ID: 1105056356

View in Genome Browser
Species Human (GRCh38)
Location 12:133103304-133103326
Sequence CACCCCCTTTGTTTTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105056353_1105056356 23 Left 1105056353 12:133103258-133103280 CCTGAGCTTATTCTTCATATCTA 0: 1
1: 0
2: 18
3: 172
4: 617
Right 1105056356 12:133103304-133103326 CACCCCCTTTGTTTTAAGACAGG 0: 1
1: 0
2: 3
3: 25
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105056356 Original CRISPR CACCCCCTTTGTTTTAAGAC AGG Intronic
901141994 1:7041022-7041044 CTCCCTCTGTTTTTTAAGACAGG + Intronic
901404769 1:9038730-9038752 GACCCCTTTTATTTTAAGGCAGG + Intronic
901430764 1:9213249-9213271 GGCCCCCTTTTTTTTGAGACAGG + Intergenic
901733382 1:11296522-11296544 CCCCCCCTTTGTTTTGAGACAGG + Intergenic
903890007 1:26563230-26563252 CTCCCCCTTTTTTTTGAGACAGG + Intronic
904681307 1:32231242-32231264 CACCACTTTTTTTTTAAGGCAGG + Exonic
908516106 1:64894344-64894366 AACCCCCTTTGTTTCTAGAGTGG - Intronic
908986893 1:70035003-70035025 CAACCGATTAGTTTTAAGACAGG + Intronic
911131629 1:94394330-94394352 CACCACCATTGTTTTATTACAGG - Intergenic
912445185 1:109730404-109730426 AACTCTCTCTGTTTTAAGACAGG + Intronic
913024020 1:114817317-114817339 CACCCGATTTTTTTTAAGCCAGG - Intergenic
913375907 1:118152240-118152262 CAACCCCTTTATTTTATGAATGG - Intronic
914262590 1:146011499-146011521 CGCCCCCTTGTTTTTGAGACAGG + Intergenic
915412769 1:155715514-155715536 CTCTCTCTTTTTTTTAAGACAGG - Intronic
915764959 1:158353666-158353688 CACAGACTTTGTTTTAAGCCAGG + Intergenic
921172441 1:212561272-212561294 CTCCCACCTTGTTTGAAGACAGG + Intergenic
921856165 1:219987194-219987216 CACCTCCTTGGTTTTTAGAAGGG + Exonic
922978919 1:229808650-229808672 AACTCCCTTTTTTTTGAGACGGG + Intergenic
924680179 1:246223113-246223135 CAACTCCTTTGATTCAAGACAGG + Intronic
1065695920 10:28379677-28379699 AACCCCCTTTTTATTGAGACAGG + Intergenic
1069861777 10:71475960-71475982 CACCCCCTTGCTTTGAAGAGTGG - Intronic
1071044249 10:81354579-81354601 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1077197122 11:1287331-1287353 CACCCCCTTTTTGTTAAAGCTGG - Intronic
1077628497 11:3794620-3794642 CCACGCCTTTGTTTTAAGACAGG + Intronic
1078202680 11:9197687-9197709 AACTCACTTTTTTTTAAGACGGG - Intronic
1078962841 11:16299562-16299584 CACGCCTTTTCATTTAAGACTGG + Intronic
1081579134 11:44339970-44339992 ATCCCCCTTTTTTTTGAGACAGG + Intergenic
1082011166 11:47450363-47450385 CCCCCCCTTTTTTTTGAGACAGG + Intergenic
1083751454 11:64763142-64763164 CACCCCAGGTGTCTTAAGACAGG + Intergenic
1084059062 11:66657741-66657763 CCCCACCTTTTTTTTGAGACAGG + Intronic
1084301177 11:68253698-68253720 CCTCCCCTTTTTTTTGAGACAGG + Intergenic
