ID: 1105065457

View in Genome Browser
Species Human (GRCh38)
Location 12:133193511-133193533
Sequence CTCCAGAGGATGCAGCAACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105065457_1105065462 -6 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065462 12:133193528-133193550 CTGGAGGTGAGGAACACTGTGGG 0: 1
1: 0
2: 1
3: 25
4: 268
1105065457_1105065466 16 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065466 12:133193550-133193572 GACAGAAAGAGGGGCAAAAAAGG 0: 1
1: 0
2: 8
3: 67
4: 842
1105065457_1105065461 -7 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065461 12:133193527-133193549 TCTGGAGGTGAGGAACACTGTGG 0: 1
1: 1
2: 6
3: 39
4: 355
1105065457_1105065465 7 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065465 12:133193541-133193563 ACACTGTGGGACAGAAAGAGGGG 0: 1
1: 0
2: 3
3: 36
4: 397
1105065457_1105065464 6 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065464 12:133193540-133193562 AACACTGTGGGACAGAAAGAGGG 0: 1
1: 0
2: 2
3: 41
4: 485
1105065457_1105065463 5 Left 1105065457 12:133193511-133193533 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1105065463 12:133193539-133193561 GAACACTGTGGGACAGAAAGAGG 0: 1
1: 0
2: 4
3: 24
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105065457 Original CRISPR CTCCAGAGGATGCAGCAACA AGG (reversed) Exonic