ID: 1105064774

View in Genome Browser
Species Human (GRCh38)
Location 12:133186889-133186911
Sequence TTGTGTTACAAAAAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 514}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105064774 Original CRISPR TTGTGTTACAAAAAAGAAGT GGG (reversed) Intronic
905970029 1:42134861-42134883 TTTGGTGGCAAAAAAGAAGTGGG - Intergenic
907256948 1:53186526-53186548 TTGTGTTAAAAAGCAGAAGATGG - Intergenic
907544616 1:55248906-55248928 TTGGGTTAAAAAACAGAACTTGG - Intergenic
908304600 1:62799227-62799249 TTTTGTTACAGAAATAAAGTGGG + Intronic
908314640 1:62920736-62920758 TTGTCTTAAAAAAAAAAAGTGGG + Intergenic
909291660 1:73890662-73890684 TATTGTTACAAAAAACAGGTTGG - Intergenic
909391884 1:75129435-75129457 TGCTTTTACAAAAAAAAAGTTGG - Intronic
909949145 1:81698885-81698907 TTGTGGTATTAAAAAAAAGTTGG - Intronic
910033965 1:82767618-82767640 GTGTGTTTAAAGAAAGAAGTAGG + Intergenic
910332806 1:86094942-86094964 TTGTGATACAAGAAAGAAAATGG - Intronic
910382878 1:86648236-86648258 TTGTATTCCAAACAAAAAGTAGG + Intergenic
911310931 1:96291083-96291105 GTGAGTTCCAAGAAAGAAGTAGG - Intergenic
911823863 1:102455587-102455609 TTGTGTTCTAAAAAAGAGTTTGG + Intergenic
912215966 1:107612703-107612725 TTATGTTCCAAAAAAGAACCTGG + Intronic
912891367 1:113535459-113535481 TTGAGTTAAAAAAAAGAGGAAGG - Intronic
914223787 1:145703722-145703744 ATATGTTGAAAAAAAGAAGTAGG + Intronic
915291845 1:154889612-154889634 TTCTTTTACAAGAAAGAAGGGGG - Intergenic
915620532 1:157080461-157080483 TTGTCTTAAAAGAAAAAAGTGGG - Intergenic
916222267 1:162456646-162456668 TTTTGTTACAAAACTGAATTAGG + Intergenic
916844709 1:168638027-168638049 TAGTGTTCTAAAAAATAAGTGGG + Intergenic
917499910 1:175576749-175576771 TAGTGTCTCAAAAATGAAGTAGG - Intronic
917700169 1:177572716-177572738 ATGTGTTAAAAAAAAAAATTTGG - Intergenic
917894721 1:179476588-179476610 ATGTGTTCCAAAAATGAAGGTGG - Intronic
918599418 1:186337995-186338017 TTATCTTACAAAAAAAAACTAGG - Intronic
918713561 1:187761867-187761889 CTGTGTTTCAAAAAAAAAGAAGG + Intergenic
920078962 1:203358319-203358341 TTGTGAGACAAAACAGAAGTAGG + Intergenic
920825402 1:209420466-209420488 TTTTGTAACAAAAATGAAATGGG - Intergenic
921648772 1:217651503-217651525 TGGTGATCCAAAAAGGAAGTGGG - Intronic
921691261 1:218153295-218153317 TTTTGTTACCGAAAAGAAATTGG + Intergenic
922000188 1:221469540-221469562 TTTTATTACAAAAATGATGTTGG - Intergenic
922021610 1:221710607-221710629 TTATTTAACAAAAAAGAATTAGG + Intronic
922070045 1:222183388-222183410 TTGTGTAACACAAAAGAACAAGG + Intergenic
922444722 1:225687510-225687532 TTGTTTAAAAAAAAAAAAGTTGG + Intergenic
922575145 1:226656189-226656211 TTGTGTTAAAGAGAAGAACTGGG - Intronic
923115451 1:230932946-230932968 TTGTGTTATGAAAAGGAGGTAGG - Intronic
923547658 1:234934585-234934607 TTGAGTTAAAAAACAGAAATAGG - Intergenic
924502510 1:244650954-244650976 ATGTGTAGCTAAAAAGAAGTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063402366 10:5758591-5758613 TTGTGTGACAGAAGAGAAGCAGG - Intronic
1064784706 10:18880935-18880957 TTTTTTTACAAAAAAAAAGGCGG + Intergenic
1065387839 10:25151126-25151148 TGGTGTCTCAAACAAGAAGTTGG - Intergenic
1066227857 10:33402010-33402032 TTTTGTTTAAAAAAATAAGTAGG - Intergenic
1066391264 10:34978984-34979006 ATTTGTTACAAAAGAGTAGTGGG - Intergenic
1066643905 10:37585660-37585682 TTATGTTACAAAAAATAATTTGG + Intergenic
1066708769 10:38209673-38209695 ATTTGTTTCAAAAAAGAATTTGG + Intergenic
1066980730 10:42412820-42412842 ATTTGTTTCAAAAAAGAATTTGG - Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1067154173 10:43761096-43761118 TTGTTTTGTAAAAAAGAATTTGG + Intergenic
1067963374 10:50881347-50881369 TTGTGTTACATAAACAGAGTTGG + Intronic
1068249206 10:54414465-54414487 TTGGGCTACAGAACAGAAGTAGG + Intronic
1068959700 10:62854169-62854191 TTGTATTAGTAAAAACAAGTGGG + Intronic
1069285212 10:66705842-66705864 TTCTGTTTCAAACAAGAGGTAGG - Intronic
1069404478 10:68084229-68084251 TTTTTTTAAAAAAAAAAAGTAGG - Intergenic
1070578700 10:77702089-77702111 TTCTCTGACATAAAAGAAGTTGG + Intergenic
1071021796 10:81065736-81065758 TTGTCTTACAAAAATGAAAAAGG - Intergenic
1071771894 10:88738365-88738387 TTGTGTTTGAAACCAGAAGTAGG + Intronic
1071791899 10:88963739-88963761 TTTTGGGTCAAAAAAGAAGTAGG + Intronic
1071952116 10:90715642-90715664 TTATGTTGCAAAAATGCAGTTGG + Intergenic
1072297677 10:94027138-94027160 TTGAGTTTCAAAAGATAAGTAGG - Intronic
1072308010 10:94126621-94126643 TTTTGTTTCAAAAAAGATATTGG + Intronic
1072447719 10:95514067-95514089 TTGTGTAAAAAAAAAAAATTAGG - Intronic
1072556118 10:96514784-96514806 TTTAGGTACAAAATAGAAGTGGG - Intergenic
1074140202 10:110665817-110665839 TTATGTTAAAATACAGAAGTTGG + Intronic
1074659180 10:115632092-115632114 TTTTATTACTAAAAAGAAGAAGG + Intronic
1075300568 10:121319842-121319864 TTGTGTTCAAATGAAGAAGTTGG - Intergenic
1077972861 11:7213548-7213570 TTGGGTGACAAAAAAGGGGTGGG + Intergenic
