ID: 1105070403

View in Genome Browser
Species Human (GRCh38)
Location 12:133231134-133231156
Sequence CAGTGGAGATGGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1000
Summary {0: 1, 1: 0, 2: 13, 3: 111, 4: 875}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105070403_1105070424 27 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070424 12:133231184-133231206 CCAGTCCCTGGGTGGATGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 235
1105070403_1105070412 4 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070412 12:133231161-133231183 TGGCCCAATAGCCCCCTTTCTGG 0: 1
1: 0
2: 2
3: 6
4: 101
1105070403_1105070418 16 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070418 12:133231173-133231195 CCCCTTTCTGGCCAGTCCCTGGG 0: 1
1: 0
2: 2
3: 20
4: 243
1105070403_1105070416 15 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070416 12:133231172-133231194 CCCCCTTTCTGGCCAGTCCCTGG 0: 1
1: 0
2: 2
3: 24
4: 317
1105070403_1105070421 19 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070421 12:133231176-133231198 CTTTCTGGCCAGTCCCTGGGTGG 0: 1
1: 1
2: 3
3: 29
4: 201
1105070403_1105070422 26 Left 1105070403 12:133231134-133231156 CCACCTGCCCTCCATCTCCACTG 0: 1
1: 0
2: 13
3: 111
4: 875
Right 1105070422 12:133231183-133231205 GCCAGTCCCTGGGTGGATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105070403 Original CRISPR CAGTGGAGATGGAGGGCAGG TGG (reversed) Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900726932 1:4222669-4222691 CTGTGACGATGGAGTGCAGGAGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900884587 1:5405335-5405357 GAGTGGAGATTGAAGACAGGGGG - Intergenic
901685136 1:10939565-10939587 CAGAGAAGATGAAGGTCAGGAGG - Intergenic
901922836 1:12548651-12548673 CATTGGAGAGGGAGGGAGGGAGG + Intergenic
902098482 1:13965964-13965986 TATTGGAGATGGAGCCCAGGAGG + Intergenic
902930903 1:19730780-19730802 CAGTGGAGAGGGGAGGCTGGTGG + Intronic
903280063 1:22245250-22245272 CAGTGCAGGAGGAAGGCAGGGGG + Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904753531 1:32755311-32755333 CAGAGGAGGTGGAGTGAAGGGGG + Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905173698 1:36124010-36124032 CCGTGGAGCTGGATGGCTGGAGG - Intronic
905281726 1:36853583-36853605 CTCAGGAGAGGGAGGGCAGGCGG - Intronic
905295805 1:36953751-36953773 AAGCAGAGATGCAGGGCAGGTGG + Intronic
905316151 1:37082677-37082699 AAGAGGAGATGGAGGGCAAAGGG + Intergenic
905797464 1:40823716-40823738 AAGGGGAGATGGAGGTGAGGAGG - Intronic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906476407 1:46172185-46172207 CAGGGGAGATGGCAGGCAGGTGG - Intronic
906682944 1:47743108-47743130 CAGTGGCGATGGCAGGGAGGTGG + Intergenic
907304583 1:53506627-53506649 CTGTGTAGATGGAGGGGATGTGG + Exonic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907339424 1:53724161-53724183 CAGTTGAGAGGGTGGGCAGATGG - Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
908677093 1:66617334-66617356 CAGTTAAGATGGAGGCCAGTTGG - Intronic
908690926 1:66779633-66779655 CAGAGGAGAGAGAGAGCAGGAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909561799 1:77016065-77016087 GAGTGGAGAAGGAGGGGATGTGG - Intronic
910253723 1:85225219-85225241 CCTTGGAGCTGGAGGCCAGGCGG - Intergenic
910509536 1:87988171-87988193 CGGTGGAGGGGAAGGGCAGGGGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
912415935 1:109508603-109508625 CAGAGGAGATGAAGTTCAGGTGG + Exonic
912473917 1:109923931-109923953 TTGGGGAGCTGGAGGGCAGGAGG + Exonic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912633207 1:111267276-111267298 CAGTGGTGATGGTGGCCATGGGG - Intergenic
912699963 1:111870340-111870362 CAGTGCAGAAGGAAGGGAGGTGG + Intronic
912772071 1:112473187-112473209 CAGGAGAGAGGGAGGGAAGGAGG + Intronic
913231093 1:116741321-116741343 GAGTGGACATGGAGGGCATTTGG + Intergenic
913232402 1:116751344-116751366 CACTGGAGTTGGATGGCAGCTGG + Intergenic
913533193 1:119747713-119747735 CAGGGGAGGAGGAGGGGAGGAGG - Intergenic
914244855 1:145878046-145878068 AAGGGGAGAAGGAGGGTAGGTGG + Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915140870 1:153767803-153767825 CTGTGTAGATGGAGGGCGTGAGG - Exonic
915327348 1:155087111-155087133 CAGTGGACAAGGATGGCAAGGGG + Exonic
915528104 1:156488434-156488456 CAGGGAGGATGCAGGGCAGGAGG + Intronic
915564628 1:156706653-156706675 CAGTGGAGATGGCAGGGAGACGG + Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916267482 1:162905161-162905183 CATGTGAGATGGAGGGCATGTGG - Intergenic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
916647260 1:166797898-166797920 AAGGGGAGAAGGAGGGCTGGGGG - Intergenic
916744977 1:167678297-167678319 AAGTGGAGATGCAATGCAGGAGG - Intronic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
918147975 1:181774617-181774639 GAGTAGAGATGGATGGCTGGAGG - Intronic
918395929 1:184112930-184112952 GAGTGGAGTTGGAGGTCAGGAGG - Intergenic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919888880 1:201955594-201955616 CAAGGGAGAAGGAGGGCAGTGGG - Intronic
919934652 1:202243577-202243599 CAGGGGAGGTGTAGAGCAGGAGG + Intronic
919990094 1:202703557-202703579 GAGTGGTGATGGAGGCCAAGAGG - Intronic
920078623 1:203355401-203355423 CAGGGAAGGTGGAGGGCAAGAGG + Intergenic
920300761 1:204987375-204987397 CAGGGGAGATGAGGGGGAGGGGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
920951819 1:210579132-210579154 CACGGGAGATGGAGGGTGGGAGG + Intronic
921031093 1:211335825-211335847 CAGGAGAGGTGGAGGACAGGTGG + Intronic
921281679 1:213573918-213573940 GAGTGGTGATGATGGGCAGGTGG + Intergenic
921409753 1:214823255-214823277 CAGTGGAGGTGGTGGGAGGGGGG + Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922083182 1:222318209-222318231 ATGTGGAGAAGGAGGGCGGGCGG - Intergenic
922125025 1:222713156-222713178 CAATGGAGATGCGGGGCAAGGGG - Intronic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923339045 1:232992446-232992468 CTGCACAGATGGAGGGCAGGAGG + Intronic
923461924 1:234215374-234215396 CAATGGAGAAGGGGGGCAGAGGG + Intronic
923651444 1:235877772-235877794 CAGTGTAGATGTAGCCCAGGTGG + Intronic
924444815 1:244119367-244119389 GAGAGGAGATGGAGGAAAGGAGG + Intergenic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
924803968 1:247347990-247348012 AAGTGGAGAGGAGGGGCAGGCGG + Intergenic
1062925548 10:1313297-1313319 GAGTGGCGATGGGGGACAGGTGG - Intronic
1063107432 10:3004713-3004735 GAGTGGAAATGGAGGTCATGTGG + Intergenic
1063115973 10:3072082-3072104 CAGTGGAGATTCCAGGCAGGAGG - Intronic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064142080 10:12799045-12799067 GAGTAGAGATGGAGGCCAGGAGG + Intronic
1064405548 10:15059124-15059146 AAGGGGAGAGGGAGGGAAGGGGG - Intronic
1064870694 10:19933783-19933805 GCGGGGAGAGGGAGGGCAGGAGG + Intronic