1085729924 11:78988673-78988695 CACTCCCTTTTTGTAAAGACAGG + Intronic
1086295582 11:85363962-85363984 CATGACTTTTGTTTTAAGACTGG - Intronic
1088326256 11:108604388-108604410 CCCCGCCTTTCTTTTGAGACAGG - Intergenic
1088391985 11:109324557-109324579 CACTCCCTTTGGTTTGAGAGAGG + Intergenic
1089481595 11:118809877-118809899 CCCCCCTTTTTTTTTCAGACAGG - Intergenic
1089618529 11:119709141-119709163 CACCACCTATTTTTGAAGACAGG + Intronic
1090792677 11:130105407-130105429 CACCCTTTTTTTTTTGAGACAGG - Intronic
1092185166 12:6473427-6473449 CAACCCCGTTTTTTTGAGACAGG - Intergenic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1095530254 12:43178810-43178832 CACGCCCTTTATTTTAAAAAAGG - Intergenic
1095560042 12:43553161-43553183 CACCCCCTTTGCTTTCATACTGG - Intergenic
1096708280 12:53436972-53436994 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1096835846 12:54350765-54350787 CACCCTCTTTCTTTCTAGACTGG + Exonic
1096853278 12:54457450-54457472 CAACCCCTTTTTTTAGAGACAGG + Intronic
1097048463 12:56205552-56205574 CCCCCTCTTTTTTTTAAGAATGG - Exonic
1098020487 12:66150418-66150440 CCCCCCTTTCTTTTTAAGACAGG + Intronic
1098096234 12:66959384-66959406 CACCCGCTTTTTTTTTAGATTGG - Intergenic
1098271996 12:68778113-68778135 CCCGCCCTTTTTTTTGAGACAGG - Exonic
1099312468 12:81044604-81044626 CCCCCTCTTTGCTTTAAGAGTGG + Intronic
1099500251 12:83405163-83405185 CACCTCCTATATTTGAAGACAGG - Intergenic
1099801854 12:87467104-87467126 CAACCCCTCTGTTTTCAAACTGG + Intergenic
1101115622 12:101528852-101528874 CCCCTCCTTTTTTTTGAGACAGG + Intergenic
1102599256 12:114016661-114016683 CCCCCTCTTTTTTTTGAGACAGG - Intergenic
1105056356 12:133103304-133103326 CACCCCCTTTGTTTTAAGACAGG + Intronic
1105492128 13:20899088-20899110 CCCTCCCTTTCTTTTGAGACAGG - Intronic
1107710388 13:43145279-43145301 TCCCCCCTTTTTTTTAAGAAGGG + Intergenic
1108320810 13:49288625-49288647 CACCAGCTTTGTTGTTAGACTGG + Intronic
1109168344 13:59063782-59063804 CACACGCTTTGTTTTAATACTGG + Intergenic
1113746924 13:112751733-112751755 CCCCCCCCTTTTTTTGAGACAGG + Intronic
1114269269 14:21091256-21091278 CACCCACTTTGATTTAATAAAGG + Intronic
1118403469 14:65400877-65400899 CAGCCCTTTTTTTTTGAGACAGG - Intergenic
1122049270 14:99044060-99044082 CACCCCCTGTTTTTTCAGAAGGG + Intergenic
1125871190 15:43103356-43103378 CATCCTTTTTGTTTTGAGACAGG - Intronic
1127215436 15:56818519-56818541 CTCCTCCTTATTTTTAAGACTGG - Intronic
1127376909 15:58393493-58393515 CACCTCATTTTTTTTAAAACTGG - Intronic
1128544568 15:68558371-68558393 CACCATTTTTTTTTTAAGACAGG + Intergenic
1128704536 15:69828976-69828998 TACCCCCTTTGTTTTAAAATGGG - Intergenic