1078264030 11:9739742-9739764 TAGTGTTACACTAAAGAAGAAGG - Intronic
1078360681 11:10665353-10665375 GTGTATTAGTAAAAAGAAGTGGG - Intronic
1078389465 11:10924347-10924369 TTATGTGACAGAAAAGAAGTAGG - Intergenic
1078500062 11:11864180-11864202 TTGTATTACAAGAAAAATGTAGG + Intronic
1079176515 11:18146842-18146864 TTGTCATACAAAATAGAAGTTGG + Intronic
1079562513 11:21840074-21840096 TTGCTTTACAGAAAAGAAGAAGG - Intergenic
1079625310 11:22610055-22610077 TTGTGTAATAAAAAAAAAGCAGG + Intergenic
1079702553 11:23566841-23566863 CTGTGTTAAAAAAAAAAAGTTGG - Intergenic
1080521631 11:33072453-33072475 TTCTGTGACAAAAAAGAAAGTGG - Exonic
1080699199 11:34630179-34630201 TTGTGTTTCTAAAGAGAAGGAGG - Intronic
1080805213 11:35647033-35647055 TTGTTTTAGAAAAAAGGAATTGG + Intergenic
1080952436 11:37050603-37050625 TTTTATTAGAAAAAAAAAGTTGG + Intergenic
1081748286 11:45488316-45488338 TTGTGATCCAAGAAAGAAATTGG + Intergenic
1082087382 11:48061274-48061296 TTGTGTTAGAAAGGAGAAGAGGG - Intronic
1082693011 11:56328191-56328213 AGTTTTTACAAAAAAGAAGTGGG - Intergenic
1083194416 11:61075624-61075646 TTGTTTTACAAAATGGAAATGGG - Intergenic
1083978108 11:66140729-66140751 TTGTATTACATAAAAATAGTTGG - Intronic
1084375220 11:68772345-68772367 TTCTGTCTCAAAAAAAAAGTTGG + Intronic
1084885251 11:72200216-72200238 TTTTGGTCCAAAAAAGAAGTGGG - Intergenic
1085177617 11:74504722-74504744 TTGTGTTTAAAAAAAAAAGTGGG + Intronic
1085325795 11:75605736-75605758 TTGGTTTAAAAAAAAAAAGTTGG + Intronic
1086075935 11:82852233-82852255 TTGTGTTATAAATATAAAGTGGG - Intronic
1086079544 11:82889186-82889208 TTTTTTTAAAAAAAAGAAATGGG - Intronic
1086610504 11:88749467-88749489 TTGGGGTACCAAAAAGAGGTGGG + Intronic
1087035341 11:93750223-93750245 TTGTATAATAAAAAAGAAGGGGG - Intronic
1087235846 11:95717862-95717884 TTGTGCCAAAAAAAAGAAATGGG + Intergenic
1087306325 11:96493095-96493117 AGGTATTAAAAAAAAGAAGTGGG + Intronic
1087543329 11:99549091-99549113 TTGTGTTATAAAAAAAAAAAAGG - Intronic
1088741531 11:112771424-112771446 TTTTGTTACAAAAAATACGTGGG + Intergenic
1088904554 11:114144510-114144532 TTCTTTTACAAAAAAGAAAAGGG + Intronic
1089634818 11:119805324-119805346 TTGTGTTGCAGAAAAACAGTGGG + Intergenic
1090174429 11:124635821-124635843 TTATGTTACCTATAAGAAGTTGG - Exonic
1090759141 11:129820470-129820492 TTGTTTTACTAAAAAGCAATGGG + Intronic
1090928478 11:131273873-131273895 TTGTGTTACAAGGAAGAAAGTGG + Intergenic
1091393577 12:140295-140317 CTGTTTTACAGAAAAGAAGCCGG + Intronic
1092627586 12:10343986-10344008 TTTTATCACAAAAAATAAGTAGG - Intergenic
1092925270 12:13266374-13266396 TTCTTTGACAAAAAAGAAGAGGG + Intergenic
1092990569 12:13893820-13893842 TTTTTTTAAAAAAAAGAAGGGGG + Intronic
1093124034 12:15307013-15307035 TTCTGTTTGAAAAAAGAAGAGGG - Intronic
1093905757 12:24690263-24690285 TTGTGGTACAAAATAGGAGAAGG + Intergenic
1094762389 12:33549335-33549357 TTTTGTTACAAATATGGAGTGGG - Intergenic
1095336528 12:41034807-41034829 TTTTGTAACAAACATGAAGTTGG + Intronic
1095819864 12:46466165-46466187 TTATGTAACAATACAGAAGTGGG - Intergenic
1095859484 12:46900683-46900705 TTGTATTAAAAAACAGCAGTTGG - Intergenic
1098792850 12:74847849-74847871 GTGTGATACAAAATAGATGTTGG - Intergenic
1098857645 12:75670736-75670758 GTTTGTTACAAAAAAGATTTTGG - Intergenic
1099263360 12:80412442-80412464 TAGTGTTACTAAAAAAAACTGGG - Intronic
1099350367 12:81560459-81560481 ATGTGTTTTAAAAAAGAACTAGG + Intronic
1099471779 12:83059031-83059053 TTCTGTCCCAAAAAAGAAATAGG + Intronic
1099578670 12:84412600-84412622 TAGAGTTAGAAAAAAGAGGTTGG + Intergenic
1099846334 12:88032499-88032521 TTGTTTTACATAACCGAAGTGGG - Intronic
1100100394 12:91096711-91096733 TTTTGTTATAAAAATGAATTTGG - Intergenic
1100347344 12:93745412-93745434 TGGAGTTACTAAAAGGAAGTGGG - Intronic
1100540678 12:95554470-95554492 TTTTTTTAAAAAAAAGAAATGGG - Intergenic
1101432309 12:104636849-104636871 TTGTTTTAAAAAAAAAAAATAGG - Intronic
1102335734 12:112077872-112077894 TCGTGTTTAAAAAAAAAAGTGGG + Intronic
1103152151 12:118650142-118650164 AGGTGTGACAAAAAAGAAGAGGG - Intergenic
1104509309 12:129361589-129361611 TTGGGTTACAAATACTAAGTGGG - Intronic
1104781877 12:131427068-131427090 TTGTGTTGTAAAAAAGAAAAAGG - Intergenic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1105709578 13:22994472-22994494 TTGTGGTACAAAAAACAATATGG - Intergenic
1106154691 13:27143250-27143272 TCATGACACAAAAAAGAAGTAGG + Intronic
1106916012 13:34515148-34515170 TTGTTTTACTTAAAAGTAGTTGG - Intergenic
1108693473 13:52881426-52881448 TTATGTTACAAAGAAGAAGGAGG - Intergenic
1108839632 13:54596066-54596088 TTGTGTTACAAGAGAGTAGTTGG - Intergenic
1109106447 13:58257572-58257594 TTGAGCTATAATAAAGAAGTAGG - Intergenic
1109637268 13:65137925-65137947 TTGTGTTACAATATAGAGATTGG - Intergenic
1110136201 13:72070591-72070613 TTGTCCTACAAAAATGTAGTAGG + Intergenic
1111340851 13:86883414-86883436 TTTTTTTACAAAAAACAAGAAGG + Intergenic
1111870362 13:93824584-93824606 TTGTTTAAAAAAAAAAAAGTTGG - Intronic