1064961575 10:20970819-20970841 CTGGGGAGATGCTGGGCAGGTGG - Intronic
1065874183 10:29982969-29982991 AAGGGGAGAGGGAGGGAAGGAGG + Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1067213934 10:44284786-44284808 GGGTGGAGATGCAGTGCAGGAGG - Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067560637 10:47302014-47302036 AAGTGGAGGAGGAGGGCATGGGG - Intronic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067786621 10:49254982-49255004 CGGTGCAGGTGGAGGGCAGTGGG - Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1069755959 10:70774600-70774622 CCGGGGATATGGTGGGCAGGAGG - Intronic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070311342 10:75276053-75276075 CAGTGGAGAAGCAGAGCGGGGGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070826059 10:79391248-79391270 ATGTGGAGATGGGGGACAGGTGG + Intronic
1070826256 10:79392037-79392059 CGGTGGAGAGGGAGGCCGGGTGG - Intronic
1070851002 10:79561339-79561361 CAGTGCAGGTTGGGGGCAGGTGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072700286 10:97635966-97635988 CAGTGGAGATGAAAGAAAGGGGG + Intronic
1072709681 10:97707810-97707832 CCCTGGAGCTGTAGGGCAGGGGG - Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1073730263 10:106279298-106279320 ATGGGGTGATGGAGGGCAGGGGG + Intergenic
1074401201 10:113142337-113142359 AAGGGGAGAGGGAGGGAAGGTGG + Intronic
1074524503 10:114252336-114252358 GAGTAGAGATTGAGGGGAGGAGG + Intronic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1075006700 10:118835841-118835863 GAGAGGAGATGGATGGCAGTGGG - Intergenic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1076019919 10:127064380-127064402 CATTGAAGAGGGAGGGCAGGAGG + Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076178643 10:128388045-128388067 CAGTGGAGGTGGGAGGCAGGAGG + Intergenic
1076319038 10:129564714-129564736 CAGAGGAAAAGAAGGGCAGGAGG - Intronic
1076444504 10:130503250-130503272 AAGGGGAGAAGGAGGGAAGGGGG - Intergenic
1076593559 10:131609197-131609219 CACTGCAGATGGAGGGAGGGAGG - Intergenic
1076749786 10:132537064-132537086 CAGAGAAGACGGAGGGGAGGCGG - Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077190129 11:1252532-1252554 CACGGGAGGTGGAGGGCAGGCGG - Intronic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077499687 11:2903542-2903564 CGGCCCAGATGGAGGGCAGGAGG - Exonic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078609552 11:12808593-12808615 CAGTGGGGAGGGGTGGCAGGTGG - Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1079392273 11:20032873-20032895 CTTTGGAGATGGAAGGCACGTGG + Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1080190851 11:29546911-29546933 AAGTGGGGATGGCAGGCAGGTGG - Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080903271 11:36515630-36515652 CAGTGGAGGGGCAGGGCAGTGGG + Intronic
1081492449 11:43579063-43579085 CATGGGAGATGGGGGGCGGGGGG + Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1081742037 11:45447727-45447749 AATAGGAAATGGAGGGCAGGAGG + Intergenic
1081759914 11:45569964-45569986 CAGTGGAGATGGAAGGGCTGAGG + Intergenic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1081813278 11:45924897-45924919 CAGTGGTGAGGGGAGGCAGGCGG + Intronic
1082835758 11:57649184-57649206 AAGGGGAGAGGGAGGGCTGGCGG + Exonic
1083147061 11:60767669-60767691 CCATGGAGAGGGAGGGTAGGGGG + Intronic
1083335879 11:61921447-61921469 CAGTGGAGATAGCAGTCAGGGGG - Intergenic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083720659 11:64602058-64602080 CAGAGGATGTGGCGGGCAGGTGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083769582 11:64859038-64859060 CAGTGGAGTAGAAGGGCTGGGGG - Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084391472 11:68880076-68880098 AGGTGGAGATGCTGGGCAGGTGG - Intergenic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084472795 11:69373020-69373042 CAGGGGAGAGGGTGGGCAGTGGG + Intergenic
1084480146 11:69415322-69415344 CAGCAGAGGTGGGGGGCAGGAGG + Intergenic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084981333 11:72830315-72830337 CAGGGGAGATGATGGCCAGGAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1085442785 11:76578979-76579001 GAGTGGAGATGGGGGTCAGAGGG + Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087037349 11:93768704-93768726 AAGGGGAGATGGTGGGCACGGGG + Intronic
1087309230 11:96521135-96521157 CAATACAGATGGGGGGCAGGGGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1088133253 11:106521727-106521749 CAGTCAAGATGAATGGCAGGTGG - Intergenic
1088902240 11:114127086-114127108 TAGTGGAGTTGGGGGGCAAGGGG - Intronic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089210517 11:116797772-116797794 GAGTAGAGATAGAGGCCAGGGGG - Intergenic
1089292980 11:117449697-117449719 TAGTGGAGGTGGATGGCAGAGGG - Intronic
1089762156 11:120735799-120735821 CAGTGGTGGTGGAGGCCATGAGG - Intronic
1090210804 11:124920067-124920089 CAGGGCAGATGGGTGGCAGGAGG + Exonic
1090217635 11:124984003-124984025 CAGTGGCCGTGCAGGGCAGGGGG + Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1090976331 11:131683486-131683508 GAGTGGAGGTGAAGGGGAGGAGG + Intronic
1091041937 11:132289479-132289501 CATGGGAGCTGGAGAGCAGGGGG - Intronic
1091156847 11:133382388-133382410 GATTGGAGAAGGAGGCCAGGAGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091446791 12:548318-548340 CCCTGGAGATGGAGGCCAGGTGG + Intronic
1091648844 12:2294491-2294513 CAGTGGAGAGTGAGGGGCGGGGG + Intronic
1091682504 12:2537130-2537152 AAGTGGAGGAGGAGGGCAGTGGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092205683 12:6613232-6613254 GAGAGGAAATGGAGGGGAGGGGG + Intergenic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1093189103 12:16054821-16054843 TGGTGGAGGTGGAGGGTAGGAGG + Intergenic
1093418476 12:18947456-18947478 CAATGGAGATGGTGGACAGAGGG - Intergenic
1093872066 12:24304886-24304908 TATTGGAAATGGAAGGCAGGAGG - Intergenic
1094018513 12:25889239-25889261 CAGAGGAGAGGGAGGGGATGGGG + Intergenic
1094304415 12:29001449-29001471 CCCAGGAGATGGAGGGCAAGAGG + Intergenic
1094492882 12:30972208-30972230 GAGTGGAGCTGGAGGTCAGTGGG + Intronic
1094571476 12:31644922-31644944 CACTGGAGATGGTGGCCAGGGGG - Intergenic
1094596988 12:31874741-31874763 CACAGGAGATGCAGGGCAGATGG + Intergenic
1095131929 12:38553127-38553149 GAGAGGAGATGAAGGGAAGGGGG - Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095735888 12:45555779-45555801 CAATGGAACTGGAAGGCAGGAGG - Intergenic
1095955434 12:47803111-47803133 CAGGGGACATGGAGGCCAGCTGG + Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096052298 12:48621270-48621292 GGGTGGAGATGGAGGGAATGGGG + Intergenic
1096394876 12:51258208-51258230 CAGTTGAGAGTGAGGGTAGGAGG + Intronic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096672941 12:53210985-53211007 TGGCTGAGATGGAGGGCAGGAGG + Exonic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1099361164 12:81703563-81703585 AAGTGGAGAAGGAGGGCAAGAGG - Intronic