1130023014 15:80247004-80247026 GACCTCCTAAGTTTTAAGACAGG - Intergenic
1131140317 15:89971958-89971980 CTTCCCCTTTTTTTTGAGACAGG + Intergenic
1134149309 16:11793525-11793547 CACCCCCTTTTTTTTGAGACAGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1134533718 16:15006802-15006824 CACCCCCTTCGATTAAAGTCTGG - Intronic
1136574502 16:31115534-31115556 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1137331252 16:47498895-47498917 CTACCCTTTTGTTTTGAGACAGG - Intronic
1137883443 16:52076830-52076852 CACCCCCCTGCTTTTAAAACAGG - Intronic
1139227344 16:65245713-65245735 CACCCCCTTTATTTTATGGATGG + Intergenic
1139862315 16:70033930-70033952 CACCCCCTTCGATTAAAGTCTGG + Intergenic
1141266089 16:82498543-82498565 CACCCCCTTTGTCTTACATCAGG - Intergenic
1142510970 17:392880-392902 CAACCCCATTTTTTTTAGACAGG + Intergenic
1143138545 17:4726623-4726645 CACCACCTTTTTTTTGAGACAGG + Intergenic
1143744967 17:8986278-8986300 CACTTCCTTTTTTTTGAGACAGG - Intergenic
1144452483 17:15392491-15392513 CACTCCCTTGGATTCAAGACTGG + Intergenic
1146375730 17:32292980-32293002 ATCCCCCTTTTTTTTGAGACAGG - Intronic
1147450425 17:40500758-40500780 CACCCCCTATTTTTGAAAACTGG + Intronic
1147924648 17:43938883-43938905 CAACCCCTTTGTATTGAGAGGGG + Exonic
1147962058 17:44173806-44173828 TTCCCACTTTTTTTTAAGACAGG - Intronic
1148004421 17:44414311-44414333 CACCCCCCTTTTTTGGAGACAGG + Intronic
1148273790 17:46284873-46284895 TCCCCCCATTGTTTTGAGACAGG + Intronic
1150409266 17:64929707-64929729 TCCCCCCATTGTTTTGAGACAGG - Intergenic
1150744635 17:67806654-67806676 ACCCCCCTTTTTTTTGAGACAGG + Intergenic
1150792635 17:68210941-68210963 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1151888588 17:76938682-76938704 CACCCTCTTTTTTATGAGACAGG + Intronic
1153107643 18:1546336-1546358 CACCCCCTGGGTTTTAAGGAAGG - Intergenic
1156505909 18:37592267-37592289 CTCCCCCTTTTTTTTAAGTTGGG + Intergenic
1156821548 18:41379055-41379077 CAGGTCCTTTGTATTAAGACAGG - Intergenic
1161757040 19:6141737-6141759 CCACCCTTTTGTTTTGAGACAGG + Intronic
1161828664 19:6586788-6586810 CCCTCCCTTTTTTTTGAGACAGG - Intronic
1162221024 19:9176490-9176512 TACCCCTTTTTTTTTTAGACGGG + Intergenic
1165024345 19:32948729-32948751 CCACCCCTTTTTTTTGAGACAGG + Intronic
1165450677 19:35880351-35880373 CACCTCCCTTTTTTTAAGACAGG + Intergenic
1167646141 19:50706151-50706173 CCCCCCCTTTTTTTTGAGACAGG - Intronic
1167681275 19:50923125-50923147 CACCATTTTTTTTTTAAGACAGG - Intergenic
926435483 2:12833447-12833469 CATCCCCTTTTTTTGAAGAACGG - Intergenic
926718444 2:15942005-15942027 CGCCCCGTTCGTTTTAATACCGG - Exonic
927802972 2:26118317-26118339 CTCCCCCTTTTTTTTGAGACCGG + Intronic
928172283 2:29011437-29011459 CTCCCCCGTTCTTTTAAGATTGG + Exonic
