ID: 1105063192

View in Genome Browser
Species Human (GRCh38)
Location 12:133172777-133172799
Sequence CTGGGATGTGAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 629}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105063192 Original CRISPR CTGGGATGTGAGAGGGAAGC AGG Intronic
900121929 1:1051932-1051954 CCGGGAGGTGAGAGAGAGGCGGG - Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900769212 1:4527620-4527642 CTGGGGAGTGACAGGGAAGTGGG - Intergenic
901132458 1:6970614-6970636 TTGGGATGGGAGAGACAAGCAGG + Intronic
901195135 1:7436179-7436201 CTGGGAGGCGAGAGGGAGCCGGG + Intronic
901254279 1:7807815-7807837 CTGGCAGGTAAGGGGGAAGCAGG - Intronic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
901817105 1:11800628-11800650 GTGGGATGGGAGAGGGTGGCAGG - Intronic
902361825 1:15946107-15946129 CTGGGAGGTGACAGGACAGCCGG + Intronic
902795693 1:18799297-18799319 CTGGGATGAGCATGGGAAGCTGG - Intergenic
903280610 1:22247942-22247964 CTGACATGTGAGTGGGGAGCAGG + Intergenic
903378345 1:22880309-22880331 ATGGGATGTGAGTGTGGAGCAGG - Intronic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
903929803 1:26855613-26855635 CTGGGAGGTGAGGAAGAAGCTGG + Exonic
904598228 1:31659855-31659877 CTGTAATGTGAGGGGGAACCAGG + Intronic
904824196 1:33264091-33264113 CTGGGATATAGCAGGGAAGCAGG + Intronic
905233741 1:36531060-36531082 CTGGGCTGTAACTGGGAAGCTGG + Intergenic
905632839 1:39528357-39528379 CTGGGCTGTGGGAGGCAACCAGG - Intergenic
905648028 1:39638213-39638235 CTGGGATTTGAGACTGAGGCAGG + Intronic
905803331 1:40859719-40859741 CTGAGATGTGGGAGAAAAGCTGG - Intergenic
906139917 1:43528001-43528023 CTGGGATATGACAGGGAACAAGG + Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906187303 1:43871613-43871635 ATGGGATGTGAGGGAGAAGATGG + Intronic
906187312 1:43871651-43871673 ATGGGATGTGAGGGAGAAGATGG + Intronic
906187414 1:43871972-43871994 CTGGGATGTGAGAAAGAGGGTGG + Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
908393284 1:63702799-63702821 CTGGAGTGGGAGAGGGAGGCAGG + Intergenic
908469473 1:64429411-64429433 ATGGAATGTGAGTGGGAAGTGGG + Intergenic
908784390 1:67720815-67720837 ATGGGATGTCAGAAGGAAACAGG - Intronic
909094084 1:71265680-71265702 GTGGGATGAGGGAGAGAAGCAGG - Intergenic
909662114 1:78095745-78095767 CTGGGTGGTAAGAGAGAAGCTGG - Intronic
910288415 1:85578235-85578257 GTGGGATGGGGGTGGGAAGCTGG - Intronic
911154974 1:94628212-94628234 CTGGGATGGGAGATGCAGGCGGG + Intergenic
911244203 1:95498833-95498855 CTGAGATGTGACAGGGCAGAGGG + Intergenic
911875290 1:103154440-103154462 TTGGAAGGTGAAAGGGAAGCAGG - Intergenic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
914831539 1:151174299-151174321 CTGGAAGGTGAGAGGGAAACTGG + Intronic
915935793 1:160089650-160089672 CTGGGATGTGATCAGGAAGCAGG - Exonic
915962580 1:160279425-160279447 ATGGGATGACAGAGGGCAGCGGG + Exonic
916071492 1:161172706-161172728 GGGGGATGTGGGAGAGAAGCTGG - Intronic
916783767 1:168067022-168067044 CTGGGATGGGAGAGGGAAGGTGG + Intronic
917702666 1:177596986-177597008 CTGGGAGTTGAGTGGGCAGCAGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918322921 1:183382139-183382161 GTGGAAGGTGAGAGGAAAGCAGG + Intronic
919726652 1:200888830-200888852 CTGGGAAGTGGAAGGGAAGTGGG - Intergenic
920033077 1:203048867-203048889 CTGGAATGGGAGAGGAAGGCAGG + Intronic
920161319 1:204000157-204000179 CTGTGATGTGAGAGAGAAACAGG - Intergenic
920227247 1:204447634-204447656 CTGGGGTGAGAGAAAGAAGCTGG - Intronic
920250896 1:204621704-204621726 CTGGCATCTGAGAGAGAAACTGG - Exonic
920702911 1:208231289-208231311 ATGGGGTGTGAGAGAGAAGCCGG + Intronic
921919539 1:220651045-220651067 ATGGGAAGTGAAAGGGAAGGAGG - Intronic
922203813 1:223429471-223429493 ATGGGCTGAGAGAGGGTAGCTGG + Intergenic
922985297 1:229861696-229861718 GTGGGAGGTGAAAGGGGAGCAGG + Intergenic
923280231 1:232436576-232436598 CTGGGACAGGAGAGGAAAGCAGG + Intronic
923422409 1:233830292-233830314 ATGGAAGGTGAAAGGGAAGCAGG + Intergenic
923729888 1:236539958-236539980 CTGGCATTTGAGAGGGAGGGAGG + Intronic
923931876 1:238709765-238709787 TTGGGATGTAGGAGGAAAGCAGG - Intergenic
1062874681 10:933372-933394 CTGGGATTAGAGATGGGAGCCGG + Intergenic
1063112339 10:3047901-3047923 CGGGGAGGGGAGAGAGAAGCAGG - Intergenic
1063630106 10:7725436-7725458 CTGAGAAGTGAGAGGCAAGGTGG + Intronic
1063986709 10:11512308-11512330 CTGGGAAGTGAGAGAGAAGGAGG - Intronic
1064780328 10:18830603-18830625 CTGGGAAGTGAGAGGGGAGAGGG + Intergenic
1065187966 10:23187707-23187729 CTTTGAAGTGTGAGGGAAGCAGG + Intergenic
1065488142 10:26254529-26254551 CATGGATGTGAGAGAGAACCTGG + Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065780440 10:29161929-29161951 CTGGGATGGGATGGGGGAGCTGG - Intergenic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1066695723 10:38076066-38076088 GTGGGATGTGAAGGGGAAGTAGG + Intergenic
1066981484 10:42420202-42420224 CTGGGATGGGACAGGGACACAGG + Intergenic
1067267278 10:44757130-44757152 ATGGGAGGTGAGAGGGAATGGGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067879972 10:50034773-50034795 CTGCCATGTGAGAGGGGAGAGGG + Intergenic
1067891911 10:50144607-50144629 CTGCCATGTGAGAGGGGAGAGGG - Intergenic
1069819367 10:71217941-71217963 CTGGGAGGTGAGAAGGAGGGCGG - Intronic
1069906203 10:71734082-71734104 GTGGAATGTGAGAGAGAAGAAGG + Intronic
1069935071 10:71909797-71909819 CTTGGAGGTTAGAGGGAAGATGG + Intergenic
1070566779 10:77609438-77609460 CTGGGATGGGAGAGGAATGCTGG + Intronic
1070741364 10:78905417-78905439 CTGGGCTGAGAGATGGGAGCAGG - Intergenic
1070750397 10:78960836-78960858 CTGGGATGTGGAAGGGAGGTGGG - Intergenic
1070953274 10:80447703-80447725 CTGGAATGTGGGTGGGAAGCTGG + Intergenic
1071361049 10:84846306-84846328 CTGGCATGTGAGTGGAAAGTGGG + Intergenic
1071511156 10:86263359-86263381 CTGGGAAATGAGACGGCAGCGGG + Intronic