1099893673 12:88619044-88619066 CAGAGGAGAAGGAAGGGAGGAGG + Intergenic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1102029907 12:109734304-109734326 AGGTGGAGATTGACGGCAGGGGG + Intronic
1102206958 12:111097384-111097406 CTCTGGAGATGGAGGGCTTGGGG - Intronic
1102490608 12:113287775-113287797 CAGTGAAGAAGGGTGGCAGGGGG - Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102822150 12:115917185-115917207 CAGGGGAGATGAAAGGCGGGCGG - Intergenic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103045690 12:117732850-117732872 CAGAGGGGATGTAGGCCAGGAGG + Intronic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103254657 12:119530798-119530820 AAGTGGAGATGGATGGCCAGAGG + Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103919619 12:124392698-124392720 CAGTGGACATGTAGTGGAGGAGG + Intronic
1103948663 12:124540506-124540528 GAGTGGAGATGGGGGGATGGGGG + Intronic
1103948861 12:124541055-124541077 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1103949041 12:124541610-124541632 GAGTGGAGATGGTGGGGGGGTGG + Intronic
1103949130 12:124541838-124541860 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1103949139 12:124541860-124541882 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1104010288 12:124925470-124925492 GAAGGGATATGGAGGGCAGGAGG - Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104830499 12:131747606-131747628 CTGTACACATGGAGGGCAGGAGG + Intronic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105592141 13:21802262-21802284 GAGTGCAGATGGATGGCAGTAGG + Intergenic
1106797046 13:33217360-33217382 CAGTGGAGGTGAAAGGCAGGAGG - Intronic
1107300719 13:38963094-38963116 CAGTAGTGAAGGAGGGCATGGGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107880351 13:44827066-44827088 TAGTGGAGGGGTAGGGCAGGTGG - Intergenic
1108516594 13:51209079-51209101 CAGTGGTGATGGATGGTATGGGG - Intergenic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113657191 13:112074134-112074156 AAGAGGAGAGGGAGGTCAGGGGG + Intergenic
1113787720 13:113011401-113011423 CAGTGCAGATGATGGACAGGTGG + Intronic
1113787732 13:113011462-113011484 CAGTGCAGATGGTGGACAGGCGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787921 13:113012443-113012465 CAGTGCGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113949225 13:114061960-114061982 CAGGGGACATGGTGGGCAGGGGG + Intronic
1114574844 14:23702803-23702825 TAGTGGAGGTAAAGGGCAGGTGG - Intergenic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1114717172 14:24839142-24839164 CAGAACAGAAGGAGGGCAGGCGG - Intronic
1115271863 14:31561550-31561572 CCGTGGTGCTGCAGGGCAGGGGG + Intronic
1115665584 14:35541631-35541653 CACTGCAGATGGATGGCAGAAGG + Intronic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119203453 14:72776497-72776519 CTGTGGAGATGGACTCCAGGGGG + Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1121163851 14:91772615-91772637 GAGGGAAGAAGGAGGGCAGGAGG + Intronic
1121489469 14:94347649-94347671 CATTGCAGCTGGAGGGCAGCTGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121565148 14:94903790-94903812 CAGTTGAGAGCTAGGGCAGGAGG + Intergenic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122672909 14:103385684-103385706 GAGTGGAGAAGGAGGTGAGGGGG + Exonic
1123005976 14:105324050-105324072 TGCAGGAGATGGAGGGCAGGGGG + Intronic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124815634 15:32989252-32989274 CACTGGGGATGGAAGGTAGGTGG + Intronic
1125367677 15:38936229-38936251 CAGTGGACATGGATGGCTTGGGG + Intergenic
1126268255 15:46780647-46780669 CAGAGGAGAATGAGGACAGGAGG - Intergenic
1126382818 15:48066373-48066395 CAGGGCAGAAAGAGGGCAGGGGG - Intergenic
1126394569 15:48200552-48200574 TAATGGAGATGGTGGGGAGGTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127392696 15:58519840-58519862 CAGATCAGATGGGGGGCAGGTGG + Intronic
1127521605 15:59748204-59748226 TGGAGGACATGGAGGGCAGGAGG - Intergenic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128030529 15:64476085-64476107 TAGTGGTGATGCATGGCAGGTGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128270805 15:66307790-66307812 AGATGGAGATGGAGGGAAGGTGG + Intronic
1128331167 15:66756668-66756690 CAGTGGAGATTGGGGCCAGAAGG + Intronic
1128453829 15:67822008-67822030 CAGAGGAGTTGGAACGCAGGAGG + Exonic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129239803 15:74244578-74244600 GACTGGAGAAGGAGGGGAGGAGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131316996 15:91348069-91348091 CAGTGGAGATGAAGGAGAAGAGG - Intergenic
1132120059 15:99168763-99168785 CAGTGGAGGAGGAGGAGAGGAGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132622958 16:876311-876333 CCGTGGAGACGGAGGGTCGGCGG + Intronic
1132804242 16:1768392-1768414 CAGGGGATGTGGATGGCAGGAGG - Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1133966913 16:10538245-10538267 CACTGGAGGTGAGGGGCAGGGGG - Intronic
1134017051 16:10895931-10895953 GAGGGGAGATGGAGGCCAGTGGG + Intronic
1134058337 16:11183706-11183728 CAGTGGAGGTGACAGGCAGGCGG - Intergenic
1134245122 16:12534055-12534077 CAGTGCAGAGTGAGGGCAGCAGG + Intronic
1135040331 16:19113368-19113390 TAGTAGAGATGGGGGGCGGGGGG + Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136500436 16:30667409-30667431 CAGTGAAGAGGGAGGCCGGGTGG - Exonic
1137697797 16:50473872-50473894 CAGTGGAGACAGAGGTTAGGAGG + Intergenic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1137801030 16:51262171-51262193 CGGGGGAGAAGGAGGGAAGGAGG - Intergenic
1137808251 16:51328483-51328505 CAGGGGAGATGGTGGGTGGGGGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138251505 16:55505457-55505479 CAGTGGAGAGGAAGGGCCTGTGG - Exonic
1138256012 16:55561541-55561563 CCGTGAAGATGGAGGGCATTTGG - Intronic
1138534753 16:57653945-57653967 CGGTGGTGATGGTGGGGAGGGGG - Intronic
1139140229 16:64253561-64253583 TAGTGGATATGGTGGGCAGGTGG - Intergenic
1139308337 16:66006989-66007011 CATTAGACATGGAGGGCATGAGG + Intergenic
1139419967 16:66844252-66844274 GAGCGGAGATTCAGGGCAGGAGG - Intronic
1139692415 16:68649709-68649731 AAGGGGAGATGGAGGGCTGGGGG + Intronic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142203989 16:88774012-88774034 CAGGGGAGAGGGAGGCCTGGAGG - Intronic
1142205796 16:88782548-88782570 CACTGGAGAGGGAGGGCGTGGGG + Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142669437 17:1480937-1480959 CAGGGGAGAAGAGGGGCAGGTGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143731198 17:8883922-8883944 CAGTGAAGGAGGTGGGCAGGAGG - Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144628751 17:16858877-16858899 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144876234 17:18398920-18398942 CTGGGCAGCTGGAGGGCAGGAGG - Intergenic