1111991253 13:95119723-95119745 TTTTGTTACAAAAAAGAATGGGG - Intronic
1112198431 13:97249859-97249881 TTATGCTGCAAAAGAGAAGTTGG + Intronic
1112853918 13:103741934-103741956 TTTTTTTAAAAAAAAAAAGTGGG - Intergenic
1112901106 13:104357907-104357929 TTGTGTTATAAAACACAAATTGG - Intergenic
1113310277 13:109124872-109124894 TTGTGTTACCAAAAACAATGTGG + Intronic
1113977885 13:114244611-114244633 TTGTAATACATAAAATAAGTAGG - Intronic
1114325529 14:21585050-21585072 ATGTGTGACAAAAATAAAGTGGG - Intergenic
1115485284 14:33904387-33904409 TTGTGTAAGAAAGAAGAAATGGG + Intergenic
1115989042 14:39132522-39132544 CTCTGTCTCAAAAAAGAAGTAGG + Intronic
1116167552 14:41352425-41352447 TTGAGTTAGATAAAAGAAATAGG - Intergenic
1116360790 14:43995124-43995146 TTATGTTACAAAAAATATTTTGG + Intergenic
1116415353 14:44671431-44671453 ATGTTTTAAACAAAAGAAGTAGG - Intergenic
1117200484 14:53385044-53385066 TTGTGTTGCTATATAGAAGTCGG - Intergenic
1117678007 14:58174395-58174417 TTATGTGAAAAAAAAGATGTTGG + Intronic
1118363572 14:65075882-65075904 TTGTGGTATAAAAAGGAAGTGGG - Exonic
1120404073 14:84072145-84072167 TTGTTTTACAAAAAGGAAAATGG - Intergenic
1120473260 14:84954011-84954033 TTGTGCTACAAATAAAATGTGGG + Intergenic
1202847009 14_GL000009v2_random:187363-187385 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1202916472 14_GL000194v1_random:177960-177982 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1202876306 14_KI270722v1_random:5146-5168 TTGTGTTAAAAAACAGAATCAGG - Intergenic
1123414698 15:20086805-20086827 TTGTCTTAAAAAAAAGAAAGAGG + Intergenic
1123524040 15:21093919-21093941 TTGTCTTAAAAAAAAGAAAGAGG + Intergenic
1123815727 15:23976814-23976836 CTGTCTTATAAAAAAAAAGTTGG - Intergenic
1124687009 15:31791371-31791393 TTTTGTTAAATATAAGAAGTGGG + Intronic
1125063249 15:35450205-35450227 TTTTGTTATAAAAAATAAATAGG - Intronic
1125180277 15:36875139-36875161 TTCTTTTACAGAAAAGAAGCCGG + Intergenic
1125863610 15:43021369-43021391 TTGTGTTTTAAAAAAGGATTGGG - Exonic
1126924283 15:53565396-53565418 TTGCCTTCCAAAAAAGAAATGGG - Intronic
1127178826 15:56392647-56392669 TTGTGTTACTAATCACAAGTAGG + Intronic
1127685189 15:61336601-61336623 TTTCGTTAAAAAAAAAAAGTTGG - Intergenic
1127967527 15:63934082-63934104 AGCTGTTAAAAAAAAGAAGTTGG - Intronic
1129484163 15:75853169-75853191 TTGTGTTTTAAAAAAGATATGGG + Intronic
1129787267 15:78317847-78317869 TATTGTTAAAAAAAAAAAGTGGG + Intergenic
1130138332 15:81200073-81200095 TTGTTTTAGAAAAAGGAAGTTGG - Intronic
1130164398 15:81437786-81437808 TTGTGGCACAAAGAAGAAGGAGG - Intergenic
1130635698 15:85617693-85617715 CTGTGTTCAAAAAAAGAAGAAGG + Intronic
1131124303 15:89845583-89845605 TTCTGTTAAACAACAGAAGTTGG + Intronic
1132320535 15:100921472-100921494 TTTTGTTTCAAAAAGGAACTAGG + Intronic
1132383583 15:101383876-101383898 TTATGTCAAAAAAAAGTAGTGGG + Intronic
1133101439 16:3482521-3482543 TTGTGTGTCAACAGAGAAGTTGG - Exonic
1133484743 16:6208953-6208975 TTGGGTCACAAAAAAAAAATGGG - Intronic
1135673908 16:24398112-24398134 TTATGTTTGACAAAAGAAGTTGG + Intergenic
1136493254 16:30624752-30624774 CTGTCTTAAAAAAAAGAAATGGG - Intergenic
1136646776 16:31626738-31626760 TTGTGATAGAATTAAGAAGTGGG + Intergenic
1138824747 16:60305427-60305449 TTGTGTTACAAAAAAATATTTGG - Intergenic
1140293431 16:73685516-73685538 TTGGGCTACAATAAAGAGGTTGG - Intergenic
1140806871 16:78540690-78540712 TTTTGTTAAAAAAAAAAAATGGG + Intronic
1140894280 16:79311338-79311360 TTCCTTTTCAAAAAAGAAGTAGG - Intergenic
1141031115 16:80589686-80589708 TTATGTCACACACAAGAAGTTGG + Intergenic
1142536557 17:620919-620941 TTTTGTTACAAGAAAGGATTTGG + Intronic
1144236528 17:13266418-13266440 CTGAGTTAGAAAAAAGAAATTGG - Intergenic
1145197582 17:20908377-20908399 CTGTGTAACAAAAAATATGTTGG + Intergenic
1145796711 17:27659780-27659802 CTGTGTCAAAAAAAAAAAGTTGG + Intergenic
1147271434 17:39274808-39274830 ATGAGGTACAAAAAGGAAGTAGG + Intronic
1148378307 17:47170482-47170504 TTTTTTTACAAAAAACAAATTGG - Intronic
1149676966 17:58473847-58473869 TTGTGTTATAAAAATAAACTTGG - Intronic
1150127199 17:62645161-62645183 TTGTGTAACAAATGAGAAATGGG + Intronic
1150537992 17:66064324-66064346 TTATGTTACTAAAATGAAATAGG + Intronic
1151554800 17:74841377-74841399 GTGTGATAGAAAAAGGAAGTGGG + Intergenic
1151988744 17:77560440-77560462 TTCATTTACAAAAAATAAGTTGG + Intergenic
1155955530 18:31953714-31953736 TAGTTTTGCAAACAAGAAGTAGG - Intergenic
1156201385 18:34836043-34836065 TTTAGTTACAAAAAAGAATTGGG + Intronic
1156663158 18:39372702-39372724 TTGGGGTCAAAAAAAGAAGTAGG - Intergenic
1157000432 18:43516412-43516434 TGGTGTTACAAGAAAGAAGCTGG - Intergenic
1157090456 18:44630751-44630773 TTTTATTACAAAATAGAAGATGG + Intergenic
1157636722 18:49163947-49163969 TTATGTAAGAAAAAAGGAGTGGG + Intronic
1158103313 18:53855379-53855401 TTGTGTAAGAAAAAAGCAGGGGG + Intergenic
1159327024 18:66935331-66935353 TTATGATAAAAAAAAAAAGTAGG - Intergenic
1159442395 18:68498188-68498210 TTTTGTAACAAAAAACAAGAGGG - Intergenic