928962393 2:36941149-36941171 TACTTCCTTTGTTTTGAGACAGG - Intronic
929120161 2:38477510-38477532 CACCCTCTTTGTTCCAAAACGGG - Intergenic
931338832 2:61378165-61378187 CTCCCTCTTTTTTTTGAGACAGG - Intronic
931380765 2:61751199-61751221 CAACCTCTTTATTTGAAGACAGG + Intergenic
932060735 2:68495342-68495364 CAGACCCTTTGTTTTGAAACAGG - Intronic
933844334 2:86313484-86313506 CAACCTCTTTGTTTTATGAATGG + Intronic
936150882 2:110021781-110021803 CACTCCCATTGCTTTAAGAGAGG + Intergenic
936193794 2:110349588-110349610 CACTCCCATTGCTTTAAGAGAGG - Intergenic
937996350 2:127697637-127697659 CACCCCCTCATTTTTGAGACAGG - Intergenic
939155668 2:138522447-138522469 CCCACCCTTTTTTTTAAAACTGG + Intronic
940380984 2:153014433-153014455 TTCCCCCTTTTTTTTGAGACAGG - Intergenic
944512425 2:200477791-200477813 CACCGCCTTTGTTTTTGGGCCGG - Exonic
944658744 2:201902565-201902587 CAACCCCTGTGTTTTACCACTGG + Intergenic
945029937 2:205654084-205654106 CACCACCTATGTTTGAAGGCTGG - Intergenic
1170992412 20:21315495-21315517 TTCCCCCTTTTTTTTGAGACAGG + Intronic
1172088145 20:32405906-32405928 CACCCCTTTTTTTTTGAGATGGG + Intronic
1172227724 20:33316390-33316412 TTCCCCCTTTTTTTTGAGACAGG - Intergenic
1174436245 20:50509413-50509435 CAGCCCTTTTTTTTCAAGACAGG + Intergenic
1175807335 20:61837185-61837207 AACCCCGTTTTTTTTGAGACAGG - Intronic
1176164678 20:63666539-63666561 CTCCCCCTTTTTTTTGAAACAGG + Intronic
1177667255 21:24176497-24176519 CAGCCATTTTGTTTTAAGCCAGG - Intergenic
1184803297 22:46775482-46775504 CACCTCTTCTGTTTTGAGACTGG + Intronic
1184835063 22:47016192-47016214 CACCCCCTTTGTTTCAGCCCTGG + Intronic
1184905149 22:47478042-47478064 CGTCCTCTTTGTTTTGAGACAGG + Intronic
950637097 3:14323127-14323149 CATCCCCATGGTTTAAAGACAGG - Intergenic
951009674 3:17661894-17661916 TCCCCCTTTTTTTTTAAGACAGG + Intronic
951845098 3:27076822-27076844 CACACCCTTTGCTTTAAGAATGG - Intergenic
953093432 3:39752054-39752076 CCCCCTCTGTGTTTGAAGACAGG + Intergenic
954790351 3:53128516-53128538 TACAGCTTTTGTTTTAAGACAGG + Intronic
962482019 3:135806222-135806244 CACCCCATTTCTTTCCAGACAGG + Intergenic
963302235 3:143611737-143611759 AACCCCCTTATTTTTGAGACAGG + Intronic
967135059 3:186506144-186506166 CTCCCCCATTGTTTTCAGACTGG + Intergenic
971303493 4:25461220-25461242 CCCCCCCTTTTTTTTGAGACAGG - Intergenic
972277293 4:37569089-37569111 CCCCCCTTTTTTTTTGAGACAGG - Intronic
973597951 4:52511892-52511914 CATCACTTTTTTTTTAAGACAGG - Intergenic
974408196 4:61503996-61504018 CAACCCCCTTTTTGTAAGACAGG + Intronic
976396816 4:84564863-84564885 CCCCCCCTTTTTTTTGAGACAGG - Intergenic
977604908 4:98974450-98974472 CACCAACTTTTTTTTGAGACAGG + Intergenic