1145155994 17:20545500-20545522 CTGGGCAGCTGGAGGGCAGGAGG + Intergenic
1145160325 17:20569450-20569472 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145318655 17:21750007-21750029 CAAGGGGGATGGTGGGCAGGAGG + Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145916721 17:28578335-28578357 CAGAGGAGCTGGACAGCAGGTGG - Intronic
1145969767 17:28950068-28950090 CACTGGAGGTGGAAGGCAGCCGG + Exonic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146624272 17:34424066-34424088 GAGTGGAGACGGAGGGATGGAGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146843459 17:36169568-36169590 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146855767 17:36257506-36257528 CTGGGCAGCTGGAGGGCAGGAGG + Intronic
1146864853 17:36330869-36330891 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1146871674 17:36381417-36381439 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146879033 17:36432499-36432521 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146882974 17:36453645-36453667 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1147067712 17:37931463-37931485 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1147074560 17:37982041-37982063 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1147079243 17:38011018-38011040 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1147086083 17:38061580-38061602 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1147095182 17:38134960-38134982 CCGGGCAGCTGGAGGGCAGGAGG - Intergenic
1147102028 17:38185545-38185567 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1147317621 17:39628253-39628275 GGGGGGAGATAGAGGGCAGGGGG + Intronic
1147527209 17:41237440-41237462 CAGAGCAGATCGAGAGCAGGGGG - Intronic
1147528333 17:41249110-41249132 CAGAGCAGATCGAGAGCAGGTGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147909924 17:43849368-43849390 CTGGGGAGGTGGAGGCCAGGAGG - Intronic
1147995627 17:44358856-44358878 CACTGGAGAGGAAGGCCAGGGGG - Intronic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148910407 17:50939553-50939575 CAGGGGAGAGGGTGGGCTGGAGG + Intergenic
1149039141 17:52166823-52166845 CAGTGTAGACGAAGGTCAGGTGG + Intergenic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1149134737 17:53350952-53350974 CAGTGCAGTTGGAGGGTAAGGGG - Intergenic
1149610718 17:57955953-57955975 CACAGGAGATGGTGGGAAGGGGG + Intergenic
1149846619 17:60012055-60012077 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1150084966 17:62268630-62268652 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1150163968 17:62923950-62923972 CACTGGAGGTGGTGGGTAGGGGG - Intergenic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150432767 17:65131668-65131690 AACAGGAGATGGAGGGCAGGAGG + Intergenic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1151277457 17:73046382-73046404 CCTGGGAGATGGAAGGCAGGAGG + Intronic
1151407998 17:73902036-73902058 CAGTGGAGATGGGGGGCGGGGGG - Intergenic
1152035278 17:77868418-77868440 CAGCGGTGAGGGAGGGGAGGTGG - Intergenic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152430354 17:80245371-80245393 CCGTGGAGAGGCAGGGCTGGGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153115954 18:1656451-1656473 ATGTGGAGATGGAGGTCAAGAGG - Intergenic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153679032 18:7483073-7483095 CAGTGGAGACGGAGCTTAGGAGG - Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156580599 18:38370452-38370474 CAGTGAATCTGGAAGGCAGGAGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157540912 18:48505822-48505844 CAGTGGAGGTGGTGGGAGGGTGG - Intergenic
1158130662 18:54149181-54149203 CACTGGGGGTGGAGGGCTGGGGG - Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159431894 18:68362897-68362919 CAGTGGAGAGGGGATGCAGGAGG - Intergenic
1159775412 18:72598574-72598596 CAGTGGATTTGGGGGGCATGTGG - Intronic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160522410 18:79515441-79515463 CAGTGGTGGTGGTGGGCGGGTGG + Intronic
1160612185 18:80097138-80097160 AGGGGGACATGGAGGGCAGGCGG - Intergenic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160975417 19:1790278-1790300 GAGGGGAGAGGGAGGGGAGGGGG - Intronic
1161000703 19:1909402-1909424 CACTGGAGAGGAAGGGCTGGTGG - Intronic
1161282464 19:3453486-3453508 CAGTCGAGTTGGCGTGCAGGGGG + Intronic
1161590936 19:5128844-5128866 CAGTGGAGGCGGGGGGCGGGGGG + Intronic
1161783593 19:6309800-6309822 CAGTGGTGATGAAGACCAGGCGG + Exonic
1162080458 19:8214874-8214896 CAGAGGAGATGAAGGGCAGTGGG + Intronic
1162318988 19:9959813-9959835 CTGGGGAGGTGGGGGGCAGGGGG + Exonic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162854582 19:13458696-13458718 CAGAGGATCTGCAGGGCAGGTGG + Intronic
1163112712 19:15170964-15170986 CAGTGGGGTTGGATGCCAGGTGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163399323 19:17082529-17082551 CAGACGAGATCGGGGGCAGGAGG + Intronic
1163645181 19:18485250-18485272 GAGTTGAGATGGAGGCCTGGAGG - Intronic
1163709892 19:18840188-18840210 CAGTGGAGACGGAGGACACCGGG + Intronic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1164946162 19:32294932-32294954 GAGTGGAGGGGGTGGGCAGGAGG + Intergenic
1165059784 19:33199539-33199561 CAGAGGGGATGGGAGGCAGGAGG - Intronic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166097577 19:40550682-40550704 TAGTAGAGATGGACGGCGGGGGG + Intronic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166142684 19:40813418-40813440 CTGGGGAGATGGTGGGCGGGGGG + Intronic
1166214351 19:41325747-41325769 CAGAGGAGATGGGGGGCACGGGG - Intronic
1166234012 19:41442822-41442844 AAGTGGTGGTGGGGGGCAGGTGG + Intergenic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166757632 19:45203170-45203192 AAGTGGACCTGGAGGGCATGAGG - Intronic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1166879737 19:45920492-45920514 CAGGGGAGATGAAGACCAGGGGG + Intergenic
1167017084 19:46848225-46848247 CAGGTGTGATGGGGGGCAGGGGG + Intronic
1167196183 19:48030442-48030464 AAGCAGAGAGGGAGGGCAGGCGG - Exonic
1168103585 19:54153680-54153702 CAGTGGAGAGGGGGATCAGGGGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925659232 2:6184535-6184557 AAGGAGTGATGGAGGGCAGGAGG + Intergenic
926243706 2:11106648-11106670 TTGTAGAGATGGAGGGCGGGGGG - Intergenic
926703512 2:15819917-15819939 AGGTGGAGGTGGAGGTCAGGCGG + Intergenic
926730904 2:16034653-16034675 GAGTGGAGATGGAGGGTTTGGGG + Intergenic
926861695 2:17316898-17316920 CAGAGAAGATGGAGGTGAGGTGG + Intergenic
927154705 2:20214717-20214739 CAGGGGAGTTGGTGGGCAGGGGG + Intronic
927191721 2:20521757-20521779 TGGTGGAGATGCAGGGCAGGGGG - Intergenic
927209366 2:20629384-20629406 CAGTGCAGAGGGCGGGCTGGAGG - Intronic
