ID: 1105063568

View in Genome Browser
Species Human (GRCh38)
Location 12:133176788-133176810
Sequence TCCCCCACCAAAAAAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105063563_1105063568 28 Left 1105063563 12:133176737-133176759 CCCTGAACAGACCAATAATAAGG 0: 2
1: 50
2: 772
3: 2659
4: 3465
Right 1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG 0: 1
1: 0
2: 0
3: 26
4: 150
1105063565_1105063568 27 Left 1105063565 12:133176738-133176760 CCTGAACAGACCAATAATAAGGA 0: 2
1: 70
2: 820
3: 1863
4: 3847
Right 1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG 0: 1
1: 0
2: 0
3: 26
4: 150
1105063566_1105063568 17 Left 1105063566 12:133176748-133176770 CCAATAATAAGGAGCAAGATTGA 0: 1
1: 22
2: 264
3: 620
4: 1073
Right 1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG 0: 1
1: 0
2: 0
3: 26
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105063568 Original CRISPR TCCCCCACCAAAAAAGCCTA GGG Intronic
900002238 1:21112-21134 ATCCCCACCGAAAAAGCCCATGG + Intergenic
900021957 1:191636-191658 ATCCCCACCAAAAAAGCCCATGG + Intergenic
902677404 1:18018320-18018342 TCCCCCACTCAAGAAGCCCAAGG - Intergenic
906437178 1:45806012-45806034 TCCCACACAAAAAAAGCTTTCGG - Intronic
907988799 1:59558731-59558753 TCCCCACCCTAATAAGCCTAGGG + Intronic
908795342 1:67825708-67825730 TCCCCAAGGAAAAAGGCCTACGG + Intronic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
911650953 1:100387866-100387888 ACCCCCTCCAAAAAAACCCAAGG + Intronic
913178000 1:116292515-116292537 TCCCCCACCAAGTAAGACTGAGG + Intergenic
916461862 1:165033559-165033581 GCCCCTGCCAAAGAAGCCTAGGG + Intergenic
918365687 1:183805348-183805370 TTCCCCACCAGAGAAGCCTCGGG - Intronic
919900943 1:202043901-202043923 CCCCCCACAAAAAAAGGTTATGG + Intergenic
1064031947 10:11888189-11888211 TCCCCCACTAAAAAAGAATCAGG + Intergenic
1064200530 10:13280821-13280843 GCCCCCACCAAAAATGACAATGG - Intronic
1065851084 10:29789901-29789923 ACCACCACCAAAAAAGCTGAGGG - Intergenic
1066029107 10:31399343-31399365 TCCCCCACCAAAACCTCCTCCGG + Intronic
1068296058 10:55073773-55073795 CTCCCCCCCAAAAAAGCCTACGG - Intronic
1069801020 10:71081548-71081570 TCTCCCACCAAAAACGCCTCTGG + Intergenic
1072897041 10:99376244-99376266 TCCCCACCCAAACAATCCTAAGG + Intronic
1072955575 10:99885214-99885236 CCCCCCACAAAAAAAGCCTGGGG + Intronic
1073257123 10:102159927-102159949 TCCCCCACCAAAGAAGTCTCTGG + Exonic
1074316430 10:112365639-112365661 GCCCTCACCAAAAATGCTTATGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080680723 11:34473380-34473402 TACCCCACAAAAAAATCCAATGG + Intergenic
1081299377 11:41431870-41431892 TGGCCCACCACAAAAACCTAAGG - Intronic
1081553328 11:44134268-44134290 CCCCCCACCAAAAAACATTAGGG - Intronic
1084590465 11:70087090-70087112 TCCCCCAGCAACAAAAGCTATGG - Intronic
1087924600 11:103904679-103904701 TCTCCCAGCAAAAATGCATAAGG - Intergenic
1089230399 11:116969365-116969387 ATCCCCACCAAAAAATCATAAGG + Intronic
1089594560 11:119569048-119569070 TCCCCCACATAAAGAGCCTTTGG - Intergenic
1091375656 12:23173-23195 ATCCCCAACAAAAAAGCCCACGG + Intergenic
1091690226 12:2591137-2591159 TGGCCCTCCAAAAAAGCCTTGGG + Intronic
1093880539 12:24399056-24399078 ACCCCCACCAAAAACGGCCACGG + Intergenic
1094878058 12:34673569-34673591 ACACACACAAAAAAAGCCTATGG + Intergenic
1095095700 12:38147352-38147374 TCCACTAACAAAAAGGCCTAGGG - Intergenic
1097533033 12:60829620-60829642 TCCCCCACAAAAAAAGTAAAAGG - Intergenic
1098575738 12:72039993-72040015 ACCACAGCCAAAAAAGCCTAGGG - Intronic
1099091458 12:78315326-78315348 TCACCCGCAAAAAAAGCCTTGGG - Intergenic
1102214450 12:111150519-111150541 TCCCCCACTCCAAAAGCCCAAGG - Intronic
1102782539 12:115577831-115577853 TCCTCCCCCAACAAAGCTTAGGG + Intergenic
1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG + Intronic
1105838731 13:24234561-24234583 GCCCCCACCAACAAAACGTACGG - Intronic
1107665286 13:42682316-42682338 TTCTCCACTAAAAAAGACTAGGG + Intergenic
1115657541 14:35458543-35458565 TGCCCCACAAGAAATGCCTAAGG - Intergenic
1116320426 14:43454851-43454873 TGCCCCACCAAATACACCTAAGG - Intergenic
1118216344 14:63812086-63812108 TCCCCAACCTAATAAGCCTGAGG + Intergenic
1120789872 14:88569948-88569970 CCCCCCACAAAAAAAGACTGTGG + Intronic
1121772178 14:96556221-96556243 TTCTCCACCACCAAAGCCTACGG + Exonic
1126174575 15:45723676-45723698 GGCTCCACCAAAAAAGCCTTTGG + Intergenic
1127605519 15:60583599-60583621 TCCAGCACCAAAACAGCCTCAGG + Intronic
1129115458 15:73363101-73363123 TCCCCCTCCAACACAGCCTGCGG + Intronic
1130062001 15:80577005-80577027 TCCCTCACCAAGAAAGCCCTGGG + Intronic
1132100393 15:99018816-99018838 TCCCCCACCCAAAAACACAAAGG - Intergenic
1132451273 15:101969827-101969849 ATCCCCACCGAAAAAGCCCATGG - Intergenic
1133914715 16:10098935-10098957 CCCCCCCCAAAAAAAACCTATGG + Intronic
1145360903 17:22211475-22211497 TCCCCCACCAAAAAAAGGTGAGG - Intergenic
1146620591 17:34394102-34394124 TCCCACCCCAGAAAAGCATAAGG - Intergenic
1148690173 17:49522656-49522678 TACCCCATCAAGAAAGCCTAAGG + Intergenic
1150752880 17:67882310-67882332 CTACCCACCAAAAAAGCATAGGG - Intronic
1152049492 17:77960762-77960784 TCCCCCAACAAAGCATCCTAGGG - Intergenic
1153206556 18:2709534-2709556 TCCCCCACAAAAAAACCCACAGG - Intronic
1154499825 18:14990436-14990458 TCCTCCCACAAAAAAGCTTAAGG + Intergenic
1156128935 18:33944502-33944524 TCCCCCTCCAAAGTAGCCTCTGG + Intronic
1156197925 18:34796933-34796955 TCTCCCACCAAAAAAACATCCGG + Intronic
1158176004 18:54656658-54656680 TCCCTCCCCAAAAGAGCTTATGG - Intergenic
1158729192 18:60003871-60003893 TCCCCCACCCAGAGAGCTTAGGG + Intergenic
1160305866 18:77735714-77735736 TCCCCTAACAAAAAAACTTATGG - Intergenic
1160352555 18:78196455-78196477 TCCTCCTCCAAAAAAGCACACGG - Intergenic
1160633991 19:62720-62742 ATCCCCACCGAAAAAGCCCATGG + Intergenic
1163529857 19:17842819-17842841 TCCCCCAGCTAAAAGGCCTGTGG - Intronic
1163653621 19:18532868-18532890 CCCACCACCCAAACAGCCTAGGG - Intronic
1164732084 19:30513992-30514014 TCCCCCACACAGAAAGCCAATGG - Intronic
1165522482 19:36325640-36325662 TCCCGCATCAAAAAGGCCAACGG - Intergenic
928131537 2:28655339-28655361 TCCCCCACCCAAAACGACTCAGG + Intergenic
930086159 2:47498734-47498756 TCCCCCTCCAAAAAAGTGAAGGG + Intronic
931011969 2:57927739-57927761 TCCCAGACCAAAAAAGCTGAGGG - Intronic
933808269 2:86015741-86015763 TCCACCCCCAAAAAACCCTTTGG - Intergenic
936567489 2:113592308-113592330 ATCCCCACCAAAAAAGCCCATGG - Intergenic
937649695 2:124306404-124306426 TTCCCCCCCAAATAAGTCTATGG + Intronic
940233683 2:151486168-151486190 TCCCCCACCAAAAGAGGCAAAGG + Intronic
941308793 2:163904423-163904445 TCCCAAACCAAAAAAGCCTGGGG + Intergenic
942281414 2:174367575-174367597 TCCCCCACCAAAAAAATATTTGG + Intronic
942899096 2:181092737-181092759 CCACCAACCAAAAAAGCCCAGGG + Intergenic
945270550 2:207934921-207934943 TCCCCCACAAAAATAGCCCCTGG + Intronic
945732748 2:213560861-213560883 TCCCCCACAAAAAAAGTTAATGG - Intronic
946660288 2:221992264-221992286 TCCAGCACCAGAAAAGCCAAAGG + Intergenic
947394585 2:229674278-229674300 TCCCCCACCAAAAAAGAAGAAGG - Intronic
947873505 2:233453024-233453046 TCCCCAAGGAAAAAAGCCTCAGG - Intronic
1169571943 20:6915829-6915851 TTCTCCACCCAAAAAGCCAAGGG + Intergenic
1169596075 20:7200570-7200592 CCCCCACCAAAAAAAGCCTAGGG - Intergenic
1170663687 20:18366556-18366578 TCCCTCATCAAAGCAGCCTAGGG + Intergenic
1173364961 20:42376755-42376777 TCCCCAGCCACAAAAGCCTGGGG + Intronic
1173761326 20:45563123-45563145 TCCCCCAACAAAAAAGGTTGGGG - Intronic
1174074188 20:47920518-47920540 TCCCCCCTCAAGAAAGCCCAGGG - Intergenic
1174960245 20:55148223-55148245 TCACAGACAAAAAAAGCCTAAGG + Intergenic
1178510129 21:33198058-33198080 TTCCCAACCAAGAAAGCCTATGG - Intergenic
1179662399 21:42885263-42885285 TCCTCCTCCAAGAAAGCCTTGGG + Intronic
1184193679 22:42911939-42911961 ACCTCCACCAAAAAAACCAAAGG + Intronic
951618902 3:24579365-24579387 TCCCCCACCAAAAGATACTGAGG - Intergenic
951674984 3:25228633-25228655 TCTCCCACCAAAAAAAGTTAAGG - Intronic
955750730 3:62183678-62183700 TCCCCCATCAGAAACGCATAGGG - Intronic
956220567 3:66898375-66898397 TCCCCACCCTAATAAGCCTAAGG - Intergenic
956281522 3:67562040-67562062 TCCCCCATCAAAAATGCAGAAGG - Intronic
956482852 3:69690022-69690044 TCCCCCACTAAAAATACCGAGGG + Intergenic
956745993 3:72311363-72311385 TCACCCACCAACAATGCCCAAGG - Intergenic
958901294 3:99889797-99889819 TCCTCCTCCAAAAAAATCTAAGG + Intronic
960843394 3:121983465-121983487 TCCCCCCCCAAAAAAAATTAAGG - Intergenic
961157419 3:124691964-124691986 TCCCACCCCAGAAAAGCCTCCGG + Intronic
961737334 3:129010461-129010483 TCCCCCAACAACAAAGCCAGAGG - Intronic
962484827 3:135832211-135832233 GCCCACAGAAAAAAAGCCTAAGG + Intergenic
963406970 3:144878005-144878027 CCCCCCCCCAAAAAAACCAAAGG + Intergenic
966518507 3:180846579-180846601 TCCCAAACCAAAAGAGCCCAGGG - Intronic
967379130 3:188838052-188838074 TACCCAACCAAACAAGACTAGGG - Intronic
973635761 4:52861222-52861244 TACCCCAACATAAAAGCCTCTGG + Intergenic
976586364 4:86801423-86801445 TCACCCCCCAAAAAAACCTCAGG - Intronic
978589575 4:110310425-110310447 TCTCTCACCAAAAAAGCTTAGGG + Intergenic
979437798 4:120714854-120714876 TGCCTCACCAGAAAACCCTAAGG - Intronic
980101646 4:128547376-128547398 TTCTCCACCAGAAAAGCCTAGGG - Intergenic
983377183 4:166945154-166945176 TCCTCCACCAAAAAAGGCCAAGG - Intronic
985619451 5:946386-946408 TCCCGCCCCAAAGCAGCCTATGG - Intergenic
987145886 5:14991294-14991316 TTCCCCACCAAAAATGCACAAGG + Intergenic
988037415 5:25845324-25845346 ACCCTCACCAAAAATTCCTATGG + Intergenic
989608309 5:43267076-43267098 GCCAGCAACAAAAAAGCCTAGGG - Intronic
991344277 5:65646054-65646076 TCCCCTACCAGAAAAGTCTATGG - Intronic
993726209 5:91369334-91369356 TCCCCCTCAAAAAAAGCTAATGG - Exonic
994711053 5:103264555-103264577 TACCCCACCAATGAAGCCTCTGG - Intronic
994987913 5:106961640-106961662 TCCCCAAGTAAAAAAGCCTAGGG + Intergenic
997637322 5:135423128-135423150 TCACAGACCAAAGAAGCCTAAGG - Intergenic
998131470 5:139653517-139653539 TCCCCCAGGGAACAAGCCTATGG - Intronic
1001714756 5:173806277-173806299 TCTCCCATCAAAACATCCTATGG + Intergenic
1001957944 5:175861215-175861237 TCCACAATCAAAAAAGCCTTGGG + Intronic
1002003288 5:176211224-176211246 TTCCCCCACAAAAAAGCCCAGGG - Intergenic
1002223164 5:177699720-177699742 TTCCCCCACAAAAAAGCCCAGGG + Intergenic
1003963543 6:11232002-11232024 TCTCCCACCAAAAGTGCATATGG + Intronic
1006227643 6:32553821-32553843 TCCTCCTCCAGAAAAGCCTATGG + Intronic
1006230305 6:32580695-32580717 TCCTCCTCCAGAAAAGCCTATGG + Intronic
1007582320 6:42966842-42966864 TCCCCTACCACAAAGCCCTAGGG + Exonic
1008634078 6:53392156-53392178 ACCCCCACCAATAATGCATAGGG - Intergenic
1009451836 6:63810307-63810329 CCCCCCCCCAAAAAAACCTGCGG + Intronic
1010025102 6:71205974-71205996 CCCCTCCCCAAAAAAGCCTAAGG + Intergenic
1012319414 6:97824143-97824165 TCCCCCACCACAGAAGACTAGGG - Intergenic
1012635283 6:101530835-101530857 TCTCCCTCCAAAAAAACTTATGG - Intronic
1013063759 6:106662653-106662675 TCCCACCCCAAAACAGCCTGGGG - Intronic
1016395616 6:143620748-143620770 TCCCCCTGCATAAAAGCCAATGG - Intronic
1016943768 6:149508260-149508282 TCTCCCACTATAAAGGCCTAAGG + Intronic
1018638199 6:165883577-165883599 TCCCCCACCAAAGAAGGGTGAGG + Intronic
1024874046 7:54000424-54000446 TCCTCCCCCAAAGAAGACTAGGG - Intergenic
1027108335 7:75419327-75419349 TCCAACACCAACAAAGCCTTGGG + Exonic
1029686166 7:102149562-102149584 TCTCCCACCAATAACGCCCATGG - Intronic
1031318730 7:120292810-120292832 ACCCCAGCAAAAAAAGCCTAAGG - Intronic
1032865083 7:135916880-135916902 ATCCCCACCAAAAAAGCCCATGG - Intergenic
1033591025 7:142808704-142808726 TCCTCCATCAAAAAGGTCTAGGG + Intergenic
1037162594 8:15791121-15791143 TCCCCCACCCAAATAGTTTATGG + Intergenic
1037248864 8:16869064-16869086 TCCCCCCACAAAATAGCCTTGGG - Intergenic
1041678754 8:60564771-60564793 TCCCCCACCAATAAAAAGTAAGG + Intronic
1042813900 8:72856926-72856948 TCCCCCACCACAGAAACATATGG + Intronic
1043750806 8:83931303-83931325 TCCCCACCCAAATAAGCCTGAGG - Intergenic
1043818831 8:84838320-84838342 TCCCCCACAAAAAAGGACTGAGG + Intronic
1045619723 8:103961237-103961259 TCACCCTCCAAAACAGCCTATGG + Intronic
1048029671 8:130619455-130619477 CTACCAACCAAAAAAGCCTAGGG - Intergenic
1049885045 9:21225-21247 ATCCCCACCGAAAAAGCCCATGG + Intergenic
1051297587 9:15612996-15613018 ACCCCCAACAAAACAGTCTATGG - Intronic
1051616881 9:19015099-19015121 ACCCCTTCCAAAAAAGCCTAAGG + Intronic
1057033695 9:91797592-91797614 TTCCCCACCCACAGAGCCTAGGG - Intronic
1057033891 9:91798271-91798293 TTCCCCACCCACAGAGCCTAGGG - Intronic
1057847099 9:98534074-98534096 TGCCCCACCAAAAGGGCCTTGGG - Intronic
1061017862 9:127992944-127992966 CCCCCCACCAACAAAACCTCAGG - Intergenic
1061247295 9:129407143-129407165 TCCCCCACCAAAACATCCTGTGG - Intergenic
1061404289 9:130384991-130385013 TCCCCCACCACACAAGGCTTGGG - Intronic
1186781764 X:12919402-12919424 TCCTCAACCTAAAAAACCTAAGG + Exonic
1188129431 X:26413138-26413160 CCCCCCCCCAAAAAAGCCTCAGG - Intergenic
1193206079 X:78749296-78749318 TCCCCCAACAAGAAGGCCAAGGG - Intronic
1195331038 X:103800824-103800846 TTCCCCACAGTAAAAGCCTAGGG + Intergenic
1195449028 X:104989051-104989073 TCCTCCCCCAGAAAAGCCTGGGG + Intronic
1197703525 X:129617343-129617365 TCCACCAGCAGAAAAGCCTGAGG + Intergenic
1197724885 X:129769591-129769613 TCCCCCACCACAAAAGCCACAGG - Intergenic
1201933735 Y:19383413-19383435 TGCCCCCCAAAAAAAGCCCAGGG - Intergenic