1159626874 18:70705563-70705585 TTCTATTACAAAAAAGAGATAGG + Intergenic
1160241375 18:77125740-77125762 TTTTGATACAAAAAAAAAGGAGG - Intronic
1162119542 19:8454680-8454702 TAGTGTTAAAAAAAAAAAGGGGG - Intronic
1162193979 19:8969411-8969433 TTTTTTTAAAAAAAATAAGTTGG - Intronic
1162504407 19:11074573-11074595 TTGTCTTAAAAAAAAAAAGAAGG + Intergenic
1166540106 19:43599483-43599505 TTTTGTTAAAAAAAAAAAATGGG + Exonic
1167118798 19:47504084-47504106 TTGTGTTTAAAAAAAAAAGAGGG + Intronic
1167753838 19:51397974-51397996 TGGTTTTACAAAAAAGAAAAGGG - Intergenic
1168303971 19:55424280-55424302 TTCTATTAAAAAAAAAAAGTAGG + Intergenic
1202674359 1_KI270710v1_random:27670-27692 TTGTGTTAAAAAACAGAATCAGG + Intergenic
926211790 2:10876494-10876516 TTTTATTACAAAGAGGAAGTAGG - Intergenic
926597257 2:14804812-14804834 TTGTGTTACTAGAAAGGACTTGG + Intergenic
926734277 2:16060838-16060860 CTGGGTTCCAAAAGAGAAGTGGG + Intergenic
926938005 2:18105265-18105287 TTTTGTTAAAAAAAAAAAGGAGG + Intronic
926994536 2:18720215-18720237 GGGTATTAGAAAAAAGAAGTTGG - Intergenic
927489750 2:23513247-23513269 TTGTTTAAGAAAAAAGAAATTGG - Intronic
928073934 2:28245694-28245716 TTGAGTTAGAGAAAAGCAGTGGG + Intronic
930480341 2:51941218-51941240 TTGTGTTTCATAAAATAACTGGG + Intergenic
930901735 2:56515363-56515385 ATTTATTAAAAAAAAGAAGTGGG - Intergenic
932870409 2:75393020-75393042 TAGTTTTTAAAAAAAGAAGTAGG + Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933230746 2:79804506-79804528 TTGCATCACAGAAAAGAAGTTGG - Intronic
933559365 2:83872762-83872784 TTGTGTTAGAAAAAAAGATTAGG - Intergenic
933578778 2:84101239-84101261 TTCTGTTAGAAAAAAAAAATGGG + Intergenic
935164334 2:100556603-100556625 TTGTATTAAAAAAAAGGAATTGG - Intergenic
935550812 2:104451536-104451558 TTTTCTTAAAAAAGAGAAGTTGG - Intergenic
935877852 2:107531327-107531349 TTTGTTTAAAAAAAAGAAGTGGG - Intergenic
936253672 2:110889306-110889328 TTGTTTTAAAAAAAATTAGTTGG - Intronic
936270224 2:111043411-111043433 TTGTGTTATGAAAAAGAGGTGGG + Intronic
936710205 2:115122595-115122617 TTGTGTGGCAACAAAGAAATGGG - Intronic
936862918 2:117039275-117039297 TTGTATGAGAAAAATGAAGTGGG + Intergenic
937385141 2:121423417-121423439 TTATGTTAGATAAATGAAGTTGG + Intronic
937680401 2:124637956-124637978 ATTTGCTACAAAAAAGAGGTAGG - Intronic
938170892 2:129075819-129075841 TTGTGTAAAAAAAAAAAATTGGG + Intergenic
939125643 2:138174359-138174381 CTGGGTTAGAAAAAAGAATTGGG - Intergenic
939451718 2:142382790-142382812 TGGTGTGAAAAAAAAGAGGTAGG + Intergenic
939454530 2:142417042-142417064 TTATATTACAAAAAATTAGTGGG - Intergenic
939471685 2:142630439-142630461 TTGTTTTATAAAAAAGAAACAGG - Intergenic
939998172 2:148939669-148939691 TTGTTTTATAAATAATAAGTGGG + Intronic
940019632 2:149143330-149143352 TTGTCCTAAAAAAAAAAAGTTGG - Intronic
940822104 2:158367215-158367237 TTGTGTTATAAAAAGGAAAAAGG - Intronic
941179358 2:162239496-162239518 TTTGGTTAAAAAAAAAAAGTTGG + Intronic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
941554434 2:166958922-166958944 TTCTGTGACAAAGAAGAGGTTGG - Intronic
942579984 2:177407803-177407825 TTTTTTTAAAAAAAAGAGGTGGG + Intronic
942674348 2:178411980-178412002 TTGTGTTAAAAAAAAAAAAAAGG + Intergenic
942682284 2:178490023-178490045 TTGTTTTACAACAAAGACTTGGG + Intronic
944003909 2:194877996-194878018 TTGTGTTAAACATAAGAAGTGGG + Intergenic
944229036 2:197375103-197375125 TTGTGTTACAGAACAGAAAATGG + Intergenic
945146064 2:206739406-206739428 TTGTCTTAAAAAAAAAAAGTGGG + Intronic
945258451 2:207822262-207822284 CTGTTTTCCAAATAAGAAGTGGG - Intergenic
945338853 2:208626923-208626945 TTGCCTGACACAAAAGAAGTTGG + Intronic
945433096 2:209788114-209788136 TTGTTTTAAAACAAAAAAGTTGG + Intronic
946017463 2:216615454-216615476 TTGTGTTACAAGAAAGGCTTAGG + Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947220340 2:227785719-227785741 TTTTGTTACAAAAAAGACCCTGG + Intergenic
948041348 2:234904125-234904147 TTGGGTTACAGGGAAGAAGTGGG + Intergenic
1169152396 20:3299906-3299928 CTGTGTCTCAAAAAAGAAATAGG - Intronic
1169219360 20:3812586-3812608 TTCTGTTTCAAAAAAGAACAAGG + Intergenic
1169795213 20:9455087-9455109 TTAATTTACAAAAAAGAAATAGG - Intronic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1171058778 20:21934953-21934975 TTGTATTAGCAAAAAGATGTGGG - Intergenic
1172828692 20:37813010-37813032 ATGTATTAAAAAAAAAAAGTTGG + Intronic
1172956735 20:38765317-38765339 TAGTGCCACAAAAAAGAACTGGG - Intronic
1173295826 20:41755592-41755614 TTGTTATATAAAAAAGAAATTGG - Intergenic
1173429344 20:42972259-42972281 TTGTTTTAGAAACAAGAAGTTGG + Intronic
1173504766 20:43578089-43578111 TTGTGTTGAATAAAAAAAGTAGG - Intronic
1175082782 20:56435213-56435235 TTCTGTTACAAAAATGGAATTGG - Intronic
1175094190 20:56528594-56528616 TTGTGTCCAAAAAAAAAAGTTGG + Intergenic
1176637575 21:9262518-9262540 TTGTGTTAAAAAACAGAATCAGG - Intergenic
1177249751 21:18577476-18577498 TTGTGTGACAAAGAAGGAGGAGG + Intergenic
