ID: 1105045764

View in Genome Browser
Species Human (GRCh38)
Location 12:133002009-133002031
Sequence ACGTGAGAAGAAAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105045764_1105045770 23 Left 1105045764 12:133002009-133002031 CCCGCTTCCCTTTCTTCTCACGT 0: 1
1: 0
2: 1
3: 41
4: 456
Right 1105045770 12:133002055-133002077 CCTTCAGTGACTCACTTCTGTGG 0: 1
1: 0
2: 1
3: 16
4: 196
1105045764_1105045768 -10 Left 1105045764 12:133002009-133002031 CCCGCTTCCCTTTCTTCTCACGT 0: 1
1: 0
2: 1
3: 41
4: 456
Right 1105045768 12:133002022-133002044 CTTCTCACGTGTTCTTAGCAAGG 0: 1
1: 0
2: 1
3: 1
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105045764 Original CRISPR ACGTGAGAAGAAAGGGAAGC GGG (reversed) Intronic
900084933 1:888315-888337 AAGAGAGAAGAAAGGAAGGCAGG + Intergenic
900918495 1:5655804-5655826 AAGAGAGAAGAAAGGAAGGCAGG + Intergenic
901150341 1:7097119-7097141 ACGGGAGCAGGAAGGGAAGAGGG - Intronic
901909068 1:12439735-12439757 AGGAGGGAAGAAAGGGAAGAAGG + Intronic
902271051 1:15305411-15305433 ACGTGGAAAGAACTGGAAGCAGG + Intronic
902623216 1:17662471-17662493 GCGTGAGCACCAAGGGAAGCAGG - Intronic
902654052 1:17855557-17855579 ACGTGCATCGAAAGGGAAGCTGG - Intergenic
902926418 1:19698704-19698726 AAGGAAGAAGAAAGGGAAGGAGG - Intronic
903804924 1:25998435-25998457 CCTTGAGAATAAAGCGAAGCGGG - Intergenic
904559049 1:31384615-31384637 CCTTGAGAAGGAAGGGCAGCTGG + Intergenic
904682825 1:32240854-32240876 ACGGTAGAATAAAGGGAAGGAGG + Intergenic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
905997257 1:42391973-42391995 ACATGAGATGAAAGGGAATTTGG - Intronic
906246856 1:44282347-44282369 AAGAGAGAAGAAAGGGAAGGGGG + Intronic
906459216 1:46024468-46024490 AGGTGAGAGGGAAGGGAAACTGG - Intronic
907310272 1:53535084-53535106 AGCAGAGAAGGAAGGGAAGCAGG + Intronic
908180836 1:61603824-61603846 ACGTAAGATGAAATGGAAGGAGG - Intergenic
908561121 1:65308227-65308249 AGATGAGAAGAAAGCAAAGCTGG + Intronic
908916732 1:69136244-69136266 AAGGGAGGAGAAAGGGAAGGAGG + Intergenic
909044913 1:70698390-70698412 AGGTGAGAAGAGAGAGAAGCTGG - Intergenic
909157058 1:72091460-72091482 ACGGGAGAAGGAAGGGAGGGAGG - Intronic
909185618 1:72481908-72481930 GAGTGAGAGGGAAGGGAAGCTGG + Intergenic
909379398 1:74980839-74980861 GATAGAGAAGAAAGGGAAGCAGG - Intergenic
909532811 1:76700179-76700201 AAGCTAGATGAAAGGGAAGCTGG + Intergenic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
911624418 1:100104760-100104782 ACCTGAGAAAAAAGGGAGGCTGG - Intronic
912549356 1:110474806-110474828 AAGCAAGAAGAAGGGGAAGCGGG - Intergenic
913057465 1:115175614-115175636 GGGTGAGATGAAAGGGAAGAAGG + Intergenic
913966718 1:143382984-143383006 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914061095 1:144208591-144208613 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914118055 1:144757778-144757800 AAGGGAGAAGAAAGGAAGGCAGG + Intergenic
914902796 1:151720863-151720885 ACGGGAGGAGAAAGGGAATTTGG - Intronic
915015180 1:152726340-152726362 ACGGGAGAAGAAGAGGAGGCAGG + Intergenic
915495636 1:156280950-156280972 AAGTCAGAAGAAAGGGCAGCAGG - Intronic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
916473446 1:165145970-165145992 AGGAGAGAAGAAAGGGAAGAAGG - Intergenic
916522792 1:165580273-165580295 AGGAGAGAAGAAAGGGAGGGAGG + Intergenic
918200068 1:182258347-182258369 ACGAAAGAAGAAGGGGAAGAAGG - Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
921983174 1:221280615-221280637 ACTAGAGAAGGAAGGGAAGGAGG - Intergenic
922132494 1:222794108-222794130 AGGTAAGAGGAAAAGGAAGCAGG - Intergenic
922474493 1:225897978-225898000 AATTGAAAAGAAAGGGAGGCCGG - Intronic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922614378 1:226952893-226952915 AGGAGAGAAGAAAGGGAGGGAGG - Intronic
923357634 1:233176352-233176374 ACGGGAGAAGAAAAGGAAGAAGG - Intronic
923736125 1:236609603-236609625 ATGAGAGAAGAAAGGGATTCAGG - Intergenic
924272093 1:242344493-242344515 ACGTGGGAGGAAAAGGAAGTAGG + Intronic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1064016058 10:11773232-11773254 ACGGGGGAAGGAAGGGAAGGAGG - Intergenic
1064218960 10:13423506-13423528 AACTCAGCAGAAAGGGAAGCCGG + Intergenic
1064939407 10:20715861-20715883 AGGAGAGAAGAAAGAGAAGAAGG + Intergenic
1065412963 10:25450496-25450518 AGGTAAAAAGAAAGGGAAGATGG - Intronic