1071935968 10:90530988-90531010 ATGGAATGTGAAGGGGAAGCAGG - Intergenic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1072421185 10:95291302-95291324 GTGCTAGGTGAGAGGGAAGCAGG + Intergenic
1072430004 10:95362518-95362540 CTGGGTTGTGTGATGGAAGATGG - Intronic
1073143941 10:101266863-101266885 CTGGGGTGAGAGAGGGAATGGGG - Intergenic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1073822356 10:107278970-107278992 CTGGGATGTGTGAAGGAACCTGG + Intergenic
1074234111 10:111567625-111567647 TTGGGATCTGAAAGAGAAGCAGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1075101661 10:119510413-119510435 CTGGGATCTGAATGGCAAGCGGG - Intronic
1075144110 10:119868798-119868820 ATGGGATGGGAGGGGGAATCAGG + Intronic
1075221441 10:120588367-120588389 CTGGGAGGCAAGAGGGGAGCAGG - Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1076716411 10:132366472-132366494 CTGGGCTGTGGGAGAGACGCAGG + Intronic
1076735830 10:132458535-132458557 CTGGGACTGGAGACGGAAGCTGG + Intergenic
1076811324 10:132888082-132888104 CTGGGATGAGAGAGGGAGAGGGG - Intronic
1077062801 11:625220-625242 CTAGGGTGTGGGAGAGAAGCTGG + Intronic
1077391703 11:2303354-2303376 CTGGGATGTGGGTGGGGAGGGGG + Intronic
1077417527 11:2431699-2431721 CTGAGATCTGAGTGGGAAGAGGG - Intergenic
1077580875 11:3416503-3416525 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1077634927 11:3835920-3835942 CTGGGCTGGGAGGAGGAAGCTGG + Intronic
1078182314 11:9022392-9022414 CAGGTAAGTGAGATGGAAGCTGG - Intronic
1078758523 11:14233603-14233625 CTGGCTTGTGAGAGGTATGCAGG - Intronic
1079645009 11:22852230-22852252 CTGGGAGGTGAAAGGCAAGATGG - Intronic
1079817365 11:25077983-25078005 CTGGTCTGTGAGAGGGAGGGTGG - Intronic
1080281538 11:30563136-30563158 GTGGGATGTCTGGGGGAAGCTGG - Intronic
1080349684 11:31369476-31369498 CTGGGGTGAGAGAGGGGTGCGGG - Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1081773585 11:45664089-45664111 CAGGGACGTCAGAGGCAAGCAGG - Intronic
1083607420 11:63986986-63987008 CTGGGATGTGAGGGGCCTGCGGG + Intronic
1083681064 11:64352107-64352129 CTAGGATGGAGGAGGGAAGCAGG - Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083994168 11:66264023-66264045 CTGGGATGGGAGAGGGAGCCAGG - Intronic
1084233493 11:67770369-67770391 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1084237802 11:67799337-67799359 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084526039 11:69698560-69698582 GTGGGCTGGGAGATGGAAGCAGG + Exonic
1084834606 11:71793496-71793518 CTGGGCTGTGAGGGGGAGGAGGG - Intronic
1085040428 11:73323580-73323602 CAGGCATCTGACAGGGAAGCAGG - Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085398260 11:76218687-76218709 CTAGGATGTTAGTGGGAGGCAGG - Intergenic
1085861079 11:80236720-80236742 CTGGGATGAGAGAGAGGATCAGG + Intergenic
1087955044 11:104275925-104275947 CTGGGATATGAATGGGAAGAGGG + Intergenic
1088764245 11:112961328-112961350 CTGGGATGGGAGCGAGGAGCGGG - Exonic
1089101537 11:115966525-115966547 GTGGGCTGTGTGAGGGAAGCTGG + Intergenic
1089505154 11:118957681-118957703 CTGAGATGGGAAAGGGAGGCGGG - Intronic
1089621647 11:119726152-119726174 CTGGGCTGTGACAGGGAACCTGG - Intronic
1089668253 11:120033906-120033928 CTGGAATGAGAGGGGGAAGATGG + Intergenic
1090212357 11:124930393-124930415 CAGGGATGTGAGAGAAAATCAGG + Intronic
1090255486 11:125280879-125280901 CTAGGGGGTGAGTGGGAAGCGGG - Intronic
1090325377 11:125881809-125881831 TTGGGATGTGAAAGAGAGGCAGG - Intergenic
1090420772 11:126573453-126573475 CTGGGGTGGGTGGGGGAAGCGGG - Intronic
1090903113 11:131049905-131049927 ATGGTATGAGAGAGGGAGGCAGG - Intergenic
1091207718 11:133832928-133832950 CTGGGCTGGGAGGGGGACGCGGG + Intergenic
1091267739 11:134283681-134283703 ACGGGTTGGGAGAGGGAAGCAGG - Intronic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092408475 12:8236934-8236956 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094472491 12:30816792-30816814 CTGGGAGCTGGGAGGGGAGCAGG + Intergenic
1095189941 12:39246135-39246157 TTGGGTTGAGATAGGGAAGCTGG - Intergenic
1095632925 12:44399113-44399135 CTGAGATGGGAGAGGTGAGCAGG + Intergenic
1095921186 12:47532844-47532866 CTGGTGTATGAGAGGGATGCAGG - Intergenic
1096493047 12:52023418-52023440 CTGGGATCTGGGAAGGAAGCAGG + Intronic
1096510972 12:52128127-52128149 TTTGGATGTGAGATGCAAGCAGG + Intergenic
1096626333 12:52898421-52898443 CTGGGATGAGGGCGGGAGGCAGG - Intronic
1096839240 12:54370560-54370582 CGGGGAGGAGAGAGGGACGCGGG - Intronic
1098966771 12:76798732-76798754 GTGGGAGGTGAAGGGGAAGCAGG + Intronic
1099373863 12:81872077-81872099 ATGTGATGTGAGAGAGAAGGAGG - Intergenic
1099694458 12:85999864-85999886 CTGGGAGGGGAGATGGAAGCTGG + Intronic
1099741707 12:86645254-86645276 CTGGGATGGAAGAGGCTAGCAGG + Intronic
1099918156 12:88922126-88922148 CAGGGATGGAAGAGGGAAGCAGG + Intergenic
1100737641 12:97554912-97554934 CTGGCATGTGATATGAAAGCAGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101273959 12:103178799-103178821 GAGGGATGTGAGAGGGTAGGAGG + Intergenic
1101787795 12:107900879-107900901 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
1102520778 12:113476552-113476574 CAGGGATGCGAGAGGGATGGCGG + Intergenic
1102547334 12:113666263-113666285 ATGGGGAGGGAGAGGGAAGCCGG + Intergenic
1102641261 12:114368860-114368882 CTGAGATGGCACAGGGAAGCTGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103906970 12:124332791-124332813 GTGGGACCTGAGAAGGAAGCTGG - Intronic
1103964539 12:124630425-124630447 CTGGGCTGGGTGAGAGAAGCAGG + Intergenic
1104282546 12:127391148-127391170 CTGGGAAGTCAGAGAGCAGCAGG - Intergenic
1105014386 12:132777321-132777343 CTGGGATCTGTGAGGGGTGCCGG - Intronic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1106013700 13:25848291-25848313 CTGGGAGGGGAGAGGCAAGATGG + Intronic