980119711 4:128715212-128715234 CACACACTTTTTTTTGAGACAGG + Intergenic
981042633 4:140237584-140237606 CATGCACTTTGTTTTAAGTCTGG + Intergenic
981872248 4:149500596-149500618 CATCCCTTTTATTTTAAGTCTGG + Intergenic
984750807 4:183271998-183272020 AACCCCCATTTTTTTGAGACAGG - Intronic
984827000 4:183934395-183934417 CAACCCCTTTGTCTTAAATCAGG + Intronic
984902283 4:184596014-184596036 CTCCCCTTTTCTTTTGAGACAGG - Intergenic
986745547 5:10741345-10741367 CACCTGCTTTTTTTTGAGACAGG - Intronic
988137093 5:27187698-27187720 TTCCCCCTTTTTTTTGAGACAGG - Intergenic
998003475 5:138642178-138642200 CACCCCCTATCTCTTAAGAAAGG - Intronic
999750759 5:154626841-154626863 CCCCCCCTTTTTTTTGAGCCAGG - Intergenic
1001022540 5:168195667-168195689 CACTGCCTTTGATTTAAAACAGG - Intronic
1001188725 5:169605075-169605097 CCCCCACTTTTTTTTGAGACAGG - Intergenic
1002709791 5:181188368-181188390 CCCCCCCTTTCTTTTGAGATGGG - Intergenic
1004642394 6:17527992-17528014 CACCACCTATGTTTTTAGAAGGG + Intronic
1004801429 6:19152875-19152897 CCCCCCCTTTTTTTTTTGACAGG - Intergenic
1005415897 6:25599933-25599955 CACCACCTCTGTTTTATGCCTGG + Intronic
1007069016 6:39021382-39021404 CACCAGATTTGTTTTAAGGCAGG - Intronic
1008559549 6:52710320-52710342 CACTCCCTTTTTTTTGAGACAGG - Intergenic
1009045711 6:58235626-58235648 CACCCTCTTTCTTTTAAGTGGGG + Intergenic
1009440150 6:63668341-63668363 CTCCCCCTTTTTTTTGAGACAGG + Intronic
1010233723 6:73557804-73557826 CGACCCCTTTTTTTTGAGACAGG + Intergenic
1011644787 6:89447247-89447269 CCCTCCCTTTTTTTTGAGACAGG - Intronic
1015311236 6:131769354-131769376 CACTTCCTTTTTTTTGAGACAGG + Intergenic
1015363686 6:132372691-132372713 CCTCCCCTTTTTATTAAGACAGG - Exonic
1022363057 7:29681787-29681809 CATCACCTTTGTTTTAAAAAAGG - Intergenic
1022428257 7:30288811-30288833 CATCACCTTTGTTTTAAAACAGG + Intronic
1022698337 7:32731999-32732021 CATCACCTTTGTTTTAAAAAAGG + Intergenic
1023182230 7:37496452-37496474 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1023420362 7:39973140-39973162 CCCCCTCTTTTTTTTGAGACAGG + Intronic
1025851568 7:65248912-65248934 CACCCATTTTTTTTTGAGACAGG + Intergenic
1025956159 7:66184706-66184728 CAGCCCCTTTCTTTAAAGTCAGG - Intergenic
1026347162 7:69483919-69483941 CCCCCCCTTTTTTTTGAGACAGG - Intergenic
1028177938 7:87679392-87679414 CCCCAACTTTTTTTTAAGACAGG + Intronic
1028212810 7:88095932-88095954 CCCCCCCTTTTTTTAAAGACAGG + Intronic
1028983921 7:96995571-96995593 AAGCCCCTCTGATTTAAGACTGG + Intergenic
1029003010 7:97175871-97175893 CACTACCATTGTTTTAAGTCAGG - Intronic
1029461422 7:100695892-100695914 AACCCCCTTTGTTTAAAAAAAGG + Intergenic