1066712574 10:38251645-38251667 ACGTGGGAGGAAAAGGAAGTAGG - Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1067530287 10:47066219-47066241 ACGGGAGGAGAAGGGGGAGCAGG - Intergenic
1067900874 10:50240268-50240290 AAGGAACAAGAAAGGGAAGCTGG - Intronic
1068352719 10:55869523-55869545 ACGTCAGAAATAAGGGAAACAGG - Intergenic
1070780142 10:79132847-79132869 AAGGGAGAAAAAAGGGAAGTGGG - Intronic
1071766397 10:88670580-88670602 AAGTGAGAAGAATCTGAAGCTGG + Intronic
1072524929 10:96263306-96263328 ATGTGTGAAGGAAGGGAATCTGG + Intronic
1072826001 10:98607102-98607124 ACCTGAGAAGAAAGAGAGGGAGG - Intronic
1073209211 10:101784917-101784939 AGGTGAGAAGAAAGGAGAGAAGG - Exonic
1073791215 10:106942298-106942320 GAGAAAGAAGAAAGGGAAGCCGG - Intronic
1073956019 10:108872305-108872327 AAGTGAGAGGTAAGGGAAGGAGG + Intergenic
1074830831 10:117247469-117247491 AGGTGGGAAGAACAGGAAGCGGG - Intronic
1074906611 10:117869699-117869721 AAGCAAGAAGAAAGGGGAGCAGG + Intergenic
1076117957 10:127913755-127913777 ACTGGAGAAGAAAGGAAGGCTGG - Intronic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1077269363 11:1667953-1667975 ACGTGAGAAGAGACTGAGGCGGG - Intergenic
1078660393 11:13281113-13281135 AGGTGAGAAGGAATGGCAGCTGG - Intronic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1081937941 11:46917946-46917968 GCGTGCGAAGAAAGGGAGGCGGG - Intronic
1082834755 11:57643450-57643472 ACATGAAAGGAAAGAGAAGCAGG - Intergenic
1083014644 11:59440525-59440547 AGGTTAGAAGAAAGGGGAGTGGG - Intergenic
1083310121 11:61779703-61779725 AAGGGAGAAGAAAGAGAAACGGG - Intronic
1083583519 11:63839829-63839851 AAGGGAAGAGAAAGGGAAGCTGG - Intronic
1083605871 11:63978611-63978633 AGAGGAGGAGAAAGGGAAGCTGG - Intronic
1084119920 11:67062967-67062989 AGGTGAGATGAACGGGCAGCAGG - Intronic
1085046324 11:73355869-73355891 GCGTGAGAACAAGGAGAAGCAGG + Exonic
1085350457 11:75795037-75795059 GAGTGAGAAGAAAGGAAAGAAGG - Intronic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1086318953 11:85624857-85624879 AGGAAAGAAGAAAGGGAAGGAGG + Intronic
1087135609 11:94715471-94715493 AGGTGAGAACAAAGGAAGGCTGG - Intronic
1088768269 11:113007046-113007068 AAGGGAGAAGGAAGGGGAGCAGG - Intronic
1089598858 11:119600814-119600836 AGTGGAGCAGAAAGGGAAGCGGG + Intergenic
1089910961 11:122100569-122100591 ACGAGAGAAAAAAGGGCAGTTGG + Intergenic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1090929370 11:131281651-131281673 AGATGAGAAGAAAGGGCAGAAGG - Intergenic
1091037942 11:132250473-132250495 AGGAGAGAAGAAAGGGAAAAGGG - Intronic
1091105775 11:132918349-132918371 ACGTGAGAAGAACTTGCAGCAGG - Intronic
1091783969 12:3231221-3231243 AGGGGAGAATGAAGGGAAGCGGG + Intronic
1092195620 12:6548160-6548182 GCTGGAGTAGAAAGGGAAGCGGG + Exonic
1092247009 12:6869324-6869346 AAGCTAGATGAAAGGGAAGCTGG + Exonic
1093947987 12:25132257-25132279 ACGTGAGAAGGATGGGATGGTGG - Intronic
1094339101 12:29390302-29390324 ACCTGAGAAGGAAGAGAAGAAGG + Intergenic
1095652208 12:44624778-44624800 AAGTTAGAAGACAGAGAAGCAGG - Intronic
1095991797 12:48039860-48039882 TTGTGAGAAGAAAGGGGTGCAGG + Intergenic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1096660105 12:53118934-53118956 AGGTGAGAAGATAGGGTAGAAGG + Exonic
1096743997 12:53713735-53713757 AGGTGAGGAGAAATGGGAGCCGG + Exonic
1097034326 12:56112859-56112881 ACATTAGAAGAAAATGAAGCTGG + Exonic
1097350608 12:58544510-58544532 AAGAGAGAAGAAAGGGAAGAAGG - Intronic
1098480609 12:70954947-70954969 AGATGAGGAGAAAGGGAAGGTGG + Intergenic
1098763223 12:74451369-74451391 AAAGGAGAAGAAAGGTAAGCAGG + Intergenic
1099006174 12:77237004-77237026 AAGTGAGAATATAGAGAAGCTGG - Intergenic
1099760427 12:86913343-86913365 ATGGAAGATGAAAGGGAAGCAGG - Intergenic
1100088710 12:90943275-90943297 ACCTTAGAAGAAAGGGAAAAGGG + Intronic
1100387358 12:94115977-94115999 AAGAGAGAAGAAAGAGAAGGTGG - Intergenic
1101524145 12:105512352-105512374 ACGAGACAAGGAAGAGAAGCAGG - Intergenic
1101620559 12:106383273-106383295 ACATGATAAGAAAGTGAAACAGG - Intronic
1102455979 12:113071047-113071069 AGATGAAAAGAAAGGGAAGCTGG - Intronic
1102913649 12:116737481-116737503 AGGAAAGAAGAAAGGGAAGGGGG + Intronic
1103023692 12:117556707-117556729 AAGTGAGAGGACAGGGAAGGAGG + Intronic
1103428183 12:120857068-120857090 ACAGGAGAAGAAAAGGAAGAAGG + Intronic
1103972752 12:124682318-124682340 GCCTGAGAAGGCAGGGAAGCTGG - Intergenic
