ID: 1105044050

View in Genome Browser
Species Human (GRCh38)
Location 12:132986811-132986833
Sequence CGCAGGCAGCGCGCGAACGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105044043_1105044050 -7 Left 1105044043 12:132986795-132986817 CCGCGGGTCCTGCCCCCGCAGGC 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1105044037_1105044050 13 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1105044041_1105044050 -6 Left 1105044041 12:132986794-132986816 CCCGCGGGTCCTGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1105044036_1105044050 14 Left 1105044036 12:132986774-132986796 CCCTCACGGTCTCTCCGCAGCCC 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1105044040_1105044050 0 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105044050 Original CRISPR CGCAGGCAGCGCGCGAACGT GGG Exonic
908795903 1:67831856-67831878 GGCAGGCAGCGCTAGAACGACGG - Intronic
921155017 1:212432800-212432822 CGCAGGAGGCGCGCGAAGGGCGG + Intergenic
1068878663 10:62025588-62025610 CGCAGGAAGCACACAAACGTAGG - Intronic
1073206127 10:101770366-101770388 CGCAGGCTGCGCGTGAAGGGCGG + Exonic
1073253090 10:102133674-102133696 CGCAGGCAGCGGGTCCACGTGGG + Intronic
1075645072 10:124091917-124091939 CGCAGGGCGGGCGGGAACGTGGG + Intronic
1077299480 11:1840427-1840449 CGCAGGCAGCACCTGAAGGTAGG + Exonic
1090293917 11:125569646-125569668 GGCAGGCAGGGCCCGAGCGTGGG + Intronic
1091741843 12:2964792-2964814 CGCAGGCAGAGCGAGACAGTGGG + Intronic
1096469871 12:51869288-51869310 CGGAGCCAGCGCGCGAGCCTCGG + Intergenic
1100572795 12:95858798-95858820 TGCAGGCGGCGCGCGGACCTTGG - Intergenic
1103521143 12:121537594-121537616 CCCAGGCAGCGCCCCAAAGTTGG - Intronic
1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG + Exonic
1117699143 14:58396066-58396088 CGCAGGCGGCGCTTGAACGCGGG - Exonic
1127547740 15:60005766-60005788 CGCAGGCAGCGCGGGCACGGCGG - Exonic
1131112955 15:89776805-89776827 CGCAGGCAGCGCGGGGACGCGGG + Exonic
1149038263 17:52158484-52158506 TGCAGGCTGCGCGCGGACCTGGG - Exonic
1150168330 17:62966132-62966154 CGGAGGGAGCGCGCGTGCGTGGG - Intergenic
1152257189 17:79246937-79246959 CGCAGGCAGCTGGAGAACGCCGG + Intronic
935590515 2:104843131-104843153 CGCAGCCAGCGCGAGGACCTCGG + Intergenic
944457552 2:199911269-199911291 CGCACGCTGCGCGCGGACGTCGG + Exonic
1179976855 21:44873358-44873380 CGCAGGCAGCGCCCCGACGGAGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
993654324 5:90558880-90558902 CGCCGGGAGCGCGCGGATGTCGG + Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1049716269 8:144094646-144094668 CGCAGGCAGCGCGTGACAGCGGG - Intergenic
1051897972 9:22008750-22008772 GGCAGGGGGCGCGCGAACGCGGG - Intronic
1054891798 9:70259324-70259346 CTCCGGCAGCGCGCGGGCGTGGG + Intronic
1056475408 9:86947283-86947305 GGCGGGCAGCGCGCGGACGCCGG - Intergenic