1106218233 13:27721965-27721987 CTGGGATGTGGGAGTGAGGGTGG + Intergenic
1107142979 13:37024046-37024068 CTGGCAGGTGATAGGGCAGCTGG + Exonic
1107874445 13:44777713-44777735 CAGGGATGGGAGAGGGTAGGGGG + Intergenic
1108279763 13:48849765-48849787 GTGGGAGGTGAAGGGGAAGCAGG - Intergenic
1110584490 13:77172410-77172432 CTGGTATGAGAATGGGAAGCTGG + Intronic
1110733134 13:78904484-78904506 GTGGGATGAGAGCGTGAAGCAGG - Intergenic
1111266570 13:85822866-85822888 CTTGGATGTGAGAGGAGAGCTGG + Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112455087 13:99553058-99553080 CTGGAGGGTGAGAGGGAAACTGG - Intronic
1112621564 13:101058781-101058803 CTCGCATGGGAGAGGGAGGCAGG - Intronic
1112694089 13:101927975-101927997 CGGGGATGAAAGAGGGAAACGGG - Intronic
1113457333 13:110458040-110458062 CTGGGAGGGGAGAGGTGAGCAGG - Intronic
1113764939 13:112875222-112875244 CTGGGATGTGAAAGGCGATCAGG + Intronic
1113917103 13:113880983-113881005 CTGGGCTGTGTGATGGAGGCTGG - Intergenic
1115442545 14:33453046-33453068 CTGGCATCTGTGAGGGAATCAGG - Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118334535 14:64841720-64841742 ATGGGATGTCAGAGGGCAGCTGG - Intronic
1118362270 14:65066425-65066447 CTTGGATGTGCCAGAGAAGCGGG - Intronic
1119037943 14:71246398-71246420 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
1119472717 14:74909648-74909670 CTGGAGTGTGAGAGAGGAGCAGG - Exonic
1119545339 14:75467790-75467812 CTGGGACGTGACTGGGAAGCTGG - Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120915083 14:89703439-89703461 GTGGGAAGTGAAAGAGAAGCAGG + Intergenic
1120963965 14:90151043-90151065 CAGGGAGGTGAAGGGGAAGCAGG - Intronic
1121103468 14:91265123-91265145 GTGGAAGGTGAGAGAGAAGCCGG + Intergenic
1121175910 14:91890467-91890489 CTGGAATTTGAGGGGGAAGTCGG + Intronic
1121318663 14:92977703-92977725 GTGGAAGGTGAAAGGGAAGCAGG - Intronic
1121601257 14:95204913-95204935 CTGGTATGAGAGAGTGAATCTGG + Intronic
1122102546 14:99424826-99424848 CAGGGAAGTGAGAGAGAAGCCGG + Intronic
1122283192 14:100636294-100636316 CCTGGATGTGAGTGGGAAGGAGG - Intergenic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122305934 14:100766443-100766465 CTGGGTGGTGAGCGTGAAGCTGG + Intergenic
1122767400 14:104081802-104081824 ATGGGAAGTGAGAGAGAAGAGGG + Intergenic
1122848064 14:104511459-104511481 CTGGGGTGTGGGTGGGAGGCTGG - Intronic
1123174115 14:106401298-106401320 CAGGGATGCGAGGGGGCAGCTGG - Intergenic
1123182324 14:106482232-106482254 CAGGGATGCGAGGGGGCAGCTGG - Intergenic
1202944579 14_KI270726v1_random:14498-14520 CAGGGATGCGAGGGGGCAGCTGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124867188 15:33503993-33504015 CTGGGATAAGAGAGGGGAGTAGG - Intronic
1125277472 15:38008380-38008402 CAGGGATGATAGAGGGAAGGGGG + Intergenic
1125332009 15:38591644-38591666 CTGTGATGGGAAGGGGAAGCTGG + Intergenic
1126098811 15:45107488-45107510 CTGGGATGGGAAGGGGATGCAGG + Intronic
1126104926 15:45141245-45141267 CTGGGATGGGAAGGGGATGCAGG - Intronic
1126748490 15:51851186-51851208 CTGGGCTGTGAGAAGAAAGAAGG + Intronic
1126817310 15:52466537-52466559 CTGGGGTGTAAGAGGGAAGCAGG + Intronic
1127484969 15:59410499-59410521 CTGGGATGAGTGAGGCAAGAAGG + Intronic
1128991349 15:72263133-72263155 TAGGGATATGAGAGGGGAGCAGG - Intronic
1129356942 15:74997575-74997597 GTGGGATGTGAGAAGGTAGCAGG + Intronic
1129450808 15:75650169-75650191 CTGGAAGGTGAGCAGGAAGCTGG - Exonic
1129908071 15:79203710-79203732 CTGGCTTGTGAGATGGAAGTGGG - Intergenic
1130717327 15:86348068-86348090 CTGGGAGGTGAAAGAGAAGTAGG - Intronic
1131034740 15:89214872-89214894 CTAGGATGTGCCAGGGCAGCTGG - Intronic
1131230531 15:90655666-90655688 TTGGGTTGGGACAGGGAAGCTGG - Intergenic
1131801264 15:96071722-96071744 CTGTGATGTGACAGGGCATCTGG - Intergenic
1133033202 16:3021313-3021335 CTGGGCTGTGAGTGGGGGGCAGG + Exonic
1133349437 16:5091757-5091779 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1133453297 16:5921411-5921433 CTGGGATGTGTGGGGGGAGTAGG + Intergenic
1133839540 16:9394891-9394913 GAGGGAGGGGAGAGGGAAGCAGG - Intergenic
1135115869 16:19723010-19723032 GTGGAAAGTGAAAGGGAAGCAGG - Intronic
1135154192 16:20038198-20038220 CAGGGATGTGAAAGGGAAAGTGG - Intronic
1136474669 16:30505294-30505316 CTGGGAGGTAAGAGGGGAGAAGG + Exonic
1136687290 16:32002922-32002944 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1136787902 16:32946473-32946495 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1136881879 16:33907316-33907338 CTGGGGTGGCACAGGGAAGCTGG + Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138757866 16:59510389-59510411 CTGGGCTGTGAGTGGGTTGCTGG + Intergenic
1139924389 16:70478209-70478231 CTAGGCTGGGAGAGTGAAGCTGG + Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1142139674 16:88467292-88467314 CTGGGATGTGTGTGAGAACCAGG - Intronic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1203090132 16_KI270728v1_random:1208130-1208152 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1143449114 17:7025129-7025151 CTGGGATGTGAGGAGGTAGGGGG - Exonic
1143566232 17:7722558-7722580 CTGGGATCTGCGGGGGAAGGGGG - Intronic
1143655395 17:8290806-8290828 CTGGGATGCAGGCGGGAAGCAGG - Intronic
1143756687 17:9072656-9072678 ATGGGAAGTGAGTGGGAGGCAGG + Intronic
1144052619 17:11509960-11509982 CTGAGATGGGAGAGGTAAGAAGG + Intronic
1144624524 17:16837977-16837999 CAGGAGTGTGAGCGGGAAGCTGG + Intergenic
1144881903 17:18434743-18434765 CAGGAGTGTGAGCGGGAAGCTGG - Intergenic
1145126706 17:20306606-20306628 CAGGGAGGTGATAAGGAAGCTGG + Intronic
1145150330 17:20509643-20509665 CAGGAGTGTGAGCGGGAAGCTGG + Intergenic
1145973073 17:28968307-28968329 CTGGGAGCTGAGAAGGAGGCAGG + Intronic
1146162257 17:30566284-30566306 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1146257030 17:31397578-31397600 CTGGGACCTGAGGTGGAAGCAGG + Intronic
