:101937217-101937239 GGGGGAGGAGCTGGGGGCTGGGG - Intronic
1029702419 7:102256108-102256130 CGTGCAGGGCCCGCGGGCTCTGG + Exonic
1030049022 7:105521972-105521994 GGGGCGGGGCCCTGGGGCTGGGG + Intronic
1032267676 7:130380396-130380418 GGGACAGGACCCAGGTGCTGGGG + Exonic
1033253091 7:139777500-139777522 GGGGCAGGCGCCGGGGGCTGCGG + Intronic
1033477188 7:141702183-141702205 GGGGCGGGGCGGGCGGGCTGCGG + Intergenic
1034560720 7:151877703-151877725 GGGGCGGGACCCGGGGGCTGCGG - Intergenic
1034997722 7:155588984-155589006 GGGGCAGAGCCCAGGGGCTGTGG + Intergenic
1035740594 8:1925412-1925434 GAGGCAGGGCCCGCGGCCCGGGG + Intronic
1038318411 8:26507628-26507650 GGGGCAGGACCCACAGCCAGTGG - Exonic
1038575677 8:28701730-28701752 GGGGCTGGCCCCGAGCGCTGGGG + Intronic
1038761177 8:30384970-30384992 CGGGCGGGCGCCGCGGGCTGTGG - Exonic
1040677213 8:49765208-49765230 GGGGCAGGGGCGGCGGGCAGGGG - Intergenic
1046613360 8:116449432-116449454 GGAGCATGAGCCGAGGGCTGCGG + Intergenic
1049564402 8:143330765-143330787 GAGGCAGGACCCGGGGGCTCTGG - Intronic
1049592702 8:143469781-143469803 AGGGCAGGACCAGCCTGCTGAGG + Intronic
1049635162 8:143684328-143684350 GGGGCGGGGCCTGCCGGCTGCGG + Intergenic
1049724120 8:144137681-144137703 GGGGCGGGACCGGCGTGCGGAGG - Intergenic
1049748561 8:144273152-144273174 GGGCCAGGACGCGGGGGCGGGGG + Intronic
1049835734 8:144734414-144734436 GGGGCAGGAACCGGGTGCTCAGG - Intronic
1050552321 9:6758618-6758640 GTGTCACGACCCGCGGGGTGAGG + Intronic
1051711202 9:19933036-19933058 GGGGCAGGAGGTGGGGGCTGCGG + Intergenic
1056733916 9:89188805-89188827 GGGGTGGGACCAGCGGTCTGTGG - Intergenic
1057547186 9:96027374-96027396 AGCCCAGGCCCCGCGGGCTGCGG + Intergenic
1057995636 9:99820047-99820069 GGGGCAGGGCGCGCGGGGCGGGG - Intergenic
1058431707 9:104926644-104926666 GGTGCTGGGCGCGCGGGCTGCGG - Intronic
1059176815 9:112175386-112175408 GAGGAAGGACCCGCGCTCTGCGG - Intronic
1060214863 9:121732638-121732660 GGGGCAGGAACAGCGAGCAGAGG + Intronic
1060225673 9:121788871-121788893 GGGGCTGGACCCGTGGGCCCTGG - Intergenic
1060789790 9:126478392-126478414 GGGGCAGGGCCTGGGGGCTCAGG - Intronic
1060825100 9:126683278-126683300 GCGGCGGGAGCCGCGGGCGGGGG - Intronic
1060849176 9:126860627-126860649 GGGGCGGGGGGCGCGGGCTGGGG + Intergenic
1060929519 9:127479998-127480020 GGGGAAGGACTCTGGGGCTGGGG - Intronic
1060983091 9:127804557-127804579 GGGGCAGGACCCTGGGGTAGGGG + Intronic
1061320193 9:129823673-129823695 GGAGCGGGGCCCGGGGGCTGGGG - Intronic
1061670452 9:132185379-132185401 GGGACAGGCCCCCCTGGCTGGGG - Intronic
1061754806 9:132804874-132804896 GGGGCAGGACATGAGGGGTGAGG - Intronic
1061759835 9:132843019-132843041 GGGGCAGGACCAGCTGAATGTGG - Intronic
1061859258 9:133459814-133459836 GGGGCGGGACCCGCAGGCTGCGG - Intergenic
1061880782 9:133567891-133567913 GGGGCATGGCCAGCGTGCTGGGG - Intronic
1062014018 9:134282323-134282345 AGGGCAGAACCCGCTGGCTCAGG - Intergenic
1062275318 9:135727693-135727715 GGAGCAGTACCCAGGGGCTGGGG - Intronic
1062343335 9:136103529-136103551 GGGGCAGCCCCTGAGGGCTGGGG + Intergenic
1062423444 9:136495045-136495067 GGGTCGGGTCCCGCGAGCTGGGG + Exonic
1062521955 9:136961623-136961645 GGGCCAGGACCAGCTGCCTGGGG + Intergenic
1062609828 9:137368889-137368911 GGGGCGGGGCCCCAGGGCTGTGG + Intronic
1062630690 9:137461814-137461836 GGGGCAGGGCCTGTGGCCTGAGG + Intronic
1062655994 9:137604964-137604986 GGGGCAGGAGCCGGGGGTGGGGG + Intergenic
1185473222 X:397622-397644 GGGGCAGGAGGAGAGGGCTGCGG - Intergenic
1187181596 X:16947488-16947510 GGGGCAGGAGCAGCGAGCAGAGG - Intronic
1187317150 X:18206776-18206798 GAGGCAGGACTAGAGGGCTGAGG + Intronic
1189316731 X:40062078-40062100 GGGGCGGGGCCTGCGGACTGTGG - Intronic
1190054724 X:47174930-47174952 GGGGCGGGACCCGAGGGGAGAGG - Intronic
1200244596 X:154516250-154516272 GGGGCGGGGCCGGCGGGCTGTGG - Intergenic
1202600702 Y:26590536-26590558 AGAGCAGGACCCTCGGGCTGAGG - Intergenic