1177269158 21:18823238-18823260 TGGTGTAACAAAAAAGATGATGG + Intergenic
1177798080 21:25800088-25800110 TTTTATTACAGAAAAAAAGTTGG + Intergenic
1178735556 21:35146557-35146579 TTGCTTTACAAAAAAAAAGGGGG - Intronic
1180371390 22:12040892-12040914 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1180421614 22:12870015-12870037 TTGTGTTAAAAAACAGAATCAGG - Intergenic
1182514401 22:30845569-30845591 TTGTTTAAAAAAAAAAAAGTGGG + Intronic
1184322375 22:43752419-43752441 TTTTGTTAGAAAGGAGAAGTGGG - Intronic
1184948913 22:47825858-47825880 TTGTTTTACAAAAGGGGAGTTGG - Intergenic
1185176059 22:49327643-49327665 ATGTGTTACAAGAAAAACGTGGG + Intergenic
949418801 3:3842445-3842467 TTGTATAACAAAAAAGTTGTAGG + Intronic
949912078 3:8919812-8919834 TTATGTTAGAAATAAGAAGACGG + Intronic
951030215 3:17873140-17873162 TTGTGTTTCAAAACAAAAGTGGG - Intronic
951041301 3:17991446-17991468 TTGTGTCACTAAAAAGGAATGGG + Intronic
951131553 3:19052040-19052062 TTGTGTTAAATTAAATAAGTAGG - Intergenic
951142946 3:19188706-19188728 TTATGTTAAAATAAAGAACTAGG + Intronic
951801406 3:26600632-26600654 GTGAGTTACAAATAAGAAGATGG - Intergenic
952056174 3:29449790-29449812 TTATGTTACAAAAAATAATTTGG + Intronic
952084355 3:29799410-29799432 TTGTGCTAAAAAAAAGTTGTAGG - Intronic
952193612 3:31049291-31049313 TTGTGTTAAAAAAAAAATATGGG + Intergenic
953075177 3:39563153-39563175 TTGGCTTACAAAAAGGTAGTGGG - Intergenic
954545976 3:51435112-51435134 TTGTGTAACAAACAAAAAGTAGG - Intronic
955332182 3:58056558-58056580 TTGTGTTTTAAAAAAGTATTTGG + Intronic
955443682 3:58984259-58984281 TAGTGTCACAACAAAGAAATAGG - Intronic
955661266 3:61301939-61301961 TTGTGGGAAAAAAAAGCAGTTGG + Intergenic
955808306 3:62759595-62759617 CTGTGTTAAATAAAAGAAGTGGG + Intronic
955808471 3:62761327-62761349 TAGTGTGACAAAAATGAACTAGG + Intronic
955870274 3:63431358-63431380 AGGTGTTACAAATAAGAAGCTGG + Intronic
956729729 3:72185585-72185607 TTATGTAAAAAAAATGAAGTAGG + Intergenic
957244526 3:77700992-77701014 TTTTTTTAAAAAAAAGAAGTTGG + Intergenic
957309924 3:78506523-78506545 TTGTTTTAAAAAAAAAAAGGCGG - Intergenic
957541925 3:81582474-81582496 ATGTGTTACAAAAATGAAATGGG - Intronic
958143548 3:89594665-89594687 ATGTGTTACAAAAAGGACATAGG + Intergenic
958161637 3:89823965-89823987 ATGTGTTTCAAAAGAGATGTTGG + Intergenic
958516635 3:95125032-95125054 TTGAGTTACAAAAAAGCTTTTGG + Intergenic
958979350 3:100703226-100703248 TTGTGATAAAAAAAAGAAAATGG + Intergenic
959446776 3:106450096-106450118 GTCTGTTACAAAACAGAAGAAGG + Intergenic
959464054 3:106664075-106664097 TTTTGTAAAAAAAAATAAGTTGG + Intergenic
959466746 3:106697346-106697368 ATGTGTTAGGAAAAAGAACTGGG - Intergenic
960175575 3:114513860-114513882 TTTTGTTATAATAAAGAGGTAGG - Intronic
960377377 3:116920001-116920023 TAGTGTTACAAGAAAGAAAAAGG + Intronic
960515514 3:118598317-118598339 TTGGGTAAGAAAAAAGAATTAGG - Intergenic
960600776 3:119456205-119456227 GTGTTTTAAAAGAAAGAAGTTGG - Intronic
962045065 3:131749842-131749864 TTCTGTTACAACAAAGAAAATGG - Intronic
962049933 3:131802494-131802516 CTGTGTTATAAAATTGAAGTAGG + Intronic
962096869 3:132301606-132301628 TTCTGTTAGAAAAAAAAAGAAGG - Intergenic
962791843 3:138818421-138818443 TTGTTTTACAAATAAGAAAAAGG - Intronic
963396144 3:144737263-144737285 CTGTGTTTCAGAAAAGAAGCAGG + Intergenic
963460773 3:145612007-145612029 TTCTGTTCCCAAAAAGAAGGTGG - Intergenic
963965666 3:151367464-151367486 TTGTTTTATAAAATAGAAATAGG + Intronic
964552086 3:157896459-157896481 TTGTATTACAAAAATGAATGTGG - Intergenic
964858423 3:161172444-161172466 TTGTGTTACAAGAAAAACCTGGG - Intronic
964979294 3:162659610-162659632 TAGTTTCACAATAAAGAAGTTGG + Intergenic
965119561 3:164535845-164535867 TTTTGTGGCATAAAAGAAGTGGG + Intergenic
965268511 3:166581665-166581687 TTGTATAACAAGAAAGAAATAGG - Intergenic
965359992 3:167726990-167727012 TTGGCTTACATAAAAGAATTTGG + Intronic
965734707 3:171808567-171808589 TTTTGTTACAAAGGAAAAGTAGG - Intronic
966314253 3:178627454-178627476 TTTTCTTTCAAAAAAGAACTGGG - Intronic
967124933 3:186414831-186414853 TTGTGTTACTAAGAAGTTGTGGG + Intergenic
967279426 3:187807771-187807793 TGTTGTTACAAATAAGAAGCAGG - Intergenic
967349124 3:188492361-188492383 TTAACTTACAAAAAAGTAGTGGG + Intronic
967354847 3:188557207-188557229 ATGCGTTACAAAAAAAAAGATGG + Intronic
967429638 3:189367108-189367130 TAGTGTTACAGAAAAGTACTAGG - Intergenic
967629645 3:191730560-191730582 CTGTGTTACAAAAGAGGAGCGGG + Intergenic
968007376 3:195252233-195252255 TACTGTCACAAATAAGAAGTTGG - Intronic
1202749320 3_GL000221v1_random:142503-142525 TTGTGTTAAAAAACAGAATCAGG + Intergenic
969348407 4:6583422-6583444 TTCTGTTACTAAAAGGAAGAAGG + Intronic
969838577 4:9863632-9863654 TTTTGTTTCAATAAAGAAGTTGG + Intronic
970336848 4:15055879-15055901 TTGAGATACAAAAGATAAGTAGG - Intronic
970570330 4:17374808-17374830 CTCTGTTAAATAAAAGAAGTGGG + Intergenic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
970984594 4:22141538-22141560 TTGTGGTAGAAGTAAGAAGTGGG - Intergenic