1146685747 17:34840587-34840609 CTGGTATTTGGGAGGGCAGCAGG - Intergenic
1147148269 17:38498591-38498613 CTGGGGTGGCACAGGGAAGCTGG - Intronic
1147578654 17:41616698-41616720 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1147685999 17:42287364-42287386 CTGTGCTGTGAGTGGGCAGCTGG + Intergenic
1147882417 17:43662718-43662740 GGGGGATGAGAAAGGGAAGCAGG - Intergenic
1148074870 17:44929457-44929479 CCAGGATGTGAGTGGGAAACTGG - Intronic
1148132486 17:45270501-45270523 CTGGGCTGTGAGAGGGGCGCAGG + Exonic
1148137062 17:45300308-45300330 GTGGGAGGTCAGAGAGAAGCTGG - Intronic
1148181026 17:45604997-45605019 CAGGTATTTGAGAGGGAGGCAGG - Intergenic
1148267883 17:46240931-46240953 CAGGTATTTGAGAGGGAGGCAGG + Intergenic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1148479042 17:47948017-47948039 CAGGGAAGTTACAGGGAAGCAGG + Exonic
1150129302 17:62658378-62658400 CTAGGATGTCAGAGGGAGGAGGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1151146387 17:72045496-72045518 ATGGAAGGTGAAAGGGAAGCAGG + Intergenic
1151563574 17:74884186-74884208 TTGGGATGAGAGAGGGACCCTGG - Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152502357 17:80720903-80720925 GTGTGGTGTGAGAGGCAAGCAGG + Intronic
1152586721 17:81192642-81192664 CAGGGATGGGAGAGGTCAGCGGG + Intronic
1152662736 17:81550491-81550513 CTGGGATGAGTCCGGGAAGCTGG - Exonic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153440967 18:5118507-5118529 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
1153914550 18:9734062-9734084 CAGTTATGTGAGATGGAAGCTGG + Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155556136 18:27021171-27021193 GTGGGAGGTGAGAGGGTAGGAGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156471068 18:37377554-37377576 CTTAGAAATGAGAGGGAAGCTGG + Intronic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1157204234 18:45685142-45685164 CAGGAATGTGAGAGGGAAAAGGG + Intergenic
1157386680 18:47263863-47263885 CTAGGCTGAGAGAGGGAAGAGGG - Intergenic
1157389202 18:47287313-47287335 GTGGGAGGTGAAAGGGAAGCAGG - Intergenic
1157425763 18:47583016-47583038 CTGAGAAGTGAGAGTTAAGCTGG + Intergenic
1157598773 18:48879799-48879821 CTGTGATGTGAGTGGTGAGCAGG + Intergenic
1157940182 18:51920052-51920074 ATGGGATATGAGACGGAAGCAGG - Intergenic
1158307874 18:56126524-56126546 AAGGGATGTGAGGGGCAAGCTGG - Intergenic
1158803117 18:60936766-60936788 GTGGAAGGTGAAAGGGAAGCAGG + Intergenic
1158906088 18:62013191-62013213 CTGAGATGGAAGAGGGATGCTGG - Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159174811 18:64818863-64818885 CTGGCATTTGAGAGGGAAATGGG - Intergenic
1159888054 18:73928118-73928140 CTGGGCTCTCAGTGGGAAGCAGG + Intergenic
1159930198 18:74304219-74304241 CTGGGATGTGAGGGCAAAGCAGG + Intergenic
1160337017 18:78051200-78051222 CTGGCAGGTGAGAGGGACCCAGG + Intergenic
1160745351 19:708844-708866 CGGGGAGGTGGGAGGGGAGCGGG + Intergenic
1161152756 19:2718201-2718223 CTGGGAAGAGAGGGGGAAGCTGG - Intronic
1161228542 19:3160266-3160288 ATGAGATGGGAGAGGGAGGCAGG - Intronic
1161437514 19:4272759-4272781 GTGGGGTGTGAGAGGGGAGGAGG - Intergenic
1161457990 19:4379524-4379546 CTGGGGTGTGAGACAGCAGCAGG - Intronic
1161590506 19:5127212-5127234 CTGGCCTGAGGGAGGGAAGCGGG - Intronic
1161857828 19:6775817-6775839 ATGGGATGTGAAAGGGTAGAGGG + Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163234989 19:16024843-16024865 CTGGGGTGAGAGAGAGAGGCAGG + Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1167024327 19:46904129-46904151 CTGGGATGGGGGTGGGAAGTGGG + Intergenic
1167377535 19:49119801-49119823 CTGGGATGAGGAAGGGAATCCGG - Intronic
1167678579 19:50905250-50905272 CTGGGATGGGAGAGGGGAATAGG - Intergenic
1168145660 19:54419017-54419039 CTGGGATGTCAGAGTGAAGGTGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
925180086 2:1811850-1811872 CTGGGATCTGATGGGGAGGCAGG - Intronic
925286543 2:2719966-2719988 CTTGGAGGTGAGAGGGAAGGTGG + Intergenic
925293286 2:2762504-2762526 CTGGGTTGTGTGAGGGGATCTGG + Intergenic
926006736 2:9378605-9378627 GTGGGACGTGAGAAGGACGCTGG + Intronic
926127834 2:10282860-10282882 CAGGGCTGTGAGGGTGAAGCTGG + Intergenic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
926742802 2:16126193-16126215 CTGGGTTGGGTGTGGGAAGCAGG + Intergenic
927096445 2:19750987-19751009 GTTGGATATGAGAGGGAAGGAGG - Intergenic
927331626 2:21871299-21871321 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
927507222 2:23622369-23622391 CTGTGATGTGAGCGGGATGGTGG - Intronic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
927773625 2:25884963-25884985 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
927948938 2:27154568-27154590 CTGGGATGTGGGAGAACAGCTGG + Exonic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928068829 2:28194157-28194179 CTGGTCAGTGAGAGGGAAGTGGG + Intronic
928119109 2:28569167-28569189 CTAGGATGTGAGAAAGAAACTGG - Intronic
928224478 2:29436367-29436389 CTGGGAAGTGATTAGGAAGCAGG - Intronic
929057287 2:37889318-37889340 TGGGGAAGTGAGAGTGAAGCAGG + Intergenic
929086939 2:38177404-38177426 TTGGGATGTTAGAGTCAAGCAGG - Intergenic
929252427 2:39774029-39774051 CTGGGATGTCAGAGGAAACTGGG - Intronic
929713197 2:44285420-44285442 CAGAGATGTGGGAGGGCAGCCGG + Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
929880861 2:45836556-45836578 CTGGCATGGGAGAGGCCAGCTGG - Intronic
930104037 2:47626278-47626300 ACAGGATGTGAGAGGGAAGGTGG + Intergenic
930671823 2:54159649-54159671 CTGGGGTGAGAGAGGTAGGCAGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931333959 2:61320399-61320421 TTGGGATGTGGGAGGAAACCAGG + Intronic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
932308121 2:70718316-70718338 ACTGGATGTGAGAGGGAAGATGG + Intronic