927441281 2:23119732-23119754 CAATGGAGGTGGAGGGGATGGGG - Intergenic
927962791 2:27250977-27250999 GAGTGGAGAAGGAGGATAGGAGG + Intergenic
928103420 2:28452560-28452582 GAGTGGAGGTGGGAGGCAGGTGG - Intergenic
928166500 2:28976464-28976486 CTCGAGAGATGGAGGGCAGGGGG - Intronic
928261636 2:29772677-29772699 GAGAGGAGATGGAGGGTAAGGGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928916841 2:36481251-36481273 GAGTGGAGAAGGAAGGCAGTTGG + Intronic
929054360 2:37863055-37863077 CAGTGGAGGTCAAGGTCAGGAGG - Intergenic
929098567 2:38286972-38286994 GAGTAGACATGGAGGACAGGAGG + Intergenic
929814865 2:45222648-45222670 CAGGGGAGAAGGAGGGATGGGGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
932114031 2:69029042-69029064 TAGTAGAGATGGAGGGGGGGGGG - Intronic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932430243 2:71669883-71669905 CAGTGGAGGTGGTGGCCATGTGG - Intronic
932568925 2:72926987-72927009 CAGTAGAAATGCATGGCAGGGGG - Intronic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
934567906 2:95350702-95350724 CAGTGGAGGTGGGGGGCCAGTGG + Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935725980 2:106024483-106024505 TAGTGTAGGCGGAGGGCAGGAGG - Intergenic
935740200 2:106140574-106140596 CAGTTGCTATGGAGGGCCGGGGG - Intronic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
936731574 2:115387229-115387251 CAATGGAGATGGGGGTGAGGGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936981478 2:118269181-118269203 CGGGAGAGATGGAGGGGAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937198292 2:120179896-120179918 CAGTGGAGGTGGAGGGAGTGTGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937876145 2:126826926-126826948 CATAGGAGATGCAAGGCAGGAGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938094923 2:128455491-128455513 AAGGGGAGTTGGTGGGCAGGTGG - Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938596224 2:132789942-132789964 TCATGGAGATGAAGGGCAGGTGG - Intronic
938705153 2:133917333-133917355 AAGTGGAGATGAAGGGAATGGGG + Intergenic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
939998910 2:148947806-148947828 CAGTGATGATGGAGGCCAGAGGG - Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
941739404 2:169017317-169017339 CAGAATAGATGCAGGGCAGGAGG + Intronic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942315071 2:174690362-174690384 CAGTGCAGCTGGAGGGCCCGAGG + Intergenic
943247502 2:185473948-185473970 CAATGCTGACGGAGGGCAGGAGG - Intergenic
943876193 2:193071104-193071126 GAGTGGAAATGTAGGGCTGGGGG + Intergenic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
944143896 2:196485514-196485536 AGGTGGAGGTGGAAGGCAGGGGG + Intronic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945753145 2:213813434-213813456 AAGAAAAGATGGAGGGCAGGCGG + Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947120979 2:226814571-226814593 CAAAGGAGATGGAGAGCATGAGG + Intergenic
947348009 2:229213283-229213305 CATTGGATGTGGAGGGCAAGGGG - Intronic
947669221 2:231926059-231926081 CAGGAGAGAGGGAAGGCAGGCGG - Intronic
947773057 2:232686270-232686292 CGCTGGAGATGGAGGGTGGGAGG - Intergenic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948572760 2:238927740-238927762 CAGGGGAGATGGGGGCCATGGGG + Intergenic
948725078 2:239929609-239929631 CAGTGGAGGAGCAGGGCTGGTGG - Intronic
948725108 2:239929728-239929750 CAGTGGAGAAGCAGGGCTGGTGG - Intronic
948725118 2:239929779-239929801 CAGTGGAGGAGCAGGGCTGGTGG - Intronic
948725224 2:239930187-239930209 CAGTGGAGAAGCAGGGCTGGTGG - Intronic
948761266 2:240192843-240192865 CAGTGGAGAGCGAGGGCATCTGG - Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
948888582 2:240896233-240896255 CAGGGGCCATGCAGGGCAGGCGG + Intronic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169110712 20:3031581-3031603 CAGTGCAGATACAGGGCAGATGG - Intronic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170854984 20:20044128-20044150 CAGTGGAGTTTGATGGCTGGGGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171077843 20:22147262-22147284 CAGTGGAGATGGCAGGTGGGAGG - Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172034252 20:32000460-32000482 TAATGGATGTGGAGGGCAGGTGG - Exonic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1172285010 20:33734139-33734161 CTGTGGAGATCTAGGGGAGGAGG + Intronic
1172468080 20:35171922-35171944 CGGGGCAGAGGGAGGGCAGGAGG + Intergenic
1172611416 20:36255528-36255550 CTGAGAAGACGGAGGGCAGGGGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173056285 20:39616494-39616516 CAGTGAAAATGGGGGGCAGGAGG - Intergenic
1173522569 20:43710674-43710696 CAGTGGAGAGAGACAGCAGGGGG - Intronic
1173556523 20:43969965-43969987 TACTGGAGATGTAGGGCAAGGGG - Intronic
1173667483 20:44773311-44773333 CAGTGGAGATAGAGGGTCGGGGG - Intronic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1174744469 20:53047945-53047967 CAGTGGAAACGGAGGTCAGAAGG + Intronic
1175106442 20:56618393-56618415 CCGTGGAGCTGGAAGGCAGGTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175337288 20:58204942-58204964 CAGGGGAGATGGAGCCGAGGGGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175586946 20:60148684-60148706 GAGTGGAGAGTGAGGCCAGGGGG + Intergenic
1175934806 20:62509746-62509768 GGGTGGAGATGGAGGGGTGGAGG - Intergenic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176051296 20:63120925-63120947 AAGGGGAGATGGAAGGCGGGGGG - Intergenic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176199392 20:63853745-63853767 GAGTGGAGACGGGGAGCAGGAGG - Intergenic
1176289783 21:5037854-5037876 CAGTGGAGAGGGAAGACAGTGGG - Intronic
1176293513 21:5058793-5058815 CAGGGAAGAGGGAAGGCAGGAGG - Intergenic
1176511557 21:7752223-7752245 CAGTGGAGACGCACGGCAAGAGG - Intronic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1178645671 21:34382751-34382773 CAGTGGAGACGCACGGCAAGAGG - Intronic
1179428194 21:41298938-41298960 GAGTGGGGAGGGAAGGCAGGGGG + Intergenic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714480 21:43280293-43280315 AAGGGGAGGTGGAGGGGAGGTGG + Intergenic
1179714530 21:43280410-43280432 GAGGGGAGTTGGAGGGGAGGTGG + Intergenic
1179714551 21:43280460-43280482 GAGGGGAGTTGGAGGGGAGGTGG + Intergenic
1179714586 21:43280544-43280566 AAGTGGAGGTGGAGGGGATGGGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179714655 21:43280695-43280717 GAGGGGAGGTGGAGGGGAGGTGG + Intergenic
1179863747 21:44204855-44204877 CAGGGAAGAGGGAAGGCAGGAGG + Intergenic
1179867447 21:44225733-44225755 CAGTGGAGAGGGAAGACAGTGGG + Intronic
1181033740 22:20160218-20160240 CGGAGGAGCTGGAGGGCTGGAGG - Intergenic
1181039847 22:20186938-20186960 TAGTGGAGCAGGTGGGCAGGTGG + Intergenic
1181109012 22:20590614-20590636 CAGTGGTGATGGTGGGCACAGGG - Intergenic