1104616336 12:130273139-130273161 TTATTAGAAGAAAGGGAAGCGGG - Intergenic
1104692090 12:130834035-130834057 ACATGCGAGGAAAGGGAGGCAGG + Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1105290134 13:19048285-19048307 GCCTGAGAAGAGAAGGAAGCAGG + Intergenic
1107720821 13:43246456-43246478 ACATGAAAGGAAAGGGGAGCAGG + Intronic
1108396679 13:49996987-49997009 ACGGGAGGGGAAGGGGAAGCGGG + Intronic
1108515120 13:51194236-51194258 AGGGGAGCAGACAGGGAAGCAGG - Intergenic
1109184843 13:59255686-59255708 ACGGTGGAAGAAAGGGAAGTGGG + Intergenic
1109402714 13:61856397-61856419 ATGGGAGAAGAAAGAGAAGGTGG + Intergenic
1109736621 13:66494133-66494155 ACCTGAGTAGAAAAGGAATCTGG + Intronic
1109985123 13:69970787-69970809 ACCTCAGAAGAAACAGAAGCAGG - Intronic
1110193364 13:72757197-72757219 AATAGAGAAGAAAGGGAAGTAGG - Exonic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110609361 13:77471822-77471844 ACATGAGAAGAAGGAGAAGGAGG - Intergenic
1112133407 13:96549107-96549129 AGGTGAGGAGAAAGGGCAACAGG - Intronic
1115459799 14:33648029-33648051 GAGAGAGAAGAAAGGGTAGCAGG - Intronic
1116290007 14:43022451-43022473 AGGAGAGAAGAAAGGGATGGAGG - Intergenic
1117617271 14:57546404-57546426 AAGTGAGAGGAAAGGGAGGAAGG + Intergenic
1117802974 14:59464347-59464369 ACATGAGCAGGAAGGGCAGCAGG + Exonic
1118037626 14:61885056-61885078 ACCTAAGAAGGAAGGAAAGCTGG - Intergenic
1118074610 14:62284354-62284376 AAGTGAGTGGAAAGAGAAGCGGG - Intergenic
1118411125 14:65479545-65479567 AGGAAAGAAGAAAGGGAAGGAGG - Intronic
1118788157 14:69064103-69064125 AGGTGGTATGAAAGGGAAGCTGG + Intronic
1120267467 14:82269593-82269615 AGGAGAGAAGACAGGGAAGGAGG + Intergenic
1120960901 14:90123883-90123905 AGGTGATTTGAAAGGGAAGCTGG - Intronic
1121603201 14:95221296-95221318 ATGGGAGAAGAAGGGGAAGAGGG - Intronic
1122101130 14:99410425-99410447 AGGTGGGATGAAAGGGCAGCTGG - Intronic
1122150394 14:99722412-99722434 ACGTGAGGAGAGAAGGAACCAGG - Intronic
1122295401 14:100702941-100702963 CAGTCAGAAGAACGGGAAGCAGG - Intergenic
1124850161 15:33329119-33329141 ATGGGAGAAGAAGAGGAAGCAGG - Intronic
1125180797 15:36879622-36879644 AGGTGAGGAGAAAGGGGAACAGG + Intergenic
1126221542 15:46220003-46220025 AGGTGAGAATACAGGAAAGCTGG + Intergenic
1126936328 15:53712956-53712978 ACTTGAGATGTACGGGAAGCAGG - Intronic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1127619281 15:60717388-60717410 ACTTGAAAAGAAAGAGAAGAGGG - Intronic
1127758085 15:62112449-62112471 GACTGAGAAGAAAGGGAAGAGGG + Intergenic
1128174835 15:65545936-65545958 AAGAGAGAAGAAGCGGAAGCTGG - Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129659586 15:77545577-77545599 AAGTGAGAAGAAAGAGAAGAGGG - Intergenic
1130916092 15:88305919-88305941 AAGAGAGAAGAAAGGGAGGGAGG + Intergenic
1131067778 15:89444926-89444948 ATGTGAGAAGAGTGGGAAGTGGG - Intergenic
1131101311 15:89692034-89692056 ACCAGAAAAGAAAGGGAAGTGGG - Intronic
1131421061 15:92305788-92305810 ATGTGAGTACTAAGGGAAGCTGG - Intergenic
1133560524 16:6946118-6946140 ACTTGAGAAGCAAGGAAAACTGG - Intronic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133839286 16:9394097-9394119 AGGGAAGAAGGAAGGGAAGCAGG - Intergenic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1134866339 16:17610699-17610721 AGGAAAGAAGAAAGGGAAGGAGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135867901 16:26121568-26121590 AGGTGAGAAGGAAGGCAGGCTGG + Intronic
1137039604 16:35598857-35598879 TTGGGAGAAGAAAGGGAAACAGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1138559142 16:57789627-57789649 ACGTGAGAAGAGGGGAAAGGAGG + Intronic
1138851199 16:60632032-60632054 ATGTGAAAAGAAAGTGCAGCTGG + Intergenic
1139099926 16:63753439-63753461 ACGTGAGAAGAAAGCACAGCTGG + Intergenic
1140201857 16:72901421-72901443 ATGAGAGAAGACAGGGCAGCCGG + Intronic
1140242367 16:73214779-73214801 GCTTTAGAAGAAAGTGAAGCTGG - Intergenic
1140245662 16:73245763-73245785 AGGTGAGCAGAGAGGGTAGCTGG + Intergenic
1140516945 16:75550129-75550151 ACTAGAGAAGAAGGGGAAGCGGG + Intronic
1140650717 16:77085082-77085104 AAGTGAGAAGAAAGGGGGTCCGG + Intergenic
1141686914 16:85575464-85575486 AGGGGAGACGAGAGGGAAGCCGG - Intergenic
1142665560 17:1461396-1461418 TCCTGAGAGGAAAGGGAAGAAGG - Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1143960559 17:10714530-10714552 TCTTGGAAAGAAAGGGAAGCTGG - Exonic
