ID: 1105044052

View in Genome Browser
Species Human (GRCh38)
Location 12:132986817-132986839
Sequence CAGCGCGCGAACGTGGGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105044044_1105044052 -9 Left 1105044044 12:132986803-132986825 CCTGCCCCCGCAGGCAGCGCGCG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044037_1105044052 19 Left 1105044037 12:132986775-132986797 CCTCACGGTCTCTCCGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044041_1105044052 0 Left 1105044041 12:132986794-132986816 CCCGCGGGTCCTGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044040_1105044052 6 Left 1105044040 12:132986788-132986810 CCGCAGCCCGCGGGTCCTGCCCC 0: 1
1: 0
2: 2
3: 41
4: 420
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044043_1105044052 -1 Left 1105044043 12:132986795-132986817 CCGCGGGTCCTGCCCCCGCAGGC 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1105044036_1105044052 20 Left 1105044036 12:132986774-132986796 CCCTCACGGTCTCTCCGCAGCCC 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105044052 Original CRISPR CAGCGCGCGAACGTGGGCGT GGG Exonic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
909114209 1:71514070-71514092 CAGCGCGATTCCGTGGGCGTAGG - Intronic
919446148 1:197708074-197708096 CAGCGCGATTCCGTGGGCGTAGG - Intronic
923786810 1:237075622-237075644 CAGCGCGATTCCGTGGGCGTAGG - Intronic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG + Intergenic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1099146131 12:79045266-79045288 CAGCGAGACTACGTGGGCGTAGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1111498683 13:89088240-89088262 CAGCGAGAGTCCGTGGGCGTAGG - Intergenic
1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG + Intronic
1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG + Intergenic
1122376793 14:101266557-101266579 CAGCGAGACACCGTGGGCGTAGG - Intergenic
1122874345 14:104656643-104656665 CAGCGCGGGAGCGGGGGCGGGGG + Intergenic
1123487733 15:20756151-20756173 CAGCGCCCGAGCGTGCGCGCGGG - Intergenic
1126140095 15:45430412-45430434 AAGCGCCCGAACGCGGGCGCTGG - Intergenic
1126707814 15:51422866-51422888 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1152945146 17:83194051-83194073 CAGCCCAGGAACGTGGGGGTTGG + Intergenic
1160024796 18:75208806-75208828 CGGGGCGAGAACGGGGGCGTGGG + Intronic
1160575695 18:79852657-79852679 CAGCGCCTGCACCTGGGCGTGGG + Intergenic
1167237138 19:48321941-48321963 CAGCGCGCGGACGTGGTAGGCGG - Intronic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
931252991 2:60550258-60550280 CAGCTCGCGCACGGGGGTGTCGG + Intronic
942879285 2:180839309-180839331 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
949059135 2:241946703-241946725 CAGTACGGGGACGTGGGCGTGGG - Intergenic
1177810351 21:25918727-25918749 CAGCGCGATTCCGTGGGCGTAGG - Intronic
1183683643 22:39349820-39349842 CAGCGCGCGACCTCGGGCGCGGG - Intergenic
959683103 3:109118138-109118160 CTGCGCGTGAGCGTGGGCGTGGG - Exonic
962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG + Intronic
962882468 3:139591315-139591337 CAGCGCGATTCCGTGGGCGTAGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
978641512 4:110876440-110876462 CAGCGCGACTCCGTGGGCGTAGG + Intergenic
998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG + Intronic
999584599 5:153076633-153076655 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1022842178 7:34175210-34175232 CAGCGAGACACCGTGGGCGTAGG + Intergenic
1029044557 7:97614016-97614038 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1033210090 7:139453978-139454000 CAGGCCGCGAGCATGGGCGTGGG + Intronic
1034091991 7:148372113-148372135 CATCGCGTGAACCTGGGAGTTGG + Intronic
1035662638 8:1359441-1359463 GAGCCCAGGAACGTGGGCGTGGG + Intergenic
1045897970 8:107240967-107240989 CAGCGAGACTACGTGGGCGTCGG - Intergenic
1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1057513187 9:95697939-95697961 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG + Intergenic
1193603946 X:83542754-83542776 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG + Intronic