1181497201 22:23294144-23294166 TAATTGAGATGGGGGGCAGGAGG - Intronic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1181759974 22:25051599-25051621 CAGAGGAGAGGAAGGGGAGGAGG - Intronic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183113223 22:35668629-35668651 GGATGGAGATGGGGGGCAGGAGG - Intergenic
1183167723 22:36160298-36160320 CAGAGAAGGTGGAGGACAGGAGG - Intronic
1183261625 22:36799094-36799116 CAGGGGAGGTGCAGGGCATGGGG + Intergenic
1183309334 22:37101015-37101037 CATTGGAGTTGGGGGGCAGAGGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183358027 22:37369808-37369830 GAGGGGAGATGGAGGCCCGGTGG - Exonic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183698845 22:39438299-39438321 GAGGGGAGAGGGAGGGAAGGAGG - Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1184041891 22:41949282-41949304 CAGAAGAGATGGATGGGAGGAGG + Intergenic
1184099963 22:42336782-42336804 CAGTCGTGAGGGAGGTCAGGGGG - Intronic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
1184319586 22:43730212-43730234 GAGAGGAAAAGGAGGGCAGGAGG + Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184655001 22:45936659-45936681 CACTGCAGAGGCAGGGCAGGGGG - Intronic
1184689289 22:46110186-46110208 CATCGGAGCTGGAGTGCAGGTGG - Intronic
1185044965 22:48524193-48524215 CCGTGGAGATGGAGGCCCTGAGG - Intronic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
1185348285 22:50320110-50320132 CAGTGGAGAAGCTGGGCAGATGG - Intronic
949370911 3:3333858-3333880 AAGTAGAGACGGAGGGCAGGAGG + Intergenic
949521260 3:4856273-4856295 CAATGGCGATGGTGTGCAGGTGG + Intronic
949797164 3:7863844-7863866 GAAGGAAGATGGAGGGCAGGGGG + Intergenic
950072313 3:10162650-10162672 CAGTGGTGATGGAGAGCCTGGGG + Intergenic
950096949 3:10336033-10336055 CAGAGGACATGGGGGGCAGCCGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950535908 3:13577969-13577991 CAGTGGAGGAGGAGGGCTTGTGG + Intronic
950544242 3:13629363-13629385 CAGTGGAGGTGCTGGGCATGGGG - Intronic
951761238 3:26149041-26149063 AAGTGGAGGTGGCAGGCAGGTGG - Intergenic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
952907619 3:38152748-38152770 CAGTGGACATGGAGGGACTGGGG - Intergenic
953380979 3:42472912-42472934 GAGGAGAGAGGGAGGGCAGGGGG - Intergenic
953509729 3:43523953-43523975 CAGTGGAGGTGGAAGTCATGGGG + Intronic
953694197 3:45145502-45145524 CAGTGGACTTTGAGGGCAGGAGG - Intronic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
954611325 3:51945955-51945977 CAGTGGTGATGGGGGAGAGGTGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955074233 3:55598056-55598078 CAGGGGACATGGAGGCCATGTGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
958132319 3:89443732-89443754 CAGTGGTGAAGGGGGCCAGGTGG + Intronic
959572477 3:107899755-107899777 CAAGGGAGATGGAAGGCAGATGG - Intergenic
959932793 3:112001268-112001290 CAGAGGAGAAGGGAGGCAGGGGG + Intronic
960650379 3:119941788-119941810 CTGTGCAGATGGCGGGGAGGAGG + Intronic
960970423 3:123135379-123135401 CAGGGGAGAGGAAGAGCAGGGGG - Intronic
961487026 3:127223692-127223714 GACTGGAGAGGGAGAGCAGGGGG + Intergenic
961500182 3:127326818-127326840 CAGTTGAGATGTATAGCAGGAGG - Intergenic
961634441 3:128323998-128324020 CAGAGCAGATGGAGGCCAGTGGG - Intronic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961836207 3:129662174-129662196 CAGAGGAGATGGTGGGTGGGTGG + Intronic
962143724 3:132818002-132818024 AAGTGGAGATGTTGGGTAGGTGG + Intergenic
962382695 3:134910277-134910299 CAGCAGAGTAGGAGGGCAGGAGG + Intronic
962384651 3:134923053-134923075 AAGTGGAGATGGGGGGAGGGAGG + Intronic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964413699 3:156425919-156425941 AAGTGGAGAGGGAGGGCAAGAGG + Intronic
964664006 3:159152096-159152118 CAGTGGTGAGGGAGGTGAGGTGG + Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967825934 3:193877353-193877375 CTGGGGAGAAGGTGGGCAGGAGG + Intergenic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968078449 3:195830020-195830042 CAGAGGAGCTGGAGGGCGGGCGG - Intergenic
968091379 3:195900334-195900356 CACTGGAGTTGGAGGGGACGAGG - Intronic
968222148 3:196947433-196947455 CAGTGGAGGTGGTGGACATGGGG - Exonic
968505060 4:967694-967716 CAGTGGAGTTGGGGGGAATGAGG + Intronic
968782191 4:2591441-2591463 GACAGGAGATGGAGGGCATGTGG + Intronic
968815481 4:2819561-2819583 CAGTGGAGTTGGATGGGAGCAGG - Intronic
968891972 4:3374295-3374317 CAGTGGAGTCGGAGGAGAGGAGG - Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969220328 4:5754857-5754879 AAGTGTTGACGGAGGGCAGGCGG - Intronic
969325180 4:6439927-6439949 AAGTGAAGACGTAGGGCAGGTGG - Intronic
969354855 4:6619455-6619477 CTGTGGAGCAGGAGGGCTGGGGG - Intronic
970030819 4:11672641-11672663 CAGTGGTGAGGAAGGGCTGGAGG - Intergenic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
973820261 4:54657245-54657267 CAGGGGCGATGGAGGGCGCGTGG - Intergenic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
974106888 4:57479935-57479957 CAGTGGAGAAGGTGGGAACGGGG - Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975822182 4:78282893-78282915 CACTGGACATGGTGGGCAAGAGG - Exonic
975996445 4:80321512-80321534 CAGTGGCGGTGGTGGGCGGGGGG - Intronic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
976979241 4:91205711-91205733 CAGTAGAAAGGGAGGCCAGGTGG - Intronic
977293960 4:95191915-95191937 CAGGGGAGGAGGTGGGCAGGGGG - Intronic
977749478 4:100591768-100591790 CCGTGGAGATAGAGCCCAGGCGG - Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981067442 4:140499629-140499651 CACTGGACATTGTGGGCAGGGGG - Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981756657 4:148147210-148147232 CACTGGAGATGGAGGAAAGGTGG - Intronic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982212585 4:153051227-153051249 CAGTGGCGAGCGGGGGCAGGAGG - Intergenic
983685231 4:170400587-170400609 AAGTGGAGTGGGAGGACAGGAGG - Intergenic
984514863 4:180725600-180725622 CAGTAGAGATGGAGGACAACAGG + Intergenic
984873789 4:184349858-184349880 CAGTGGAGGATGAGGACAGGGGG + Intergenic
985797824 5:1976681-1976703 CTGTTGAGATGGGGGCCAGGAGG - Intergenic
985806052 5:2044261-2044283 CAGAGAAGCTGGAGGGCACGGGG + Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
986284046 5:6347084-6347106 CAATGGAAATGGAGGGGAAGAGG - Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986717253 5:10533382-10533404 CGGAGGAGACGGAGGGCTGGGGG - Intergenic
986773262 5:10992578-10992600 CAGGGGAGATGGAGGGCGTGCGG + Exonic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988507782 5:31838983-31839005 CAGATGATCTGGAGGGCAGGAGG - Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
992193104 5:74313328-74313350 AACTGGAAGTGGAGGGCAGGGGG - Intergenic
992406397 5:76461597-76461619 CAGAGGAGATGGATGAGAGGAGG + Exonic
992822867 5:80515824-80515846 CAATGGAGATGGAGGGGCTGAGG + Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