1144307968 17:13986615-13986637 AAGTAAGAAGAAAGGGAGGATGG - Intergenic
1145819574 17:27821642-27821664 TCTTGACCAGAAAGGGAAGCAGG + Intronic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1146716112 17:35088740-35088762 ACGTCAGAAGAAACTGAGGCAGG - Intronic
1146752110 17:35391157-35391179 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1148215808 17:45833581-45833603 ACGTGAGAGGCATGGGGAGCAGG - Intronic
1148407220 17:47426153-47426175 AAGTGAGAAGAAACTGAAGATGG + Intronic
1148548187 17:48532570-48532592 TCAGGAGAGGAAAGGGAAGCAGG + Intergenic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1152515095 17:80818546-80818568 ACGTGAAAAGTGAGGGATGCTGG + Intronic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1154087670 18:11323006-11323028 ACTTGAGGAGATAGAGAAGCTGG - Intergenic
1155175538 18:23298262-23298284 AGGTGAGAAGGCAGGGAGGCGGG + Intronic
1155593230 18:27452516-27452538 ACATTAGAAGAAAAGGAAGCTGG - Intergenic
1155775983 18:29762134-29762156 ACATGAGAAGAGAAAGAAGCAGG - Intergenic
1157565911 18:48679222-48679244 ACAGCAGAAGAAATGGAAGCTGG - Intronic
1161045258 19:2131144-2131166 ACGTGAAAAGAAGGTGCAGCCGG + Intronic
1161445899 19:4318959-4318981 AGGGGAGAAGAAAGGGGAGAGGG + Intronic
1161970670 19:7578097-7578119 AGGAGAGAGGAAAGGGATGCTGG + Intergenic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163786757 19:19278815-19278837 AGGTGAGAAGAGGGAGAAGCAGG + Intronic
1164803721 19:31099607-31099629 AGGTAAGAGGACAGGGAAGCAGG + Intergenic
1164810534 19:31151435-31151457 AGGTCAGAAGAAAGGGGATCAGG - Intergenic
1168351172 19:55676806-55676828 ACATGGGAAGACAGGGAGGCAGG - Exonic
1168611352 19:57803550-57803572 TCCGGAGAAGAAAGGGAAACGGG - Intronic
1202700502 1_KI270712v1_random:160479-160501 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
925194868 2:1914742-1914764 ACGTGAGGAGTAAGAGAAGAGGG - Intronic
925741424 2:7008654-7008676 CAGTCAGGAGAAAGGGAAGCAGG - Intronic
928602934 2:32919426-32919448 ACATGAGAAGAATGGGATACCGG - Intergenic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
929400081 2:41569639-41569661 CCGTGAGAAGCAAGAGAACCAGG + Intergenic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931209607 2:60179928-60179950 ACGTTTGGAGAAAGAGAAGCTGG + Intergenic
931319486 2:61162146-61162168 ACGAGAGAAGAATGGGGAGCTGG + Intronic
931835626 2:66095917-66095939 ACAGCAGACGAAAGGGAAGCTGG - Intergenic
933727350 2:85434388-85434410 AGGGGAGAAGAGAGGGAGGCAGG + Intronic
933907536 2:86910051-86910073 AAGTGAGAAGAAAGAAAAACAGG - Intronic
933908782 2:86919743-86919765 AAGTGAGAAGAAAGAAAAACAGG - Intronic
934023944 2:87983642-87983664 AAGTGAGAAGAAAGAAAAACAGG + Intergenic
934171430 2:89543952-89543974 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934281739 2:91618270-91618292 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934621548 2:95812572-95812594 ACTTGAGAAGATAGGCAAACTGG + Intergenic
934811895 2:97286243-97286265 ACTTGAGAAGATAGGCAAACTGG - Intergenic
934825799 2:97421697-97421719 ACTTGAGAAGATAGGCAAACTGG + Intergenic
935047891 2:99498323-99498345 ACGTGAGAAGAGGGGGAATTTGG - Intergenic
936057092 2:109269442-109269464 AAGTCAGAAGAAAGGGGGGCTGG - Intronic
936403657 2:112184271-112184293 ACGGGAGAAGAGAGGGCAGAGGG + Intronic
936820346 2:116511931-116511953 AAGTGAAATGCAAGGGAAGCAGG - Intergenic
938140243 2:128789475-128789497 ACGTGAGTCCAAAGGGAAGGAGG + Intergenic
939733856 2:145819329-145819351 AGGAAAGAAGAAAGGGAAGGAGG - Intergenic
939896742 2:147800864-147800886 ATGTGACAATAAAGAGAAGCAGG - Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
940528605 2:154849477-154849499 GGGAGAGAAGAAAGGGAAGGAGG - Intronic
941339344 2:164287104-164287126 AGGATAGAAGAAAGGGAAGAAGG + Intergenic
941408766 2:165126402-165126424 AAGAAAGAAGAAAGGGAAGGAGG - Intronic
942751443 2:179292308-179292330 AAGTAGGAAGAAAGCGAAGCTGG - Intergenic
943995236 2:194755057-194755079 ACTTGAGAAGAAGAGAAAGCTGG - Intergenic
944470933 2:200053609-200053631 ACTTGAGTACAAAGGGTAGCAGG + Intergenic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945589718 2:211715206-211715228 ATTTGAGAAGAAAGGGAATCTGG + Intronic
945989763 2:216385730-216385752 ACGTGTTAAGATGGGGAAGCTGG - Intergenic
946085039 2:217162423-217162445 AAAAGAGAAAAAAGGGAAGCAGG + Intergenic
946271104 2:218594983-218595005 ATGGGAGAAGGAAGGGAAACAGG - Exonic