1030627380 7:111859022-111859044 CTCCCCCCTTTTTTTGAGACAGG + Intronic
1033192264 7:139292245-139292267 CGCCCCCTTTTTTTTGAGACAGG - Intronic
1034707412 7:153157993-153158015 CTCCCCATTTGTTCTAAGACTGG + Intergenic
1035121100 7:156567700-156567722 CACAGCATTTGCTTTAAGACAGG - Intergenic
1036576746 8:10034486-10034508 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1037130964 8:15407226-15407248 CAACCCATATTTTTTAAGACGGG + Intergenic
1038652574 8:29419161-29419183 CCCCCCCCTTGTTTTGAGGCAGG + Intergenic
1040857822 8:51968701-51968723 CCCCACCTTTTTTTTGAGACAGG + Intergenic
1041136693 8:54766688-54766710 CACCCTATATGTTTTAAGGCGGG + Intergenic
1041259283 8:56006076-56006098 CCCCACCTTTTTTTTGAGACAGG - Intronic
1044568933 8:93696775-93696797 CACCCTGTTTGCTTTCAGACAGG + Intergenic
1048758192 8:137762401-137762423 CACCCCCATGGTTTCAAGTCTGG - Intergenic
1050759479 9:9049399-9049421 CAACCTCTTTATTTGAAGACAGG + Intronic
1051907454 9:22112570-22112592 CACTTCCTTTGTTTTGAGAATGG - Intergenic
1053140607 9:35680366-35680388 CCCCCCCTTTTTTTAAAGATAGG + Intronic
1053440159 9:38109386-38109408 CCCCCCCTTTTTTTTGAGACAGG + Intergenic
1055809159 9:80131540-80131562 CACCCCCTTTCTTCTGAGACAGG - Intergenic
1057283607 9:93729787-93729809 CACCCCATTTTTTTCAACACTGG + Intergenic
1057399437 9:94710234-94710256 CATGCTCTTTGTTTTGAGACAGG + Intergenic
1057957347 9:99421744-99421766 CACCTCCTTTGTCTTCAAACAGG + Intergenic
1058002425 9:99879787-99879809 CTCTCTCTTTTTTTTAAGACAGG + Intergenic
1061068899 9:128296581-128296603 CCCCTCCTTTTTTTCAAGACAGG - Intergenic
1062583810 9:137240132-137240154 CAGCCCGTTTGTTTTTAAACAGG + Intergenic
1186230793 X:7451409-7451431 CATCCCCTTGCTTTTAAAACTGG - Intergenic
1186261700 X:7786874-7786896 CACACCCTTTGTTTTCTCACTGG + Intergenic
1187245366 X:17549039-17549061 CACCCTCTTTGTTTTTAAGCAGG - Intronic
1187908314 X:24087713-24087735 CCCCCCCTTTTTTTTGAGACAGG + Intergenic
1188093587 X:25993799-25993821 CATCCGCATTGTTTGAAGACAGG - Intergenic
1188141401 X:26556934-26556956 CCCCCCCTTTTTTTTGAGACAGG + Intergenic
1190305939 X:49081684-49081706 CAGCCCTTTTTTTTTGAGACGGG - Intronic
1194250418 X:91567739-91567761 AAGCCTCTTTGTTTTGAGACAGG - Intergenic
1196509552 X:116491707-116491729 CACCCACAATTTTTTAAGACAGG - Intergenic
1197149716 X:123206907-123206929 CAATCCATTTGTTTTAAAACTGG + Intronic
1197985775 X:132265458-132265480 CACTCCCTGTCTTTTATGACAGG + Intergenic
1198323240 X:135540760-135540782 CACCCCCTTTTTTTTGAGACAGG + Intronic
1198340307 X:135707732-135707754 CACCCCATTCTTTTTGAGACAGG + Intergenic
1198343788 X:135740449-135740471 CACCCCATTCTTTTTGAGACAGG + Intergenic
1200569371 Y:4808985-4809007 AAGCCTCTTTGTTTTGAGACAGG - Intergenic