995523217 5:113030383-113030405 AAATGCAGATGGAGGGCTGGGGG + Intronic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997530805 5:134580069-134580091 CAGTGCAGGTGGAGGGCTGTAGG + Exonic
998145429 5:139725100-139725122 CACTGGAGATGGACTGCAGGAGG - Intergenic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998552012 5:143086908-143086930 CAGTGGAGGTAGGGGGTAGGCGG - Intronic
1000116610 5:158159842-158159864 AAGAGGAGATGGTGGGTAGGAGG - Intergenic
1001041318 5:168337548-168337570 CAGTGAAGATCAAGGCCAGGAGG + Intronic
1001074789 5:168617798-168617820 CACTGCAGATGGGGTGCAGGGGG - Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001237626 5:170043446-170043468 CAGAGGAGAGGGAGGGCTGCAGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001654830 5:173341259-173341281 CAGGGGAAATGGCAGGCAGGTGG + Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001824355 5:174733478-174733500 CAGTGGAGACGGAGTGGGGGTGG - Intergenic
1001838486 5:174852927-174852949 CAGTGGAGGGGGATGGCAGTGGG + Intergenic
1002347383 5:178557468-178557490 CAGTGGATATCGCTGGCAGGAGG - Intronic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003173189 6:3736226-3736248 CAGGGGAGAAGGAGGGATGGAGG - Intronic
1003564387 6:7210845-7210867 CAGAGGAGATGGAGGGGCTGTGG - Exonic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005422356 6:25665305-25665327 GAATGGAGAGGGAGGGGAGGTGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005988637 6:30890012-30890034 AGCTGGAGATGGCGGGCAGGTGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007091806 6:39189432-39189454 CAATTGAGTTGCAGGGCAGGAGG + Exonic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008143020 6:47853971-47853993 CAGTGGCGATGCAAGTCAGGAGG - Intergenic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1009905723 6:69867694-69867716 CAGAGGAGCTGGGGGACAGGCGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1011410740 6:87063331-87063353 AAAGGGAGATGGAGGGCAGAAGG + Intergenic
1011558738 6:88594482-88594504 CAGAGGAGAATGAGGGCTGGAGG - Intergenic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1011851515 6:91635361-91635383 AAGTGGTGATGGGGGGCGGGGGG - Intergenic
1012443433 6:99284134-99284156 GAGTGGAGGTGAAGGGCATGAGG - Intronic
1013348402 6:109284365-109284387 CATTGCAGCAGGAGGGCAGGTGG - Intergenic
1013512940 6:110860147-110860169 AAGGGGAGAAGGAGGGCTGGAGG - Intronic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1014091747 6:117411679-117411701 CAGTTCATATGGAGGGCAGTGGG - Intronic
1014752095 6:125268189-125268211 GAGAGGAGACGGTGGGCAGGTGG - Intronic
1014786713 6:125627738-125627760 TAGGGGAGATGGAGGGTAAGAGG + Intergenic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016936977 6:149454896-149454918 CCGTGGAGGTGGAGGGCCAGAGG - Intronic
1018067159 6:160132199-160132221 AAGGAGACATGGAGGGCAGGTGG - Intronic
1018076241 6:160216088-160216110 AAGTGGAGCAGGAGGGCTGGGGG + Intronic
1018208904 6:161461311-161461333 TGGTGGAGAGGGAGGGTAGGTGG + Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018948455 6:168363369-168363391 AGGGGGAGATGGAGGGGAGGGGG + Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019106640 6:169673119-169673141 CAATGGATATGGAGGGATGGAGG + Intronic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019417242 7:933470-933492 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417253 7:933500-933522 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417269 7:933537-933559 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417300 7:933627-933649 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417311 7:933657-933679 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417322 7:933687-933709 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417353 7:933777-933799 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417394 7:933897-933919 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417415 7:933957-933979 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417426 7:933987-934009 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417465 7:934107-934129 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417486 7:934167-934189 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417497 7:934197-934219 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019440929 7:1046402-1046424 CAGAGGAGCTGGCAGGCAGGAGG - Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019540010 7:1547214-1547236 CCGGGGAGCTGGAGTGCAGGGGG - Intronic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1019640817 7:2102720-2102742 CAGTGGTGATGGTGGGGACGTGG - Intronic
1019643358 7:2116244-2116266 GGGTGCAGCTGGAGGGCAGGCGG + Intronic
1020153180 7:5699713-5699735 CACTGGACATGAAGGGCAGCAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022483962 7:30763506-30763528 CAGGGGAGAGGGAGAGCAAGAGG + Intronic
1022809417 7:33854309-33854331 CAGAGGAGATGCAGGGCTGGAGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023560856 7:41471816-41471838 CAGTGGTGATGGAGGACATATGG + Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023968437 7:44975472-44975494 TACTGGAGAAGGTGGGCAGGTGG - Exonic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024983873 7:55179533-55179555 CTGGGGAGAAGGTGGGCAGGAGG + Intronic
1025099511 7:56123270-56123292 CAGAGGAGAGGCAGGGCAGGAGG + Intergenic
1025164161 7:56695975-56695997 CAGTGGAGATGGGTGGTAAGTGG - Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025706121 7:63866096-63866118 CAGTGGAGATGGGTGGTAAGTGG + Intergenic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1026285017 7:68955268-68955290 GAGGGGAGAGGGAGGGGAGGGGG + Intergenic
1026407641 7:70084018-70084040 GGGTGGAGATGGAAGGGAGGTGG - Intronic
1026496347 7:70906948-70906970 CAGTGGGGATGAAGGTGAGGAGG - Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026875487 7:73876953-73876975 CAATGGAATCGGAGGGCAGGCGG - Intergenic
1027433991 7:78144884-78144906 CAGAGCACATGGGGGGCAGGGGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028072847 7:86473879-86473901 GAATGGAGAGGGAGGGAAGGAGG - Intergenic
1028074254 7:86492296-86492318 GAGTAGTGATGGTGGGCAGGTGG - Intergenic
1028181870 7:87733824-87733846 AACTGGAGCTGCAGGGCAGGAGG - Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1028972503 7:96875075-96875097 CAGTGGACTTGGATTGCAGGTGG + Intergenic
1029220430 7:98984389-98984411 AGGTGGAGATTGAGGCCAGGTGG + Intronic
1029438602 7:100575531-100575553 CAGGTGACATGCAGGGCAGGGGG + Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030121201 7:106112281-106112303 CGGTGGCGAGGAAGGGCAGGCGG + Intronic
1030406805 7:109125270-109125292 TAGGGGAGAAGGAGGGGAGGAGG + Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031978840 7:128111196-128111218 CACTGCAGTTGGAGGGCATGAGG - Intergenic