946884105 2:224205760-224205782 AGGTGAGAAGGAAAGGAAGATGG - Intergenic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
947460488 2:230299836-230299858 ACCAGATAAGTAAGGGAAGCCGG - Intronic
947602378 2:231461987-231462009 ACCTCAGAAGAAAGGCAAGAAGG - Exonic
947637124 2:231685811-231685833 ACTTGATATGAAAGGGATGCTGG + Intergenic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948863337 2:240763418-240763440 GCGTGAGGAGAAAGGGGAACGGG + Intronic
948949633 2:241240593-241240615 TCGTGGGAAGAAAGGGAGCCTGG - Intronic
1170072200 20:12381226-12381248 ACATTAGAAGAAAGTGAAGCTGG + Intergenic
1171816591 20:29790842-29790864 AAGAGAGAAGAAAGGAAGGCAGG - Intergenic
1171901764 20:30865141-30865163 AAGAGAGAAGAAAGGAAGGCAGG + Intergenic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1172204787 20:33155529-33155551 AGCTGAGAGGAAAGGGATGCAGG - Intergenic
1172361886 20:34318460-34318482 ACGTGATAACAAAGGAAAGATGG + Intergenic
1172581129 20:36049903-36049925 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1172788560 20:37486722-37486744 AAGTGAGATGACAGGGAAGGAGG + Intergenic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1173214251 20:41065318-41065340 ACGTGAGAAGAAAGAGAGATGGG - Intronic
1173456028 20:43202063-43202085 AGGGGGAAAGAAAGGGAAGCGGG - Intergenic
1173561532 20:44009330-44009352 AGGAGACAAGAAAGGGAAGGAGG + Intronic
1173755512 20:45512203-45512225 ACCAGGGAAGAAAGGGGAGCTGG - Intergenic
1174141950 20:48421219-48421241 ATGTGAGAAGTGAGGGATGCAGG + Intergenic
1176005322 20:62859191-62859213 AAGCGAAAAGACAGGGAAGCGGG + Intronic
1177105127 21:16945896-16945918 ACTTGAGAAGAAAGAGAATAAGG + Intergenic
1177204658 21:17997298-17997320 AAGTGAGGAGGAAGGAAAGCTGG - Intronic
1178143466 21:29710884-29710906 AGGAAAGAAGAAAGGGAAGGAGG - Intronic
1178985457 21:37299049-37299071 AGCTTAGATGAAAGGGAAGCAGG + Intergenic
1179902406 21:44401016-44401038 CCGTGAGGAGAAAGGGAAGGAGG - Intronic
1180016310 21:45087424-45087446 ATGTGAGAAGAAGGGGATGCAGG + Intronic
1180098535 21:45573382-45573404 TCGTGGGAAGAAAGAAAAGCAGG - Intergenic
1180335138 22:11571089-11571111 AAGAGAGAAGAAAGGAAGGCAGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1182088412 22:27577364-27577386 ACTTGAGAAGACAGGGCTGCTGG + Intergenic
1184356859 22:43987089-43987111 ACCTGAGAAGTAAGGCATGCTGG + Intronic
1185413785 22:50698853-50698875 AAGAGAGAACAAAGGGAAACTGG - Intergenic
1203290082 22_KI270735v1_random:28141-28163 AAGTGAGAAAGAAGGGAAGGAGG - Intergenic
949584786 3:5426846-5426868 ACGAGAGAAAAAAGGAAAGAAGG - Intergenic
950590790 3:13934736-13934758 AAGTGAGGAGGAAGAGAAGCTGG + Intergenic
951067987 3:18289893-18289915 ATGTAAGAAGAAAGGGAGACTGG + Intronic
951376841 3:21928400-21928422 AGGAAAGAAGAAAGGGATGCAGG + Intronic
952674687 3:36013400-36013422 AAGAGAGAAGAAAGGGAAGAAGG + Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
954940224 3:54365467-54365489 AGGGAAGAAGAAAGGGAAGGAGG - Intronic
955058147 3:55474290-55474312 AGGTGAGAAGACAGAGATGCGGG + Intronic
956312615 3:67898025-67898047 AAGTGAGAAAAAAGAGAAACAGG - Intergenic
958094886 3:88931260-88931282 AGGAAAGAAGAAAGGGAAGAAGG - Intergenic
958414412 3:93856624-93856646 ATGAGAGAAGCAAGGGAAGAAGG + Intergenic
959702792 3:109314104-109314126 AGGTGAAAAGAAAGTGAAGGCGG - Intronic
959984945 3:112561898-112561920 GAGTGAGAAGGAAGGGAAGCCGG - Exonic
960202899 3:114859388-114859410 ACGAGAAAAGAAAAGGAAGAAGG - Intronic
960863809 3:122180564-122180586 ATGTGTGAAGACAAGGAAGCTGG + Intergenic
961160709 3:124722335-124722357 AAGTGAGAAGACAGGAAAGGAGG + Intronic
962122786 3:132580794-132580816 AAGAGAAAAGAAAGGGTAGCTGG - Intronic
962304917 3:134277642-134277664 ATGTGAAGAGAAAGGGAAGGAGG + Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963272141 3:143295960-143295982 GAGTGATAAGAAAAGGAAGCAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963442587 3:145357860-145357882 AAGTGAGAAGAGAGAGAAGGGGG + Intergenic
964409891 3:156386902-156386924 AGCTGACATGAAAGGGAAGCTGG - Intronic
964450645 3:156809555-156809577 ACATTAGAAGAAAATGAAGCTGG - Intergenic
964709851 3:159660141-159660163 CACTGAGAAGAAAGGAAAGCAGG + Intronic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
966910577 3:184557424-184557446 TGGTGAGAAAACAGGGAAGCAGG + Intronic
966985448 3:185175792-185175814 GCGAGAGAAGAAAGCGAAGCAGG - Intergenic
967793482 3:193573545-193573567 ACCTGAGAAGGCAGGGAAGGAGG - Intronic
968472710 4:789388-789410 TCGTGAGAAAAAAGGGCAGTGGG + Intronic
968732470 4:2276112-2276134 ACGTGAGAATTCAGGGCAGCGGG + Intronic
969028326 4:4191936-4191958 AAATGAGAAGAAAGGAAGGCAGG + Intronic
970368392 4:15384080-15384102 AGGTGAGAAGCAAGTGAAGATGG + Intronic
971055048 4:22903033-22903055 ATGGGAGGTGAAAGGGAAGCAGG + Intergenic
971408195 4:26341903-26341925 AAGAGAGAAGAAAGTGTAGCTGG + Intronic
971468101 4:26987328-26987350 TGGGGAGAAGAAAGGGAAACTGG + Intronic
972423587 4:38912286-38912308 ACTAGAGAAGAAAGGGAAGTGGG - Intronic
972639821 4:40915204-40915226 ACGAGATGAGAGAGGGAAGCAGG - Intronic
972779998 4:42279239-42279261 ACGTGGGAAGAAGAGGACGCGGG - Intergenic
972790510 4:42367195-42367217 AGCTGATGAGAAAGGGAAGCAGG - Intergenic
972829751 4:42801777-42801799 GCGGAAGAAGAAGGGGAAGCAGG + Intergenic
973218416 4:47697770-47697792 CCATGAGGAGAAAGGGGAGCTGG + Intronic
973562175 4:52148354-52148376 AGGAGAGAAGAGAGGGAAGATGG + Intergenic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974183342 4:58412141-58412163 AAGGGAGAAGAAAGAGAAGAAGG - Intergenic
975145800 4:70966091-70966113 ACATTAGAAGAAAGGGAACTAGG + Intronic
976143247 4:82015181-82015203 ACAGAAGAAGAAAGGGAAGGAGG + Intronic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
977065225 4:92305283-92305305 ATGTGAGAAGAGAGGGTGGCTGG - Intronic
978404481 4:108364734-108364756 AGGTGGGAAGATGGGGAAGCAGG - Intergenic
978643362 4:110897928-110897950 ACATGTAAAGAAAGGGAAGCAGG - Intergenic
981756507 4:148145978-148146000 AAGTGAGAAGAAAAGGGAGGAGG + Intronic
982420999 4:155197452-155197474 AAGTAAGAAGGAAGGAAAGCAGG - Intergenic
983555064 4:169052596-169052618 AGGGAAGGAGAAAGGGAAGCTGG + Intergenic
984053019 4:174890760-174890782 AGGTGAAATGAAATGGAAGCTGG + Intronic
984243321 4:177244152-177244174 ACAGGAGAAGAAAGAGAGGCAGG + Intronic
984844845 4:184100525-184100547 AGGTGAGAAAAAAGGGTAGAGGG + Intronic
986310572 5:6547820-6547842 ACCTGGGAAGAAAAGGAAGAGGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987068205 5:14309844-14309866 AGGAGAGAAGAAAGGGAATAAGG - Intronic
987096199 5:14552597-14552619 ACGTGAGGACACAGGGAAGATGG + Intergenic
987325076 5:16805092-16805114 ACGTGAGTAAAAATGGCAGCTGG + Intronic
987433274 5:17862820-17862842 ACCTGAAAAGATAGGGTAGCTGG - Intergenic
987989234 5:25189972-25189994 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
990240827 5:53814986-53815008 TGTTGAGAAGAAAGGGAAGTGGG - Intergenic
990485618 5:56257108-56257130 AAGAGAGAAGGAAGGGAAGGAGG - Intergenic
993852683 5:93030892-93030914 AGGAGAGAAGAAAGGAAAGAAGG + Intergenic
994297785 5:98112019-98112041 ATGTGAGTGGAAAGGGAAACAGG + Intergenic
994364096 5:98891506-98891528 GCATGAGTTGAAAGGGAAGCTGG + Intronic
994628539 5:102252050-102252072 AAGCGAGAAGGAAGGGAAACGGG + Intronic
994723992 5:103413468-103413490 AGGTGAGGAAAAAGGGAAGTCGG + Intergenic
995542390 5:113197748-113197770 AGTTGAGAAGAAAAGGAGGCAGG + Intronic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
997309155 5:132865861-132865883 ACGTGAGAAGCAAGGAAAGTCGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999658991 5:153839115-153839137 AGGGGAGATGAAAGGAAAGCAGG + Intergenic
1000275728 5:159733229-159733251 ATGAGAGAAGAAAGGGAAGGTGG - Intergenic
1001380617 5:171304255-171304277 AGGTTAGAGGAGAGGGAAGCAGG - Intergenic
1001963143 5:175892672-175892694 ACGTGAGATGACAGTGAGGCAGG - Intergenic
1003031645 6:2606262-2606284 GTGTGAGAAGAAAAAGAAGCAGG + Intergenic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1003362280 6:5439444-5439466 ATGTGAGAAGAAAACAAAGCAGG + Intronic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1003655496 6:8003375-8003397 AAGTAAACAGAAAGGGAAGCAGG + Intronic
1004516975 6:16328509-16328531 AAGGGAGGAGAAAGGGAAGGAGG + Intronic
1005926439 6:30449442-30449464 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1005928161 6:30462014-30462036 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1006046806 6:31305820-31305842 CCTGGAGAAGAAAGGGAAGCTGG + Intronic
1006862655 6:37183289-37183311 AAGGGAGAAGAAAGGGGACCCGG + Intergenic
1007352124 6:41281668-41281690 AAGACAGAGGAAAGGGAAGCAGG - Intronic
1008385100 6:50880299-50880321 ACGGGAGAAGAAAGGAAGGGAGG - Intergenic
1009248286 6:61267573-61267595 AGGGAAGAAGAAAGGGAAGGAGG + Intergenic
1009825665 6:68862728-68862750 AGTGGAAAAGAAAGGGAAGCAGG - Intronic
1010146922 6:72681183-72681205 ACGTGAGAAGAAAGCAATGGGGG + Intronic
1011570109 6:88725754-88725776 CCCTGAGAAGAAAGGAAAGGGGG - Intronic
1012309775 6:97708737-97708759 ACGAGGAGAGAAAGGGAAGCTGG - Intergenic
1013176249 6:107679850-107679872 AGGAGAGAAGAAAGGAAGGCTGG - Intergenic
1013271273 6:108547427-108547449 AGGTGAGGATAAGGGGAAGCAGG + Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1014942302 6:127456954-127456976 AAGAGAGGAGAAAGGGAAGGAGG - Intronic
1015414648 6:132934557-132934579 AGGGGAGAAGACAGGGAAGAAGG + Intergenic
1015486818 6:133780998-133781020 AGGGAAGAAGAAAGGGAAGTGGG + Intergenic
1017560574 6:155624006-155624028 ATGTGAAAAGAAAGGAATGCGGG + Intergenic
1017586394 6:155929782-155929804 ATGGGAGAAGAAAGGGAAAAAGG - Intergenic
1018013549 6:159693124-159693146 GGGTGAGAAGAAAGGGGACCCGG - Exonic
1018038177 6:159899195-159899217 TCGTGAGAAGAAAGAGAGGAGGG + Intergenic
1018137414 6:160790667-160790689 TTGGGAGAAGAAAGGGAAACGGG + Intergenic
1019887285 7:3916236-3916258 ACATGTGAAGAAAGGGAATCAGG + Intronic
1021470871 7:21001339-21001361 AGGGGAGAAGAAAGGGAAGAAGG + Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1021996736 7:26185778-26185800 AAGTGAGAAGAAACTGAAGATGG + Exonic
1022637462 7:32150419-32150441 ACCTTTGAAGAAAGGGAGGCTGG - Intronic
1023378777 7:39585431-39585453 ACGTGAGAACACAGGGAAAGCGG + Intronic
1023397208 7:39762354-39762376 AAGAGAGTAGAAAGAGAAGCGGG - Intergenic
1023470779 7:40516004-40516026 AAGAAAGAAGAAAGGGAAGAAGG - Intronic
1023594791 7:41817498-41817520 TCCAGAGAAGAAACGGAAGCTGG - Intergenic
1024037894 7:45524096-45524118 TGGGGAGAAGAAAGGCAAGCAGG - Intergenic
1024162886 7:46696943-46696965 ACGTGAGCAGAAAGAGGAGTGGG + Intronic
1024461290 7:49662170-49662192 AGGAGAGAAGAAAGAGAAGGGGG - Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024939496 7:54747147-54747169 GGGTGAGAAGAAAGGGAGTCTGG - Intergenic
1025950516 7:66141788-66141810 AGTTGAGAAGCAAGGGAAGAAGG + Intronic
1026005011 7:66593488-66593510 ACGTGAGAAGAAAGAGGAGAAGG + Intergenic
1027191713 7:76000493-76000515 TCCAGAGAAGAGAGGGAAGCAGG - Intronic
1028192369 7:87868153-87868175 ACCCGAGATGATAGGGAAGCTGG + Intronic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1030925002 7:115441002-115441024 AAGTAAGGAGAAAGGGAAGGAGG + Intergenic
1032108690 7:129056411-129056433 AAGCTAGATGAAAGGGAAGCTGG + Intergenic
1032948696 7:136882367-136882389 AGGGGAGAAGAAAGGGGAGGAGG - Intronic
1033732005 7:144189249-144189271 AAGTGAGAAGAAAGGCAGGAAGG - Intronic
1033742854 7:144287832-144287854 AAGTGAGAAGAAAGGCAGGAAGG - Intergenic
1033751048 7:144361782-144361804 AAGTGAGAAGAAAGGCAGGAAGG + Intronic
1033936324 7:146590085-146590107 ATGTGAGAAGACAACGAAGCCGG - Intronic
1034244969 7:149637038-149637060 ACGTGAGAACACAGGCAAACCGG + Intergenic
1035110245 7:156475793-156475815 ACGTGGGAAGCAAGGGAAATGGG - Intergenic
1035316752 7:158001376-158001398 ACGTGCAAAGAATGGGAAGCTGG + Intronic
1035338535 7:158145557-158145579 ACGTGAGCAGAAAGGCCATCAGG + Intronic
1036407315 8:8466779-8466801 CTGTGAGAAGCAAGTGAAGCAGG - Intergenic
1036530118 8:9577492-9577514 ACGGGAGGTGAAGGGGAAGCAGG + Intronic
1036652275 8:10652767-10652789 ACGGGAGGAGATAGGGAATCAGG - Intronic
1036700147 8:11007999-11008021 GGGAGAGAAGACAGGGAAGCAGG + Intronic
1036978962 8:13446974-13446996 ACGGAAGAAGGAAGGGAAGAAGG + Intronic
1038110242 8:24488625-24488647 AAGTCAGAAGAAAAGGAAGATGG + Intronic
1040694612 8:49980477-49980499 ATGTGAGGAGAAAGTAAAGCAGG - Intronic
1040754062 8:50749145-50749167 ACATGATAAGAAAGTGAAACAGG + Intronic
1041273205 8:56129937-56129959 AGAGGAGGAGAAAGGGAAGCAGG + Intergenic
1041513424 8:58675389-58675411 ACCTGACAGGCAAGGGAAGCTGG + Intergenic
1041520305 8:58748465-58748487 GCATTAGAAGAAAGGTAAGCAGG - Intergenic
1042093910 8:65190859-65190881 AGGTGAGAAGAAAGGAAGGATGG + Intergenic
1042130417 8:65582437-65582459 AGAGGAGAAGAAAGGGAAGAAGG + Intergenic
1042650460 8:71034718-71034740 AGCTGAGAAGACATGGAAGCTGG - Intergenic
1042656938 8:71110049-71110071 AGGTAAGAAGAAAGGGTAACGGG + Intergenic
1044184913 8:89239761-89239783 CCCTGAGAAGAAAGGAAAGAGGG + Intergenic
1044359305 8:91262518-91262540 ACAAGAGAAGTAAGGGAAGAAGG + Intronic
1044458055 8:92412014-92412036 ACTAGAGAAGGAAGGGAAGGAGG + Intergenic
1046320186 8:112564314-112564336 AGGGGAGAAGGAAGGGAAGAAGG - Intronic
1046847045 8:118929182-118929204 ATGTGAGAGGAAAGGAAAGAAGG + Intronic
1046861911 8:119102524-119102546 AGGCTAGAAGAAAGGGAAGAAGG + Intronic
1046910489 8:119621022-119621044 ATGTCGGAGGAAAGGGAAGCAGG - Intronic
1047846227 8:128808394-128808416 AAGAGAGAATAAAGGGAAGGAGG - Intergenic
1048150355 8:131887714-131887736 ACCTGGGAAGAAAGGCAGGCAGG - Intergenic
1049214816 8:141402699-141402721 AAGTGAGGAAAAAGGGGAGCAGG - Intronic
1049448225 8:142641403-142641425 GTGTGAGAAGAAGGGGAGGCTGG + Intergenic
1050005554 9:1125912-1125934 ACTTGAAAAGAAAGGAAACCTGG - Intergenic
1050569988 9:6927816-6927838 CCTTGAGAAGAATGGGAAGTGGG - Intronic
1050710909 9:8462177-8462199 AAGTGAGGAGGAAGGGAAGAAGG - Intronic
1050861191 9:10432963-10432985 ACCTGACAAGAAAGGCAAACAGG - Intronic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1053436852 9:38081444-38081466 ACGTGGGGAGAAAGGAAATCAGG + Intergenic
1054848436 9:69821230-69821252 ACGAGAGAGGAATGGGAAGGAGG + Intronic
1055641926 9:78325526-78325548 AGATGAGAAGAAAGGGCATCTGG - Intronic
1056238822 9:84623171-84623193 ACGTCAGAAGACAGGGAAAGGGG - Intergenic
1056767016 9:89450725-89450747 ACATTAGAAGAAAATGAAGCTGG + Intronic
1058349167 9:104000270-104000292 ACCTGAGAAGGAAGAGAAGAAGG + Intergenic
1059519974 9:114932002-114932024 AAGTGAGCAGAAAGGAAAGGAGG - Intergenic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060004564 9:119988232-119988254 AGGTGAAAAGAAAGGCAAGTGGG - Intergenic
1060577793 9:124713197-124713219 ACATGAGAAAAAAATGAAGCTGG + Intronic
1061431611 9:130534817-130534839 ATGAACGAAGAAAGGGAAGCAGG + Intergenic
1185711681 X:2308846-2308868 AGGAGGGAAGAAAGGGAAGGAGG + Intronic
1186058823 X:5681518-5681540 AGGAAGGAAGAAAGGGAAGCAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186412585 X:9356901-9356923 ATGTGAGAAGACAGGAATGCTGG - Intergenic
1186642499 X:11471099-11471121 ACATTAGAAGAAATGGAAACTGG + Intronic
1186706100 X:12140176-12140198 ATGTTAGTAGAAAGGGAAGGTGG - Intronic
1186902089 X:14067237-14067259 CCGTGAGAAGAATGGGAGGGAGG + Intergenic
1186990567 X:15062782-15062804 ACAAGGGAAGTAAGGGAAGCAGG + Intergenic
1187323010 X:18257948-18257970 AGGGGAGAGGAAAGGGAAGGGGG + Intronic
1187537392 X:20155234-20155256 AAGCGAGAAGAGAGGAAAGCAGG + Exonic
1188268923 X:28114394-28114416 ACAAGAGGAGACAGGGAAGCAGG + Intergenic
1189294618 X:39909742-39909764 AAGGGAGATGAAAGGGAAACAGG + Intergenic
1189400753 X:40666448-40666470 ACGTGAGAGGGCAGGCAAGCAGG + Intronic
1190456935 X:50635790-50635812 AAGGGGGAAGAAAGGGAAACAGG + Intronic
1190534631 X:51413588-51413610 AGGAAAGAAGAAGGGGAAGCGGG - Intergenic
1191105566 X:56770060-56770082 ACGCGAGAAGAAAAGAATGCAGG + Intergenic
1191106559 X:56775462-56775484 ACGCGAGAAGAAAAGAATGCAGG + Intergenic
1191107552 X:56780863-56780885 ACGCGAGAAGAAAAGAATGCAGG + Intergenic
1192024109 X:67429981-67430003 ATGAGAGAAGAAAGAGAAACGGG - Intergenic
1192434532 X:71134928-71134950 ACGTGAGAAGGAAAGGTAGAGGG - Intronic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1193005931 X:76618087-76618109 AGGTGAGTAGAAACTGAAGCAGG + Intergenic
1193169675 X:78321327-78321349 ACCAGAGAAGAAAGGAAAGGGGG + Intronic
1193397481 X:81003178-81003200 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1194158069 X:90417924-90417946 AGGTAATTAGAAAGGGAAGCAGG + Intergenic
1196231216 X:113224348-113224370 AGGTGAGAATAAAGTGAAGGAGG + Intergenic
1196308771 X:114136272-114136294 TAGAGAGATGAAAGGGAAGCTGG + Intergenic
1196950132 X:120868612-120868634 ACATTAGAAGAAAATGAAGCTGG - Intergenic
1197485426 X:127044170-127044192 ACGAGAGAAGAAAGGGGGGTAGG + Intergenic
1197781605 X:130165681-130165703 GCGTGAGAGGAAAGGGAAGGAGG - Exonic
1199612290 X:149628811-149628833 GTGTGAGAAGAAAGAGAACCAGG + Intronic
1199637832 X:149830159-149830181 CCCTGAGAAGAAAGGAAAGGGGG - Intergenic
1199637931 X:149830683-149830705 TCGGGAAAAGAAAGGGAAACAGG + Intergenic
1199827377 X:151514088-151514110 TCAGGAGAAGAAAGGGAAGTAGG + Intergenic
1200504396 Y:3994892-3994914 AGGTAATTAGAAAGGGAAGCAGG + Intergenic
1200734793 Y:6782649-6782671 CCCTGAGAAGAAAGGAAAGGGGG - Intergenic
1201070420 Y:10143106-10143128 AAGAGAGAAGAAAGGAAGGCAGG + Intergenic
1201411569 Y:13703859-13703881 ACGTGAGAAGACTAGAAAGCGGG + Exonic