933728162 2:85437950-85437972 CTGGGATGCAAGCGGGAGGCTGG + Intergenic
933778760 2:85787436-85787458 AGGGGCTGTGAGAGGGAGGCTGG + Exonic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
935382875 2:102470820-102470842 CTGGTGTGTGAGTGGGATGCTGG + Intergenic
935418933 2:102846461-102846483 CTGGGGTGTGAGTGTGAAGGCGG + Intergenic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936529870 2:113268727-113268749 CTGGGATGGGTGAGGACAGCTGG + Intronic
936973650 2:118198283-118198305 ATGGCAGGTGAGAAGGAAGCAGG - Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
937384146 2:121411210-121411232 TTCTGATATGAGAGGGAAGCGGG + Intronic
937651892 2:124328487-124328509 CTGGGGTGTGAGAAGGGAGAAGG - Intronic
937951621 2:127392322-127392344 ATGGAAAGTGAGGGGGAAGCAGG - Intergenic
938099109 2:128486151-128486173 TTGGGAGGTGAGAGGGAAAGAGG + Intergenic
938120891 2:128632349-128632371 AAGGAATGAGAGAGGGAAGCTGG - Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940521027 2:154748041-154748063 TTGGGATGGGAGATGGAGGCAGG - Intronic
941477383 2:165966661-165966683 CTGTGTTGTGAGAGGGACCCAGG + Intergenic
941766308 2:169300732-169300754 CTGTGATGTGACAGGTAAGATGG + Intronic
941779347 2:169427168-169427190 CTAGGCTGTGAATGGGAAGCTGG + Intergenic
943054455 2:182958640-182958662 CTTAGATGTGTGAGAGAAGCAGG + Intronic
943138566 2:183948572-183948594 CTAGTATGTGAGAGTGAAGTAGG + Intergenic
943351997 2:186806522-186806544 CTGGGATGTGTGAGGGAGTCTGG + Intergenic
945025563 2:205616611-205616633 CTGGAATGTGGGAGGGAGGAAGG - Intronic
945333929 2:208569750-208569772 CTGAGGTGTGAGAGGAAAGCAGG + Intronic
945849489 2:214988420-214988442 CTGGGATGTGAGGTGGGAGCAGG - Intronic
945989263 2:216380170-216380192 CTGGGATGCGACAGGCAAGGAGG - Intergenic
946634375 2:221708035-221708057 GTGGGATGTAAGAGGTAAGGAGG - Intergenic
947354496 2:229277770-229277792 CTGGGAGGTGGTAGGGTAGCAGG + Intergenic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
1169012479 20:2262026-2262048 CTGGGTTGTGATAGTGAAGCTGG - Intergenic
1169142904 20:3236146-3236168 CTGGGATGTGCCAAGGAAACTGG - Intronic
1169550565 20:6697505-6697527 CCGTGATGTGAGAGAGAAGTTGG + Intergenic
1171121366 20:22571830-22571852 CTGGGAAGGGAGAGGCAAGAGGG + Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1171959938 20:31486017-31486039 CTGGGAGGTGAGAGGGCGGGAGG + Intergenic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1173162147 20:40661032-40661054 CTGGGATGTGGGAGTGAGGGTGG + Intergenic
1173182041 20:40813084-40813106 CTGGGATGGGAGAGGGATGGTGG + Intergenic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1173490560 20:43476632-43476654 ATGGGATGTGGGAGGAAACCAGG + Intergenic
1173527657 20:43745296-43745318 CTGGGAGGAGAGAGAGAAGTAGG - Intergenic
1173961205 20:47073923-47073945 CGGGGAAGTGAGAGAGATGCGGG - Intronic
1174130536 20:48340828-48340850 CTGGGCTGCGGGAGGCAAGCTGG - Intergenic
1174136334 20:48382635-48382657 CAGGGAGGTGACAGGGAACCTGG + Intergenic
1174563059 20:51445003-51445025 CTGGGAGGTGAGTGAGCAGCTGG - Intronic
1174897105 20:54461614-54461636 CTGGGATGTGAAAGGCAAATAGG + Intergenic
1175084216 20:56445335-56445357 CTGGGCTGAGGCAGGGAAGCAGG - Intronic
1175681812 20:60994783-60994805 GTGGGATGGGGGAGGGAGGCAGG - Intergenic
1175698016 20:61117039-61117061 ATGAGATGTTAGAGGGAAACTGG - Intergenic
1175789612 20:61733033-61733055 CTGGGCTGTGTGGGGGCAGCAGG + Intronic
1175830595 20:61963317-61963339 CGGGATTGAGAGAGGGAAGCAGG - Intronic
1175999966 20:62827292-62827314 CTCGTAAGTGAGAGGGAAGTTGG + Exonic
1176725079 21:10424917-10424939 CAGTCATGTGAAAGGGAAGCTGG + Intergenic
1179565967 21:42249211-42249233 CTGGGATGAGGGAGGGGCGCCGG + Intronic
1179720423 21:43313338-43313360 CTGGGATGTGGAGGGGAACCTGG + Intergenic
1179999979 21:44991188-44991210 CTGGGATGGGAGACTGAGGCCGG + Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180660589 22:17463606-17463628 CTGGGGAGTTAGAGGGAATCAGG + Intronic
1180763064 22:18223550-18223572 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1180772579 22:18400997-18401019 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180803959 22:18650613-18650635 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180806804 22:18718836-18718858 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1181043833 22:20205347-20205369 CAGGCGTGTGAGAGGGAAGTGGG - Intergenic
1181179068 22:21054651-21054673 CTGAGAAGTCAGAGAGAAGCGGG + Intronic
1181217760 22:21344646-21344668 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1181947501 22:26529479-26529501 CTGGGAGGGGAGAGGGGAGAGGG + Intronic
1181956262 22:26589877-26589899 CTGGGATCTGGGAGGCAGGCAGG - Intronic
1182440880 22:30363125-30363147 CTGGGGTGTGAGCTGGCAGCTGG - Intronic
1182800897 22:33031363-33031385 CTGGGAGGTGAGAGGAAGGGAGG - Intronic
1183244979 22:36686473-36686495 CTGGCATGTAAGAGGGAGGAAGG + Intronic
1183265778 22:36824214-36824236 CTGGAGTGTGAAAGGGGAGCAGG + Intergenic
1183307638 22:37091264-37091286 CTGGGATGTGGGAGGCAGCCTGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183362081 22:37387967-37387989 CTGGGAACTGGGAGAGAAGCAGG - Intronic
1185026883 22:48419530-48419552 CTGGGATCTGAGCTGGGAGCAGG - Intergenic
1185052855 22:48562890-48562912 CGGGGCTGTGAGAGGAAAGAGGG - Intronic
1185058668 22:48594154-48594176 AGGGGCGGTGAGAGGGAAGCAGG + Intronic
1203234417 22_KI270731v1_random:141985-142007 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
949548089 3:5089763-5089785 ATGGGAAATGAGAGGGAAGGGGG + Intergenic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950716391 3:14850553-14850575 CTGGGATGAGATGGGGAAACTGG + Intronic
950796214 3:15512417-15512439 CTGGGCTGGGAGATGGAAGAGGG + Intronic
950965642 3:17143993-17144015 CTGGGGTGTGTGAGGAAAGCTGG + Intergenic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