971046346 4:22809438-22809460 TAGTGTGAAAAGAAAGAAGTGGG - Intergenic
971638942 4:29103492-29103514 TTGTGTTACTGAAAATAATTAGG + Intergenic
972117344 4:35652859-35652881 TTGTTTTTCAAGGAAGAAGTGGG - Intergenic
972373686 4:38450232-38450254 TTGTGTTACTGACAGGAAGTTGG + Intergenic
972884826 4:43472426-43472448 TGGTTTTACAAAAAAGAAAAGGG + Intergenic
973372090 4:49259365-49259387 TTGTCTCAAAAAAAAAAAGTTGG + Intergenic
973775385 4:54236973-54236995 TTCTGTCTCAAAAAAAAAGTGGG - Intronic
973944004 4:55939233-55939255 TTGTCTTACAAAACAGGAGGGGG - Intergenic
974484348 4:62487873-62487895 TTGTGGTAAAAAAAAAAAGCCGG - Intergenic
974714804 4:65654227-65654249 TTTTTTTTCAAGAAAGAAGTTGG - Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
976053802 4:81039231-81039253 TTTTGTTTGAAGAAAGAAGTTGG + Intronic
976703890 4:88001948-88001970 TTGTGTTAAAAAAAAAAATTAGG - Intergenic
976779544 4:88743574-88743596 TTCTTTCACAAATAAGAAGTAGG + Intronic
976840978 4:89432024-89432046 TTTTTTTAAAAAAAAAAAGTTGG - Intergenic
977067612 4:92338041-92338063 ATCTGGTACAAAAAAGAACTAGG + Intronic
977856151 4:101896802-101896824 ATGTGCTTCAAAAAGGAAGTGGG + Intronic
978156617 4:105496470-105496492 TTCTATTACCAAAAAGAAGGGGG + Intergenic
978276374 4:106955689-106955711 TTGTGTTAAATAAAACCAGTTGG - Intronic
978625819 4:110684084-110684106 TGGTGTCACCCAAAAGAAGTTGG - Intergenic
979544917 4:121929385-121929407 TTTTGTAAAAATAAAGAAGTAGG - Intronic
980381457 4:132024927-132024949 TTTTGTTAAAAAAAATATGTAGG - Intergenic
980488717 4:133496140-133496162 TTGTTTTAATAAAAAAAAGTAGG - Intergenic
982394810 4:154904739-154904761 TTTTGTAACAAAAAAAAAGTGGG + Intergenic
983068905 4:163245981-163246003 TTGTGTTAAAAAAAAAAACAGGG - Intergenic
983122957 4:163911302-163911324 GTGTGTTCCAACAAAGAGGTAGG - Intronic
983952144 4:173654725-173654747 TTGGGTTGAAAAAAAGAAGAGGG - Intergenic
985403047 4:189611156-189611178 TTAAGTTAAAAAAGAGAAGTGGG - Intergenic
1202752470 4_GL000008v2_random:20934-20956 TTGTGTTAAAAAACAGAATCGGG - Intergenic
986102728 5:4629016-4629038 TTGTGTTTGAAGAAAGAAGGAGG - Intergenic
987815095 5:22890012-22890034 TTGTGTTTCATAAAATAATTTGG - Intergenic
987905544 5:24071428-24071450 TTGTTTTAAAAAAAAGAAAAAGG + Intronic
988600326 5:32633526-32633548 TTTTGTTAAAAAAATGAAATTGG - Intergenic
988654777 5:33197742-33197764 TTGTGTTAAATAAAACAAGAAGG - Intergenic
988857181 5:35239351-35239373 TTTTTTTAAAAAAAAGATGTTGG + Intergenic
989293843 5:39800437-39800459 GTGTGTTACAAAAACTCAGTTGG + Intergenic
989765057 5:45073086-45073108 TTGAGTTACACAAATGAAATGGG - Intergenic
989767710 5:45106261-45106283 TTATATTTCAAGAAAGAAGTAGG + Intergenic
990409409 5:55526066-55526088 TTTTTTTTAAAAAAAGAAGTTGG - Intronic
991099343 5:62775360-62775382 TTGTGATTAAAAAAAAAAGTTGG - Intergenic
991595248 5:68297737-68297759 TTCTTTCACAAAAAAGAAGTAGG + Exonic
991676737 5:69095554-69095576 TTATGCTACAAAAATGCAGTTGG - Intronic
992112716 5:73511345-73511367 TAGTATTACAAAAAAGAATGAGG - Intergenic
992234024 5:74690206-74690228 TTGTTTTAGAACAAATAAGTGGG + Intronic
992301958 5:75391952-75391974 TTCTGTTAAAAAACAGAATTGGG + Intronic
992443861 5:76817596-76817618 TTCTATTAGAAAATAGAAGTGGG - Intergenic
993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG + Intergenic
993658434 5:90600866-90600888 TTTTGTTTTTAAAAAGAAGTAGG - Intronic
994342861 5:98652353-98652375 TAGTGTTACCTAAAAGAAGGTGG + Intergenic
994449352 5:99921699-99921721 AAGTGATACAAAAAAGAGGTTGG - Intergenic
995250244 5:109984780-109984802 TTTTGTCACAAAAAAGAAGAAGG + Intergenic
996643454 5:125786897-125786919 CTGTGTAACAAAAAAGATCTTGG - Intergenic
997278944 5:132625384-132625406 TTTTTTTAAAAAAAAGAATTCGG - Intronic
997290163 5:132726040-132726062 TTTTGTTTAAAAAAAGAAGGGGG + Intronic
997335183 5:133103064-133103086 CTGTCTCACAAAAAAGAAGGAGG - Intronic
997587075 5:135049773-135049795 GGGTGTTACATAAATGAAGTCGG - Intronic
997701695 5:135906420-135906442 TTAAGTAACAAAAAAGAAGATGG - Intergenic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1000440976 5:161262737-161262759 ATTTGTTACAAGAGAGAAGTGGG + Intergenic
1002369564 5:178740859-178740881 TTCTTTTACAAGAAAGTAGTGGG - Intergenic
1002549725 5:179978518-179978540 ATGTCTTACAAAAATTAAGTCGG + Intronic
1002980353 6:2129849-2129871 TTGTGTTACAAACATGACCTAGG - Intronic
1003279600 6:4679811-4679833 TTCTTGTACAAGAAAGAAGTTGG - Intergenic
1003617262 6:7667028-7667050 TTCATTTACAAAAAAGAATTGGG + Intergenic
1004734586 6:18392456-18392478 GTGGGTTAAAAAAAAAAAGTAGG - Intronic
1004781456 6:18913168-18913190 TTTTGTTTCATTAAAGAAGTGGG - Intergenic
1006384276 6:33720720-33720742 TTGTTTAAAAAAAAAAAAGTTGG - Intergenic
1009527609 6:64766035-64766057 TTATTTTACAAAAAAAAAGGGGG - Intronic
1010443898 6:75929975-75929997 TTGTGTTTGAAAAAAAAATTAGG + Intronic
1010522924 6:76863236-76863258 TTGTGTTATAAAATTCAAGTGGG + Intergenic
1010581750 6:77607472-77607494 TTATGTCAGAAAAGAGAAGTTGG + Intergenic
