ID: 1105053152

View in Genome Browser
Species Human (GRCh38)
Location 12:133073080-133073102
Sequence CCTATAATGTTCCACGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105053149_1105053152 -9 Left 1105053149 12:133073066-133073088 CCTACCATGTACTACCTATAATG No data
Right 1105053152 12:133073080-133073102 CCTATAATGTTCCACGCAATAGG No data
1105053148_1105053152 -3 Left 1105053148 12:133073060-133073082 CCTTTACCTACCATGTACTACCT No data
Right 1105053152 12:133073080-133073102 CCTATAATGTTCCACGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105053152 Original CRISPR CCTATAATGTTCCACGCAAT AGG Intergenic
No off target data available for this crispr