951734401 3:25848595-25848617 TTGGGATGTGGGAGGAAACCAGG - Intergenic
952173088 3:30830931-30830953 ATGGGAGATGAGAGAGAAGCAGG - Intronic
952739206 3:36719572-36719594 CAGGGATGAGAGAAGGAAGGAGG - Intronic
953260793 3:41337319-41337341 TTGGGATGAGAGAGGAATGCAGG + Intronic
953473347 3:43185036-43185058 CAGGGATGGAACAGGGAAGCGGG + Intergenic
953479983 3:43243079-43243101 CTATGATGTTAGAGGGAAGTTGG - Intergenic
953609094 3:44432774-44432796 CAGGGATGTAAGAGGGAAGCTGG - Intergenic
953786487 3:45915371-45915393 CTGGCTTGAGAGAGGAAAGCTGG - Intronic
953814905 3:46147193-46147215 CTGGCATGAGTGAGGGAAGGAGG + Intergenic
954899315 3:54005544-54005566 CTGGGATGTGGGTGGCAAACAGG + Intergenic
954927688 3:54251214-54251236 TTGGGGTGAGAGAGGAAAGCAGG + Intronic
954940435 3:54367413-54367435 ATGGGATGAGAGAAGAAAGCCGG + Intronic
954977215 3:54707495-54707517 CTAGGATTTGAGTGGGAAGGAGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955060511 3:55488479-55488501 CTGGAAAGAGAGAGGGAAGGGGG + Intronic
955085955 3:55703125-55703147 ATGGGAGGTGAGAGTGCAGCAGG - Intronic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
955377854 3:58412913-58412935 CGGGGACGTGAGAGGTGAGCTGG - Exonic
955386872 3:58487430-58487452 CTGGGAAGTGAGGGGGAGGGAGG + Intergenic
956712211 3:72048638-72048660 CTCTGCTGTGTGAGGGAAGCAGG + Intergenic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
956957652 3:74359064-74359086 CTGGGATGTCACTGGGAGGCAGG + Intronic
957050779 3:75410268-75410290 CTGGCAAGTGAGATGGATGCTGG + Intergenic
957053745 3:75429099-75429121 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
959858191 3:111186141-111186163 CAAGGATGTGACAGGGAAGCTGG + Intronic
961301100 3:125922580-125922602 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
961887425 3:130105493-130105515 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
962046548 3:131765989-131766011 CTGGGCTATGACAGGGAAGGTGG + Intronic
963108218 3:141664491-141664513 CTTGGATGTGAGGGGGAAAGAGG + Intergenic
963294937 3:143536168-143536190 CTGGAAAGTGAGAGGTAAGCTGG + Intronic
963617433 3:147559461-147559483 GTGGAAGGTGACAGGGAAGCAGG - Intergenic
963640573 3:147857407-147857429 GTGGGAGGTGAAGGGGAAGCAGG + Intergenic
966423624 3:179758240-179758262 CTGGCATGTGAGAGGTTTGCTGG + Intronic
966440849 3:179942580-179942602 CTGGGTCGAGAGAGGGAATCCGG - Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
966778856 3:183566229-183566251 GTGGGATGGGAGAGGTAGGCAGG + Intergenic
967282173 3:187833173-187833195 CTGGCATCTAAAAGGGAAGCTGG + Intergenic
967594374 3:191312859-191312881 CTGGGAGTTGTGAGGGCAGCTGG + Intronic
967663551 3:192143973-192143995 AAGGGATGAGAGAGGGAAGAAGG + Exonic
967793725 3:193575971-193575993 CTGGGATGGGGCAGGGAAGAAGG + Intronic
968036678 3:195553713-195553735 GTGGGAAGTGAGGGGGAAGTAGG - Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968754763 4:2409521-2409543 CTGAGATGTGAGTGGCAAGGGGG - Intronic
968996549 4:3949411-3949433 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
969069365 4:4522156-4522178 CTGACATGTGAAAGGAAAGCAGG - Intronic
969757451 4:9159271-9159293 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969817411 4:9696807-9696829 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
970014799 4:11501453-11501475 TTGAGATGTGAGAGAGAAGCTGG + Intergenic
971055048 4:22903033-22903055 ATGGGAGGTGAAAGGGAAGCAGG + Intergenic
971302994 4:25457045-25457067 CTGGCATCTGTGAGGGAAGCAGG - Intergenic
971394495 4:26215807-26215829 CAAGGAGGTGAGAGGGATGCGGG - Intronic
971831510 4:31701623-31701645 CTGGGAAGGGAGTGGGAAGGTGG - Intergenic
972339331 4:38137405-38137427 CTGGAAGGAGAGAAGGAAGCGGG + Exonic
972349127 4:38220178-38220200 GTGGAAGGTGAAAGGGAAGCAGG + Intergenic
972639821 4:40915204-40915226 ACGAGATGAGAGAGGGAAGCAGG - Intronic
973261328 4:48166948-48166970 CTGGGAGGTGAGAGGGCAGGTGG + Intronic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
974942238 4:68483201-68483223 GTGGGAGGTGAAAGGGGAGCAGG + Intronic
975568992 4:75792811-75792833 GTGGGAAGTTAGAGGGAAGATGG - Intronic
975948173 4:79734457-79734479 CTGGAAGGTGAAGGGGAAGCAGG + Intergenic
976298225 4:83493331-83493353 CTGGAGTGTGAGAGGGAGGGAGG + Intronic
976779058 4:88738378-88738400 CTGGGATGAGGGATGGGAGCAGG + Intronic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
977491845 4:97723746-97723768 GTGGAAGGTGAAAGGGAAGCAGG + Intronic
978210212 4:106126142-106126164 CTGAGATTTGAAAGGCAAGCAGG - Intronic
978232978 4:106423365-106423387 CTGGGAGGTGAGTGGGCTGCAGG + Intergenic
978489954 4:109302211-109302233 CTGGGAGGAGAGAAGAAAGCGGG - Exonic
979266820 4:118713079-118713101 CTGGGAAGTGAGAATCAAGCAGG + Exonic
980100471 4:128536739-128536761 GTGAGGTGTGAGAGGAAAGCAGG + Intergenic
981232970 4:142380063-142380085 CTGGGATTTGTGAGTGAAACTGG - Intronic
981926966 4:150151043-150151065 CTGGGATGTGGCAGGAGAGCTGG - Intronic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
982805388 4:159756119-159756141 ATGGAATGTGAAGGGGAAGCAGG - Intergenic
985682331 5:1262969-1262991 TAAGGCTGTGAGAGGGAAGCAGG + Intronic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
986302564 5:6489870-6489892 CTGGGATGTGAATGGGGACCAGG - Intronic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
987283456 5:16434699-16434721 CTGGGAGGGGTGAGGGAAGCAGG + Intergenic
989195109 5:38708870-38708892 TTGGGATGTGAGTGGCAAGAAGG - Intergenic
989343263 5:40400847-40400869 ATGGGATGGGATAGGGGAGCAGG + Intergenic
989566405 5:42905568-42905590 TTGGGATGTTAGTGAGAAGCAGG - Intergenic
991247427 5:64522953-64522975 GTGGGATGTGAGGGGGAAAGAGG + Intronic
991367226 5:65881747-65881769 CTGGAATGTGACAGGGGAGGAGG + Intergenic
992366091 5:76091443-76091465 CTGGGCAGTGAGAGGCAGGCTGG - Intronic
993290128 5:86056927-86056949 GTGGAAAGTGAAAGGGAAGCAGG - Intergenic
994009802 5:94888389-94888411 CTGGGATGTGCCAGGGAATTTGG + Intronic
994858122 5:105152112-105152134 CTGGGATGTGAGAAGAAGGGTGG - Intergenic
995300398 5:110574286-110574308 ATGGAATATAAGAGGGAAGCAGG + Intronic
995532271 5:113103353-113103375 CTCGGAGTTGAGAGGGAAGGAGG - Intronic
997382769 5:133449378-133449400 TGGGGTTGTGAGAGGGAGGCTGG + Intronic
997729934 5:136162230-136162252 TTGGGATGTGAGAGGAAACTCGG + Intronic
997980878 5:138466734-138466756 CTGGCAGGAGAGAGAGAAGCGGG - Intronic
998383380 5:141741734-141741756 CTGGGAGGTGGGAGGGAGGGAGG + Intergenic
998383755 5:141744078-141744100 TGGGGATGTCAGAGGGGAGCTGG - Intergenic
998480828 5:142461252-142461274 CTAGGATGAGAGTGTGAAGCAGG + Intergenic
999000715 5:147919828-147919850 CTGAGATGTGAGAGATAAGTAGG + Intergenic
999222597 5:149993473-149993495 CTGGAAAGTGAGAGGCACGCTGG + Exonic
999672247 5:153968042-153968064 TTGGGGTGTGACAGGGAGGCAGG + Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1001319560 5:170669032-170669054 CTGTGATGAGAAAGAGAAGCAGG - Intronic
1001320645 5:170678152-170678174 CTGGGATGTGAGAAGAAGGCAGG + Intronic
1001812490 5:174639618-174639640 CTGGGAAGAGAGAGGCAACCAGG + Intergenic
1001823948 5:174731335-174731357 CTGGGCTGGGGGATGGAAGCCGG + Intergenic
1001867222 5:175116261-175116283 CTGAGATCTGAGCAGGAAGCTGG + Intergenic
1001961060 5:175880560-175880582 CTGGGATCTGGGTGGGAGGCTGG + Exonic
1002634583 5:180600783-180600805 CTGGGGTGTGAAAGGGTGGCTGG + Intergenic
1002664142 5:180810389-180810411 CCAGGTTGTGAGAAGGAAGCCGG + Intronic
1003065359 6:2900366-2900388 CTGGAGTGTGAGTGTGAAGCTGG + Intronic
1003280866 6:4690284-4690306 GTGGGAGGTGAAGGGGAAGCTGG + Intergenic
1004548316 6:16621262-16621284 CTGGGCTCTGAGACTGAAGCAGG - Intronic
1005971227 6:30763468-30763490 CTTGGAGGAGAGAGGGGAGCAGG + Intergenic
1006041529 6:31260220-31260242 CTGGGAGGTGACAGTGAGGCTGG - Intergenic
1006175007 6:32116406-32116428 CTGGGAGCTGAGGGGGAAGGGGG - Intronic
1006306334 6:33222037-33222059 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
1006502375 6:34466755-34466777 CTGGGATGGGAGCGGGGAGGGGG + Intronic
1006944733 6:37777796-37777818 CTGGGAGGGGAGAGGAAAACTGG + Intergenic
1007123349 6:39401743-39401765 CTGGCATGTGGAAGGGATGCAGG + Intronic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007696668 6:43737990-43738012 CGGGGATGTGAGAGGGAGGCTGG + Intergenic
1007799990 6:44384165-44384187 TTGGGATGTGGGAGGAAACCAGG + Intergenic
1009377795 6:62993541-62993563 GTGGAAGGTGAAAGGGAAGCAGG + Intergenic
1010083159 6:71886928-71886950 CTCCGCTGTGAGGGGGAAGCAGG + Intronic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010766571 6:79782139-79782161 GTGGGAGGTGAAAGGGAAGAAGG - Intergenic
1011065258 6:83319374-83319396 CTGGCATGTCAGAGTGATGCGGG - Intronic
1011559436 6:88599798-88599820 CTGGGAGGTGGGAGGCAGGCTGG + Intergenic
1011590529 6:88966348-88966370 CTGGGAGGGGAGAGGGAATGAGG - Intergenic
1011752106 6:90463790-90463812 CAGAGATGTGAAAGGGAAGAAGG - Intergenic
1012541038 6:100362069-100362091 CTGGAATGTGAGGGAGAAGAAGG + Intergenic
1013812273 6:114058564-114058586 CTGGGAGGTGGAAGGGTAGCAGG + Intronic
1014568008 6:122974818-122974840 CAGGGATGTGAGATGGAGGGAGG + Intergenic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1017115932 6:150976243-150976265 CTGGGAGCTGGGAGGGGAGCTGG + Intronic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017456333 6:154604479-154604501 CTGGGAGGGGACAGGGAGGCAGG - Intergenic
1017545861 6:155450237-155450259 CAGGGATGTGTGAGGGAAAGAGG + Intronic
1018052978 6:160027711-160027733 CTGGGATGTGACAGGGACCTTGG + Intronic
1018446152 6:163860792-163860814 CTGGGATCTTAATGGGAAGCCGG + Intergenic
1018558405 6:165074257-165074279 CTGGGAGGAGAGAGAGAATCAGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1019447977 7:1081281-1081303 CTGGGATTTGAGAGGGCTTCGGG + Intronic
1019533577 7:1515937-1515959 CTAGGAAGGGAGAGGGAAGGAGG - Intergenic
1019910624 7:4098627-4098649 GAGGGATGTGAGAGGGAGGATGG + Intronic
1020317095 7:6913432-6913454 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1020317853 7:6919295-6919317 CTGGCAAGTGAGATGGATGCTGG - Intergenic
1020320830 7:6937826-6937848 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1020499861 7:8904032-8904054 GTTGGAAGTGAGAGGGAAGGAGG + Intergenic
1021588741 7:22238046-22238068 CTGGGATCTGACATGGGAGCAGG + Intronic
1021960575 7:25868937-25868959 CAGGGATGGCAGAGAGAAGCAGG + Intergenic
1022093449 7:27123304-27123326 CTGGAAACTGAGAGGGACGCCGG + Intronic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1022416226 7:30179401-30179423 CTGGACTATGAGAGGGAAACAGG - Intergenic
1024005144 7:45219806-45219828 GTGGGAAGTGAGAGGGAGGGGGG + Intergenic
1026161771 7:67875761-67875783 CGGGAATGTGACAGGGCAGCAGG - Intergenic
1026308410 7:69162523-69162545 CTGGTATGTGACAGGGCAGTTGG - Intergenic
1028245927 7:88477195-88477217 CTGAGATGAGAGTGGGAAGAAGG + Intergenic
1029164214 7:98575168-98575190 CTGGGCTGTCAGAGGGCAGGGGG - Intergenic
1029585072 7:101465401-101465423 CTGGAGTGTGAGAGGGAAACAGG - Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030147667 7:106372802-106372824 GTGGAATGTGAAGGGGAAGCAGG - Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030520377 7:110590507-110590529 CTCGGATGTGGGAGGGGAGGAGG + Intergenic
1031749897 7:125558305-125558327 GTGGGAGGTGAAGGGGAAGCAGG + Intergenic
1032850751 7:135793050-135793072 CTGCGGTGTGACAAGGAAGCTGG - Intergenic
1032948093 7:136874581-136874603 CTTGGATTTGGGAGGGAAGAGGG - Intronic
1033137642 7:138798217-138798239 CTGGGAAGGGGGAGGGAAGGAGG + Intronic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1033770565 7:144546735-144546757 GTGGGAGGTGAAAGGGAAGCAGG - Intronic
1034285334 7:149880132-149880154 CTGGGATGAGAGAGGGGAAGGGG + Exonic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034612722 7:152386505-152386527 CAGTCATGTGAAAGGGAAGCTGG - Intronic
1035787292 8:2271779-2271801 CTGGGATGTGACAGAGCTGCCGG + Intergenic
1035805515 8:2449937-2449959 CTGGGATGTGACAGAGCTGCCGG - Intergenic
1036380694 8:8234599-8234621 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
1036590901 8:10167129-10167151 CTGGCATGGGAGAGGGGACCTGG - Intronic
1036848880 8:12188035-12188057 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036870241 8:12430313-12430335 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1037696545 8:21228782-21228804 GTGGAGTGGGAGAGGGAAGCAGG + Intergenic
1037819776 8:22130049-22130071 CGGGGAGGGGAGAGGGAAGGAGG + Intronic
1037953000 8:23030873-23030895 CTGGGAGGGGAGAGAAAAGCCGG + Intronic
1038546058 8:28426602-28426624 GTGGGATATGAGTGGGATGCTGG - Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038707034 8:29903817-29903839 CTGCTATGTGGGAGGGAGGCAGG + Intergenic
1040778281 8:51073724-51073746 CAGTTATCTGAGAGGGAAGCTGG + Intergenic
1040915252 8:52562451-52562473 ATGGGCTGTGAGAAGGAAGGAGG + Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1043011069 8:74882375-74882397 CTGGGGTGTCAGAGGTCAGCTGG + Intergenic
1044346622 8:91111740-91111762 CTGGGAGGAGAGAGAGGAGCAGG + Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045585870 8:103536587-103536609 GTGGAAGGTGAGGGGGAAGCAGG + Intronic
1045634254 8:104164812-104164834 TTGGGAGGTGGGAGAGAAGCAGG + Intronic
1046558154 8:115802433-115802455 CTGGGATATTACTGGGAAGCAGG + Intronic
1046778144 8:118185767-118185789 CTGGGATGTGATAGGCTAACGGG + Intergenic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1048008827 8:130440628-130440650 GTGAGGTTTGAGAGGGAAGCAGG - Intronic
1048228592 8:132614580-132614602 GCAGGATGTGAGAGGGCAGCAGG + Intronic
1048445640 8:134490823-134490845 GAGGGATGTGAGAGGGTAGTTGG - Intronic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1049437847 8:142595865-142595887 CTGGGACGTGAGGGTGAAGGTGG + Intergenic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1050307852 9:4323555-4323577 CTGAGATCTGAGAGGTAAGTAGG - Intronic
1051079091 9:13275847-13275869 CTGGGATGTGAGTGGGCAGTGGG - Intronic
1051512053 9:17889115-17889137 GTGGAAGGTGAAAGGGAAGCAGG + Intergenic
1052590128 9:30481270-30481292 CTGGGAGGAGAGAGAGAATCAGG - Intergenic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053062582 9:35043668-35043690 CTGGGTTCTGACAGAGAAGCTGG - Exonic
1054915769 9:70494077-70494099 CTGGAAGGTGAGAGGGCAGTTGG + Intergenic
1055567370 9:77582630-77582652 CTGGGATGAGGGAGTGAAGGGGG - Intronic
1055758664 9:79582864-79582886 CTGGGCTGTTGGAGAGAAGCAGG + Intronic
1056571469 9:87820424-87820446 CTGGGAGGTGAGAAAGAAGAGGG + Intergenic
1057039197 9:91835169-91835191 CTTGGAGGTGAGGGGGCAGCAGG - Intronic
1057230870 9:93320625-93320647 CTGGGATGTGACAGGGGTGGGGG + Intronic
1057306729 9:93916682-93916704 CTGGGAAGTGAGAGTGACGGGGG - Intergenic
1057705522 9:97392431-97392453 CTGGGAAGTGAAAGGGAGGCTGG - Intergenic
1057731712 9:97614867-97614889 TGGGCATGGGAGAGGGAAGCAGG + Intronic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058547867 9:106080432-106080454 CTGGGATGAAAGATGGAAGAGGG + Intergenic
1059891977 9:118814017-118814039 CTGGGAAGTGAGACTGATGCTGG - Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1061246329 9:129402828-129402850 ATGGGATGGGGGAGAGAAGCTGG - Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061391744 9:130320686-130320708 CTGGGGAGGGAGAGGGGAGCAGG + Intronic
1061681386 9:132244061-132244083 CTGGGCAGTGAGATGTAAGCAGG + Exonic
1061947120 9:133914676-133914698 AAGGGATGGGGGAGGGAAGCGGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062127375 9:134870814-134870836 GAGGGAGGTGGGAGGGAAGCTGG + Intergenic
1062207831 9:135346992-135347014 GTGGGATGGGAGGGGGCAGCTGG - Intergenic
1062267321 9:135693105-135693127 CTGGGCTGGGAGAGGACAGCAGG + Intergenic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1186313622 X:8345917-8345939 TTGGGATGTGAGGCGGAAGTCGG + Intergenic
1186415837 X:9382422-9382444 CTGGGCTATGAGAGGGAAGTGGG - Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1189905307 X:45753393-45753415 CTGGAATGTAAAAAGGAAGCAGG + Intergenic
1190034484 X:47008761-47008783 CTGGGAGGAGACAGGGAAGCAGG + Intronic
1191046483 X:56143592-56143614 CAGGGATGTGAAAGGGAAAGTGG - Intergenic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192059905 X:67813071-67813093 CTGAAATGTGAGAGCAAAGCAGG + Intergenic
1193475206 X:81955608-81955630 CTGGAACGTGAAGGGGAAGCAGG + Intergenic
1194814256 X:98423334-98423356 GTGGAAGGTGAAAGGGAAGCAGG - Intergenic
1195001210 X:100645060-100645082 CTAGAAAGTGACAGGGAAGCAGG - Intronic
1195325118 X:103752182-103752204 GTGGGATGAGGGAGGGAGGCAGG + Intergenic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1196614666 X:117754264-117754286 CTGCTATGTTAGAGGGAATCAGG + Intergenic
1197655702 X:129114001-129114023 CAGGGAGGTGAGTGGGAGGCTGG - Intergenic
1197931240 X:131698622-131698644 CTGTGATGTGAGTGGCAGGCTGG - Intergenic
1197946218 X:131841761-131841783 GTGGGATCTGAGAGGGGAGAGGG - Intergenic
1198015069 X:132602216-132602238 CTGGGATGGGAGAAAGCAGCAGG + Intergenic
1198088868 X:133307969-133307991 CTGGGAATGGAGGGGGAAGCTGG + Intronic
1199546019 X:149007986-149008008 GTGGGAAGGGAGAGGAAAGCAGG + Intergenic
1199638875 X:149840955-149840977 CTGGAAGGTGAAGGGGAAGCAGG + Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1200128398 X:153828969-153828991 CCGGGAACTGAGAGGGAAGAAGG + Intronic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic
1202097423 Y:21266322-21266344 CTGGGAGGTGAGAAGAAAGCAGG + Intergenic