1010874748 6:81088522-81088544 TTGTGTTAAAGAAAAGATGAGGG + Intergenic
1011471736 6:87714876-87714898 TTTTGTTATAAAAAAAGAGTAGG + Intergenic
1011631632 6:89331795-89331817 TTCTATTACAAAAAGGAAGGTGG - Intronic
1012048018 6:94303058-94303080 TTTTTTTAAAAAAAAGAAGATGG + Intergenic
1012384254 6:98659710-98659732 TTTTATAACAAGAAAGAAGTAGG - Intergenic
1012421526 6:99070941-99070963 TTGTGTTAAAAAAATTAATTAGG - Intergenic
1012574900 6:100782465-100782487 TTGTGTTCCCAAAATGAAGCAGG - Intronic
1012625343 6:101398702-101398724 TTGAGTTGCAAGAAAGAAGTAGG - Intergenic
1013531786 6:111026367-111026389 TTGCTTTAAAAAAAAAAAGTAGG - Intronic
1013878184 6:114860186-114860208 TTTAGTTACAAAAAAGGAATAGG + Intergenic
1013916856 6:115350382-115350404 TTGAATTACAAAATTGAAGTGGG + Intergenic
1014598565 6:123377957-123377979 TTGTGTTAAAACAATTAAGTTGG - Intronic
1014953181 6:127583630-127583652 TTGTGCTGCAAAAAAGAGCTTGG + Intronic
1015022613 6:128494420-128494442 TTGTGTTTCAGATAAGATGTAGG + Intronic
1015243881 6:131055756-131055778 TGGTGCTGCAAAAAAGAAGCAGG + Intronic
1015353100 6:132246152-132246174 TTGTGTTACAAAAAAAGGGCTGG - Intergenic
1015467665 6:133565675-133565697 ATGTTTTAAGAAAAAGAAGTGGG + Intergenic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1016610668 6:145985434-145985456 TCCTGATACAAATAAGAAGTGGG + Intergenic
1017287857 6:152698370-152698392 TGGTGTTACAAAATATAATTAGG + Intronic
1018100299 6:160432405-160432427 TTTTGTTACAAAAATAATGTAGG + Intronic
1018620829 6:165727979-165728001 TTGTGTTAAGAAAGACAAGTGGG + Intronic
1018704628 6:166454582-166454604 ATGTGTTACAGAAAAGAAAAAGG + Intronic
1020143694 7:5626664-5626686 TTGTGTTAAAAAAAAAAAAAAGG + Intronic
1020454355 7:8354297-8354319 TTGTTTTACAAAAATTAATTGGG - Intergenic
1020517227 7:9138297-9138319 ATTTGTTACAAAAAATAATTAGG - Intergenic
1020625475 7:10573322-10573344 TTTTCTGACTAAAAAGAAGTAGG + Intergenic
1020840387 7:13210443-13210465 TTGTGTTAAAAACCAGAAGTGGG + Intergenic
1021044791 7:15909195-15909217 CTTTGTTACAAAAAAAAATTAGG + Intergenic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1023022793 7:36025841-36025863 ATGTGTTATAAAAAAAATGTAGG - Intergenic
1023421730 7:39987312-39987334 CTGTCTCAGAAAAAAGAAGTAGG - Intronic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1023805081 7:43867208-43867230 TTATTTTACAAAAAGGAAGATGG + Intronic
1023808412 7:43891684-43891706 TTGCGTTGCAAGAAAGCAGTGGG - Intronic
1023949523 7:44831537-44831559 TTGTTTGAAAAAAAAGAAGCGGG - Intronic
1026613716 7:71883478-71883500 TTATGTTCCTAACAAGAAGTGGG - Intronic
1027008884 7:74724484-74724506 ATATGTTGCAAAAAGGAAGTTGG + Intronic
1027331204 7:77095965-77095987 TTGTGTTAAACAAAAAAAATAGG - Intergenic
1028280011 7:88913078-88913100 TTTATTTACACAAAAGAAGTGGG + Intronic
1028304309 7:89243711-89243733 TTGTGTTAAGATAAAGAAGGGGG + Intronic
1028443762 7:90895034-90895056 ATGTGTTTTAAAGAAGAAGTAGG + Intronic
1028611899 7:92721126-92721148 TTGTGGTTCAAAGAAGGAGTTGG - Intronic
1029446435 7:100615408-100615430 CTGAGTACCAAAAAAGAAGTGGG - Intergenic
1029784568 7:102775389-102775411 TTGTGTTAAACAAAAAAAATAGG + Intronic
1031444810 7:121839304-121839326 TTGTGGCACAGAAAATAAGTGGG + Intergenic
1031873676 7:127114026-127114048 GTGTGAAACAAAAAAGAAGATGG + Intronic
1032157605 7:129481865-129481887 TTGTGTTAAAAAACAAAAGTAGG + Intronic
1032872338 7:135999643-135999665 TTGTTTTCCAAAAAAAAATTCGG + Intergenic
1033227708 7:139574369-139574391 CTGTCTTAAAAAAAAAAAGTTGG + Intronic
1033810612 7:145006654-145006676 CTGAGTTACAAAAAACAAGACGG - Intergenic
1033981707 7:147173280-147173302 ATTTGTTAAAAAAAAAAAGTAGG - Intronic
1034054535 7:148020775-148020797 GTGTGTTACAACAAAGTAGTCGG - Intronic
1034342243 7:150365302-150365324 TTTTGTTACAAAACTGAACTGGG + Intergenic
1035852063 8:2930334-2930356 CTGTGTTGAAAAAAAAAAGTGGG - Intergenic
1035901751 8:3464204-3464226 TTTGGTTACAAAAAAAAATTCGG - Intronic
1037051203 8:14376663-14376685 GTTTGTTGCTAAAAAGAAGTTGG - Intronic
1037426109 8:18756616-18756638 TTATGTGGCAAAAAAGAAATTGG - Intronic
1037426387 8:18759995-18760017 TTCTGTTACAAACAAGAACAAGG + Intronic
1038844891 8:31219812-31219834 TTGTGTTACAAATCAGAATATGG + Intergenic
1040635055 8:49263553-49263575 TTGTGTCACAGTAAAGCAGTTGG + Intergenic
1041456764 8:58069037-58069059 TTATGTATCTAAAAAGAAGTAGG + Intronic
1042496912 8:69465319-69465341 TTGAGTTATAAAGAAGAAGGAGG - Intergenic
1042626427 8:70762875-70762897 TTGTGTTACAAAGCAGAAATAGG + Intronic
1042953209 8:74221936-74221958 GTGTGTGACAGCAAAGAAGTTGG + Intergenic
1043397282 8:79851289-79851311 CTGTCTTAAAAAAAAAAAGTGGG + Intergenic
1043827479 8:84946959-84946981 TTCTGTTGCTAAGAAGAAGTAGG + Intergenic
1044261734 8:90132665-90132687 TTGTTTTACAACAAAGAGGCTGG - Intergenic
1044689239 8:94860738-94860760 TTGTATTACCAAAGACAAGTTGG - Intronic
1045856633 8:106771778-106771800 TTGTGTTACTAAAAACAAAAGGG - Intergenic
1046228426 8:111317751-111317773 TTGTGTTACACAAAATATTTTGG + Intergenic
1046290136 8:112148453-112148475 TTATTTTACAAAAATGAAGGGGG - Intergenic
1047423247 8:124724582-124724604 TTGGGTTAAAAAAACAAAGTTGG - Intronic
1047878173 8:129163635-129163657 TCAAGTTACAAAAAAGATGTAGG + Intergenic
1048113581 8:131494647-131494669 TAGTGATACAAAAAAGAAACTGG + Intergenic
1048307081 8:133291985-133292007 TTGTATTGCAGAAAAGAGGTGGG - Intronic
1050471201 9:5992714-5992736 TTGTGTTAAAAAAAAAAAAAGGG - Intronic
1050655700 9:7826289-7826311 TTGTGTTAAAAAAAAAAAAGTGG + Intronic
1050706429 9:8404076-8404098 TTGTGTGAGAAAGAAAAAGTAGG + Intronic
1050718169 9:8553843-8553865 GTATGGTACAAAAAAGAAGGCGG + Intronic
1051022769 9:12565024-12565046 TAGTGATACAAAAAAAAAATGGG + Intergenic
1051777034 9:20646201-20646223 TTTTGTTACTAAAAAAAAGAGGG + Intergenic
1051916330 9:22212356-22212378 TAATGGTAAAAAAAAGAAGTGGG + Intergenic
1052896813 9:33754986-33755008 TTGTTTTACTAAAAAGCAATGGG + Intronic
1053263134 9:36688985-36689007 TTGTGTTACACAACAGATCTGGG + Intergenic
1053830700 9:42077056-42077078 TTCTGTTTCAAAAAAGGAGCTGG - Exonic
1055961380 9:81823394-81823416 TGGTGTTATAAAAATGATGTCGG + Intergenic
1056069087 9:82967396-82967418 TTATTTTACAAAGAAGAGGTTGG + Intergenic
1056204296 9:84305467-84305489 ATGTCTTACAAAATAGAAATGGG + Intronic
1056736611 9:89215214-89215236 TTCTGTAACAAAAAGGAAGGGGG + Intergenic
1056927998 9:90851070-90851092 TTGTTTTTCAAACAAGAACTCGG + Intronic
1056952946 9:91059601-91059623 GTGTCTTAGAAAAAAAAAGTTGG + Intergenic
1057515568 9:95717533-95717555 TTGTGTTATCAGAAAGAAGATGG + Intergenic
1057558578 9:96109221-96109243 TTGTGCAACAAAAAAGGAGAAGG - Intronic
1057841464 9:98488694-98488716 TTTTGTTACTAAGAAGAAATGGG + Intronic
1059074744 9:111180948-111180970 TAATGTTACATAAAAGAAGAGGG - Intergenic
1059479044 9:114573903-114573925 ATGTGTAACAAAAAAAAAGTGGG + Intergenic
1060044535 9:120329222-120329244 TTGTCTTAAAAAAAAGAAAGGGG - Intergenic
1060962514 9:127691011-127691033 TTTTGTTTCAAACAAGAAGAGGG - Exonic
1203758598 Un_GL000218v1:159917-159939 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1203717960 Un_KI270742v1:172593-172615 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1203533260 Un_KI270743v1:5636-5658 TTGTGTTAAAAAACAGAATCAGG - Intergenic
1203652180 Un_KI270751v1:136182-136204 TTGTGTTAAAAAACAGAATAAGG + Intergenic
1185859557 X:3564912-3564934 CTCTGCTTCAAAAAAGAAGTGGG + Intergenic
1186138727 X:6548409-6548431 TTGAGTTAAAAAGTAGAAGTGGG - Intergenic
1187283221 X:17878775-17878797 TTGGGTTACAAATAATAATTTGG - Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1188327446 X:28822876-28822898 TTGTGTCACAAAAAATAACAGGG - Intronic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1188575427 X:31644122-31644144 TTGGAATACAAAAAAGAAGATGG + Intronic
1188947984 X:36331856-36331878 TTCTGTAACAAAAAATAAATTGG + Intronic
1189180921 X:39003913-39003935 CAGTGTCAGAAAAAAGAAGTGGG + Intergenic
1189519247 X:41748651-41748673 TGGTGTTTCCAAAAAGAATTTGG + Intronic
1190123619 X:47684101-47684123 CTGTAATACAAGAAAGAAGTTGG + Intergenic
1190185286 X:48228396-48228418 TTGTGCTGAAAAAAAAAAGTGGG + Intronic
1191027220 X:55926774-55926796 TTGAGTTACAAAAAAAAATTGGG - Intergenic
1191732779 X:64355144-64355166 TTGTGTTATCAATACGAAGTGGG + Intronic
1193047186 X:77065881-77065903 TTATTTTCCAAAAAAGAAGCTGG + Intergenic
1194166735 X:90524872-90524894 TTCTTTTAAGAAAAAGAAGTGGG + Intergenic
1194329680 X:92566092-92566114 TTCAATTAAAAAAAAGAAGTTGG + Intronic
1194725558 X:97391669-97391691 ATGTGTTAAAAAAAAAAGGTTGG - Intronic
1195136594 X:101913012-101913034 TCATGTTAGAAAAAAAAAGTGGG + Intronic
1197511579 X:127375111-127375133 TTGTGTGACAAAAAATTATTGGG - Intergenic
1197531545 X:127634260-127634282 TTCTTTTATCAAAAAGAAGTGGG + Intergenic
1197845132 X:130793345-130793367 TTGTGTTATTAAGAAAAAGTAGG - Intronic
1197979474 X:132200083-132200105 CTGTCTTAAAAAAAAGAAGTCGG + Intergenic
1198009858 X:132540754-132540776 TTGTATTACAAAAAAGGCCTAGG + Intergenic
1198038798 X:132828219-132828241 GTGTGTTACAGAAATAAAGTAGG - Intronic
1200513003 Y:4102653-4102675 TTCTTTTAAGAAAAAGAAGTGGG + Intergenic
1200638382 Y:5685284-5685306 TTCAATTAAAAAAAAGAAGTTGG + Intronic
1200660923 Y:5956425-5956447 TTTTATTCCAAAAAAGAAATTGG + Intergenic
1200795352 Y:7336431-7336453 TTGGGTTACAATCAAGAAGCAGG - Intergenic
1200853234 Y:7908185-7908207 TTGTATTTCCAAAAAAAAGTGGG + Intergenic
1201154685 Y:11119473-11119495 TTGTCTCAAAAAAAAAAAGTTGG - Intergenic
1201172119 Y:11277458-11277480 TTGTGTTAAAAAACAGAATCAGG + Intergenic
1201391998 Y:13508722-13508744 TTTTTTTAAAAAATAGAAGTTGG + Intergenic
1201784037 Y:17753969-17753991 TTGAGAAAGAAAAAAGAAGTAGG - Intergenic
1201817516 Y:18152018-18152040 TTGAGAAAGAAAAAAGAAGTAGG + Intergenic
1202250162 Y:22862715-22862737 ATCAGTTAAAAAAAAGAAGTAGG + Intergenic
1202403151 Y:24496463-24496485 ATCAGTTAAAAAAAAGAAGTAGG + Intergenic
1202467630 Y:25173618-25173640 ATCAGTTAAAAAAAAGAAGTAGG - Intergenic