1032319058 7:130868218-130868240 GAGTGGAGACGAAGGGCAGGAGG - Intergenic
1032478107 7:132226025-132226047 CAGAGGAGAGGGAGTGAAGGAGG + Intronic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1033266150 7:139888894-139888916 GAGTGGAGAAGGGGTGCAGGGGG + Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034082825 7:148296363-148296385 TAGTAGAGATGGTGGGCGGGGGG - Intronic
1034240327 7:149605843-149605865 CAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1035171381 7:157019233-157019255 CGGTGGAGAGCGAGGGCATGAGG + Intergenic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035712346 8:1728234-1728256 TAGGGCAGCTGGAGGGCAGGTGG + Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1035913210 8:3592510-3592532 AAATGGAGATGGATGGCATGGGG + Intronic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036575405 8:10023265-10023287 CAATGGAGTTGGCAGGCAGGAGG - Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037467265 8:19172650-19172672 GAGAGGAGAGGGAGGGGAGGGGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038483259 8:27915987-27916009 CAGAGGAGAAGGAGCCCAGGAGG - Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039456229 8:37709050-37709072 CAGAGGAGAAGGAGGCCTGGAGG + Intergenic
1039777845 8:40754252-40754274 CAGTGGAGTTAGAGTACAGGAGG + Intronic
1039884227 8:41646278-41646300 CAGGGGAGGAGGAGGGGAGGCGG - Exonic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040302912 8:46197214-46197236 CAGTGGAGTGGGCGGGCAGCAGG + Intergenic
1040336595 8:46419188-46419210 GAGTGGAGTGGGAGGGCAGCAGG + Intergenic
1040440092 8:47432380-47432402 CAGTTGAGATGAAGGGGAGATGG + Intronic
1040460591 8:47644094-47644116 CTGTGAAGATGGAGTGCTGGTGG + Intronic
1040837443 8:51747204-51747226 CAGTGGAGAGGGTGGGCACCAGG - Intronic
1041466918 8:58166269-58166291 CAGTGGAGGTGGGTGGCAGGAGG + Intronic
1042220373 8:66467392-66467414 TAGTGAAGATGGTGGGGAGGGGG - Intronic
1042362812 8:67901971-67901993 TTTTGGAGGTGGAGGGCAGGGGG - Intergenic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1044775716 8:95685479-95685501 GAGGGGAGTTGGTGGGCAGGTGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045773017 8:105767119-105767141 CAGTGGAGATGGAGGGGTTAGGG + Intronic
1045845283 8:106627847-106627869 AAGTGGAGATTGAGGGCACAGGG + Intronic
1046314237 8:112478977-112478999 CAGTGGAGAGGGGATGCAGGAGG - Intronic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1047612134 8:126531516-126531538 GAGTGGAGATGAGAGGCAGGAGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048260099 8:132937988-132938010 GAGTGGAGGAGGAGGGGAGGAGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048294969 8:133207285-133207307 CAGGGGAGAAGCAGGGCAGTGGG + Intronic
1048900821 8:139036203-139036225 GAGATGAGAGGGAGGGCAGGTGG + Intergenic
1049038071 8:140092034-140092056 AAGTGGAGCTGGCCGGCAGGAGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049212651 8:141393784-141393806 CACTGGACATGGGAGGCAGGAGG + Intronic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1049378534 8:142300938-142300960 CAGAGGGGAGGGTGGGCAGGAGG + Intronic
1049404016 8:142443583-142443605 AAGTGCACACGGAGGGCAGGCGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049501645 8:142970707-142970729 CAGAGGAGACGGAGGGGTGGAGG + Intergenic
1049708640 8:144053976-144053998 GAGTGGAGAGCGAGGGCGGGGGG - Intronic
1050343583 9:4664224-4664246 CAGTGGAGATGACTGGCAGCAGG - Exonic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1052077323 9:24159231-24159253 TAGAGGAGGTGGAGGGCTGGGGG - Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053313961 9:37036661-37036683 CAGGGGAGAGGGTGGGCAAGGGG - Intergenic
1053484093 9:38439172-38439194 CAGTGGACAGGGAGCACAGGAGG + Intergenic
1054761476 9:69008145-69008167 CTGTGCACTTGGAGGGCAGGAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055907895 9:81315027-81315049 CAATGGAGATGGATGTCAGTGGG - Intergenic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056219531 9:84437608-84437630 CAGTGGAGAGGAAGGATAGGAGG - Intergenic
1056277075 9:85003803-85003825 CAGTGAAGATGGGGGGAATGGGG + Intronic
1056516180 9:87352628-87352650 AGGGGGAGAAGGAGGGCAGGTGG + Intergenic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1059656757 9:116364748-116364770 CAGTGGAGAAAGAGGGGAAGGGG + Intronic
1060025908 9:120171417-120171439 CAGTGGAGACGGCTGGCAGATGG - Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062027435 9:134347009-134347031 CTGTGGAGGTGGCAGGCAGGTGG + Intronic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062467014 9:136685999-136686021 CAGTGGTGATGTGGGCCAGGTGG - Intronic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062662026 9:137641913-137641935 CCATGGAGTTGGAGGGCATGGGG - Intronic
1062722450 9:138051472-138051494 AAGGGGAGAGGGAGGGAAGGAGG - Intronic
1185506889 X:638448-638470 CAGTGGAGGTGGAGGTCTGAAGG + Intronic
1185747373 X:2583885-2583907 CGGTGGAGGTGCAGGGCGGGCGG + Intergenic
1186670710 X:11764793-11764815 GAGAGGAGATGGCGGCCAGGCGG - Intronic
1187599008 X:20806023-20806045 CAATGGAGATGGAGGTCATTGGG + Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190302895 X:49066869-49066891 CAGAGTAGATGCCGGGCAGGGGG - Intronic
1190304349 X:49073667-49073689 CAGTAGAGATGGACGGCCTGAGG - Intronic
1190429458 X:50365338-50365360 TGGTGGAAATGGGGGGCAGGTGG - Intergenic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192127849 X:68518614-68518636 TAGGGGACAGGGAGGGCAGGTGG + Intronic
1192602897 X:72483459-72483481 CAGTCGTGATGGAGGGCAAAGGG - Intronic
1194110274 X:89824835-89824857 ATGTGGGGATGGAGGGCATGGGG + Intergenic
1194146246 X:90268628-90268650 CTGTGGAGAAGAGGGGCAGGAGG - Intergenic
1195129569 X:101839759-101839781 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195176670 X:102320070-102320092 AGGTGGAGAAGGAGGGAAGGTGG - Intronic
1195182194 X:102367023-102367045 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195254915 X:103081540-103081562 AGGTGGAGAAGGAGGGAAGGAGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1196890056 X:120283000-120283022 AAATGGAGAAGGATGGCAGGAGG + Intronic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1198155291 X:133954156-133954178 TAAGGGAGATGGTGGGCAGGAGG + Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199599774 X:149535045-149535067 GAGAGGAGAAGGAGAGCAGGAGG - Intergenic
1199650745 X:149944640-149944662 GAGAGGAGGTGGAGGACAGGAGG + Intergenic
1199650865 X:149945202-149945224 GAGAGGAGAAGGAGAGCAGGAGG + Intergenic
1200462935 Y:3479576-3479598 ATGTGGGGATGGAGGGCATGGGG + Intergenic
1200491988 Y:3837899-3837921 CTGTGGAGAAGAGGGGCAGGAGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic