ID: 1105129405

View in Genome Browser
Species Human (GRCh38)
Location 13:16916977-16916999
Sequence CACAAGGAAGTTTCTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 3, 1: 46, 2: 289, 3: 351, 4: 959}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105129405_1105129407 26 Left 1105129405 13:16916977-16916999 CCATTCTCAGAAACTTCCTTGTG 0: 3
1: 46
2: 289
3: 351
4: 959
Right 1105129407 13:16917026-16917048 AATATTCCCTTTCACAGAGTAGG 0: 661
1: 173
2: 5602
3: 9169
4: 14414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105129405 Original CRISPR CACAAGGAAGTTTCTGAGAA TGG (reversed) Intergenic
901799916 1:11702034-11702056 CACAAGCATGTTTGTGAGCATGG - Intronic
902342802 1:15795274-15795296 CAGAAGGAAGGTTATGAGCAGGG - Intergenic
902488379 1:16763115-16763137 GCCAAGAAAGTTTCTGATAATGG + Intronic
903429499 1:23282730-23282752 GAGAAGGTAGTTTCTGAGCAAGG - Intergenic
903776354 1:25796584-25796606 CACAAGGTAATTTCAGAGAAAGG - Intergenic
903895742 1:26602764-26602786 CAAAACCAAGTTTCTGAGAAAGG + Intergenic
905737421 1:40339414-40339436 CAGAAGGAACTTTGTAAGAAAGG + Intergenic
906040806 1:42786460-42786482 CCAAAGGGAGGTTCTGAGAAGGG + Intronic
906757969 1:48339057-48339079 CACTAGGAAGTTTCAGAAATTGG - Intronic
907279678 1:53339241-53339263 CATTAGGACCTTTCTGAGAAAGG - Intergenic
909590853 1:77347421-77347443 CAACAGGACTTTTCTGAGAACGG - Intronic
909964763 1:81895078-81895100 CTCAAGCAAGTGTCTTAGAAAGG - Intronic
910192315 1:84606596-84606618 CAAAAGGAAGTTGCTGAAACAGG + Intergenic
910428951 1:87142201-87142223 CACCAGGAAGTGTCCCAGAAAGG - Intronic
910770821 1:90830614-90830636 CACATTGTAGTTTCTGATAAAGG - Intergenic
911599731 1:99834946-99834968 CAAAAGTAAGGCTCTGAGAATGG + Intergenic
913180047 1:116312270-116312292 CATAAGGAAATTTCTGAAACCGG + Intergenic
913728817 1:121686632-121686654 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913729267 1:121692226-121692248 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913735373 1:121777441-121777463 CCCAAAGTATTTTCTGAGAATGG + Intergenic
913739020 1:121819510-121819532 CCCAAAGTATTTTCTGAGAATGG - Intergenic
913748235 1:121931195-121931217 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913748386 1:121933060-121933082 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913748774 1:121937861-121937883 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913753967 1:122051568-122051590 CCCAAAGTATTTTCTGAGAATGG - Intergenic
913767163 1:122204848-122204870 CACAAGGAAGTTCCTGAGCATGG - Intergenic
913781872 1:122398425-122398447 CACGAAGAAGGTTCTGAGAATGG - Intergenic
913889278 1:124288831-124288853 CGCAGAGCAGTTTCTGAGAATGG - Intergenic
913901622 1:124510301-124510323 CACGCAGCAGTTTCTGAGAATGG - Intergenic
913911857 1:124693845-124693867 CGCAGAGCAGTTTCTGAGAATGG - Intergenic
913927281 1:124909934-124909956 CACAAAGAAGTTTCTGACAATGG - Intergenic
913933246 1:125007391-125007413 CACAAAGTGGTTTCTGAGAATGG - Intergenic
913936152 1:125051033-125051055 CACAAAGAAGTTTCTGAGAGTGG - Intergenic
913936277 1:125053316-125053338 CACAAAGAAGTTTCTGAGAACGG - Intergenic
914355363 1:146879988-146880010 CACAGGGAAGGCTCTTAGAATGG - Intergenic
914747854 1:150512603-150512625 CAAAAGGAAGTTTTCGGGAAAGG - Intronic
916354746 1:163892132-163892154 AACAAGGCAGTGTTTGAGAATGG + Intergenic
916508315 1:165448216-165448238 CAGAAGGAACTCTCAGAGAAAGG - Intergenic
916810737 1:168303483-168303505 CAAAAAGATGTTACTGAGAAGGG + Intronic
917784690 1:178441806-178441828 CATAAAGAAGTATCTGAGACTGG + Intronic
917974858 1:180231876-180231898 CCCTGGGAAGTTTTTGAGAAGGG + Intronic
919252676 1:195078425-195078447 CAAAAGGAGGTTTCTAAGGAAGG - Intergenic
919899331 1:202032416-202032438 AAAAAGGAAATTTTTGAGAAGGG - Intergenic
920310514 1:205045560-205045582 CTCAAGGAGGTTTCTGAAGAGGG - Intronic
921063146 1:211603191-211603213 CAGAGGGAATTTTCTGAGAAAGG - Intergenic
921936849 1:220803564-220803586 CACACGGTAGCTTCAGAGAAGGG - Intronic
923532062 1:234819398-234819420 GCCAAGAAAGTTTCTGATAATGG - Intergenic
923931620 1:238705203-238705225 TATAAGGAAGTATCTGAGAATGG - Intergenic
1062923626 10:1298250-1298272 CAAAATGAAGTTTCTCACAATGG + Intronic
1062946118 10:1463360-1463382 CACACGGAGGTTTCTGAGCAGGG - Intronic
1063142074 10:3264369-3264391 CAAAGAGAAGGTTCTGAGAAAGG - Intergenic
1063150672 10:3333564-3333586 GATAAGGAAGCTTCAGAGAACGG + Intergenic
1063605179 10:7517137-7517159 CACAAAGAATTTCCTGAGACTGG - Intergenic
1063915112 10:10873786-10873808 GACAAGGAGGATTCAGAGAAGGG - Intergenic
1064863397 10:19852046-19852068 CACTTGGGAGTTACTGAGAAAGG + Intronic
1065121489 10:22534645-22534667 CCCAAGGAAGTTTCAAAAAATGG + Intergenic
1065677021 10:28187237-28187259 CTCAAGGAAATCTCTGAAAAGGG + Intronic
1066016360 10:31248127-31248149 CACTAGGACCTATCTGAGAATGG - Intergenic
1066704786 10:38165813-38165835 CTCAAGGAAGTAGCTGTGAAAGG + Intergenic
1066794173 10:39100457-39100479 CACAAAGAAGTTTCACACAAAGG - Intergenic
1066798620 10:39156564-39156586 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1066804502 10:39232107-39232129 CACAAAGGAGATTCTCAGAAAGG - Intergenic
1066804938 10:39238452-39238474 CACAAAGCAGTTTCTCAGATAGG - Intergenic
1066805994 10:39254252-39254274 TACAAAGCAGTTTCTCAGAAAGG + Intergenic
1066807509 10:39275110-39275132 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1066807650 10:39277344-39277366 CACAGGTCAGTTTCTCAGAAAGG + Intergenic
1066810036 10:39318611-39318633 CACATAGAAGTTTCTCTGAAAGG + Intergenic
1066811282 10:39339656-39339678 CACAAAGGAATTTCTCAGAAAGG + Intergenic
1066811641 10:39345682-39345704 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1066815885 10:39411791-39411813 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
1066815936 10:39412645-39412667 CACAAAGTAGTTTTTCAGAAAGG - Intergenic
1066820029 10:39474102-39474124 CACAAAGAAGTTACTCAGAATGG + Intergenic
1066820301 10:39478514-39478536 CACAAACAGGTTTCTCAGAATGG + Intergenic
1066820773 10:39485281-39485303 TGCAAAGAAGTTTCTCAGAATGG + Intergenic
1066826658 10:39600135-39600157 CACAAAGAGTTTTCTGAGAATGG - Intergenic
1066839630 10:39892078-39892100 CACAAGGTAGTATCTCAGAATGG - Intergenic
1066842636 10:39947546-39947568 AACAAAGCAGTTTCTGAGAATGG - Intergenic
1066896903 10:41022076-41022098 CACAAAGTAGTTGTTGAGAATGG - Intergenic
1066918822 10:41452768-41452790 AACAAAGCAGTTTCTGAGAATGG - Intergenic
1066920641 10:41488438-41488460 CACAAAGAGTTTTCTGAGAATGG - Intergenic
1066928944 10:41732664-41732686 CACAAGGCAGTTTCACAGATAGG - Intergenic
1066985776 10:42465381-42465403 CTCAAGGAAGTAGCTGTGAAAGG - Intergenic
1067390190 10:45856571-45856593 CTCAAGGAAGTAGCTGTGAAAGG - Intergenic
1067501281 10:46807297-46807319 CTCAAGGAAGTAGCTGTGAAAGG + Intergenic
1067593295 10:47532621-47532643 CTCAAGGAAGTAGCTGTGAAAGG - Intronic
1067640407 10:48040731-48040753 CTCAAGGAAGTAGCTGTGAAAGG - Intergenic
1067873087 10:49979496-49979518 CTCAAGGAAGTAGCTGTGAAAGG + Intergenic
1068625603 10:59243378-59243400 CTAAAGGAAGTTTCTGAAACAGG + Intronic
1069704561 10:70450109-70450131 CACAAGGTAATTTCTGACCATGG - Intergenic
1070137366 10:73706766-73706788 CTCAAGGAAGTAGCTGTGAAAGG - Intergenic
1070318516 10:75336835-75336857 CACATGGAAGGATCTGAGAGTGG - Intergenic
1070461611 10:76676058-76676080 CACAAGGAATGTTCTGAGGGAGG + Intergenic
1070740225 10:78898467-78898489 GGCAGGGAAGTTTCTGAGGAGGG - Intergenic
1072237509 10:93466083-93466105 GGCAGAGAAGTTTCTGAGAAGGG + Intronic
1075917400 10:126180746-126180768 TACAAAGAAGCTTCTTAGAAAGG + Intronic
1078322700 11:10351042-10351064 CACAGGGAAGTTAGAGAGAATGG + Intronic
1078588110 11:12611394-12611416 CTCAAGGAGGTATCAGAGAAAGG + Intergenic
1079916492 11:26374503-26374525 AACAAATAAGTTTCTGATAAAGG + Intronic
1080337025 11:31209344-31209366 CACAAGGAATAGTCTGAGAGGGG + Intronic
1081600863 11:44492925-44492947 GAAAAGGAATTTTCTGTGAAAGG + Intergenic
1082152274 11:48755480-48755502 CACAAAGATGTTCCTCAGAAAGG + Intergenic
1082153693 11:48775262-48775284 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1082154045 11:48780894-48780916 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1082154128 11:48782191-48782213 CACAAGGAAGTTACTCAGAAAGG + Intergenic
1082154194 11:48783390-48783412 CACAAAGACGTTTCTCAGAATGG + Intergenic
1082157137 11:48836744-48836766 CTCCAAGATGTTTCTGAGAATGG - Intergenic
1082157261 11:48839131-48839153 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1082157506 11:48843612-48843634 TTCAAAGAAGTTTCTGAGAATGG - Intergenic
1082157542 11:48844297-48844319 TACAAAGAAGTTTCTGAGAATGG - Intergenic
1082159113 11:48865384-48865406 CACAAAGGAGTTTCTGAGAATGG - Intergenic
1082159315 11:48868968-48868990 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1082159627 11:48874774-48874796 GACAAAGAAGTTCCTGAGACTGG - Intergenic
1082163537 11:48912562-48912584 AACAAAGAAGTTTCTGAGAATGG + Intergenic
1082290958 11:50369718-50369740 CACAAAGCAGTTTCAGAGAGAGG - Intergenic
1082291441 11:50377989-50378011 CACAAAGCAGTTTCTCAGATAGG - Intergenic
1082294582 11:50423810-50423832 CACAAAGCATTTTCTCAGAAAGG - Intergenic
1082294607 11:50424152-50424174 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082294982 11:50429654-50429676 CACAAAGCAGTTTCTCAGGAAGG - Intergenic
1082300272 11:50496194-50496216 CCCAAAGCAGTTTCTCAGAAAGG + Intergenic
1082304641 11:50556603-50556625 CACAAAGCAGTGTCTCAGAAAGG + Intergenic
1082306208 11:50579208-50579230 CACAAACCAGTTTCTCAGAAAGG + Intergenic
1082306394 11:50581949-50581971 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1082312249 11:50665806-50665828 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1082313335 11:50683157-50683179 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082316504 11:50731358-50731380 CACAAGGAAGTTTCTGAGAATGG + Intergenic
1082318077 11:50755519-50755541 CACAAAGAAGTTTCACAGAATGG + Intergenic
1082318290 11:50759440-50759462 CACTAAGAAGTTTCTCAGAATGG + Intergenic
1082318749 11:50768784-50768806 TACAAAGGAGTTTCTGAGAATGG + Intergenic
1082321689 11:50819360-50819382 CACAAAGAAGTTTCTGGGGGAGG - Intergenic
1082337926 11:51316432-51316454 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1082349458 11:51484228-51484250 CACAAAACAGTTTCTGAGAATGG - Intergenic
1082384858 11:51999021-51999043 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1082408009 11:52335083-52335105 CACAAAGCAGTTTCTGAGAATGG - Intergenic
1082441443 11:52818091-52818113 CACAAAACAGTTTCTGAGAATGG - Intergenic
1082448607 11:52921449-52921471 CACAAAGAAGTTTCTCAGCATGG - Intergenic
1082472423 11:53266801-53266823 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1082494195 11:53580090-53580112 CACAAAGAAGTTTCTCAGCATGG - Intergenic
1082498311 11:53639597-53639619 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1082511859 11:53836000-53836022 CACAAAGCAGTTTCTGAGAATGG - Intergenic
1082516950 11:53909292-53909314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1082522985 11:53996867-53996889 CACAGGAAACATTCTGAGAATGG - Intergenic
1082573124 11:54766508-54766530 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082575277 11:54795948-54795970 CACAAAGCAGTTTCTCAGATAGG + Intergenic
1082576000 11:54804119-54804141 CACAAGGCGGTTTCTCAGATAGG + Intergenic
1082576106 11:54805835-54805857 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1082577154 11:54821682-54821704 CACAAAGCTGTTTCTCAGAAAGG - Intergenic
1082577181 11:54822028-54822050 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082577482 11:54826622-54826644 CACAAAGGAGTCTCTCAGAAAGG - Intergenic
1082580802 11:54865884-54865906 CACAAACCAGTTTCTAAGAAAGG + Intergenic
1082583074 11:54897815-54897837 GACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082583697 11:54906993-54907015 CACAAAGCAGTTTCTCAGATAGG + Intergenic
1082588261 11:54970309-54970331 CACAAAGCAGTGTCTCAGAAAGG - Intergenic
1082592857 11:55035384-55035406 CATAAAGCAGTTTCTCAGAAAGG + Intergenic
1082595019 11:55067517-55067539 CACAAAGCAGTTTCTCAGATAGG + Intergenic
1082596938 11:55093836-55093858 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1082600430 11:55144572-55144594 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1082601580 11:55164131-55164153 CACAAACAAGATTCTCAGAAAGG + Intergenic
1082602724 11:55179257-55179279 CACAAAGTAGTTTCTCAGAAAGG + Intergenic
1082603247 11:55188507-55188529 AACAAAGATGTTTCTCAGAAAGG + Intergenic
1082604915 11:55214578-55214600 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1082606906 11:55248713-55248735 CGCAAAGAAGTTACTGGGAATGG + Intergenic
1082607307 11:55256362-55256384 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1084790527 11:71472888-71472910 CACAAGGCAGTGGCTGAGAGGGG - Intronic
1087197778 11:95317830-95317852 CACAAGGAAATTTGGGACAAAGG - Intergenic
1088318425 11:108530705-108530727 CAGGAGCAGGTTTCTGAGAATGG + Intronic
1089287885 11:117419497-117419519 CAGGAGGAGGTTTCTGAGGAGGG - Intergenic
1090442887 11:126738687-126738709 CAAAAGGACATTTCTGGGAAGGG - Intronic
1091186179 11:133649963-133649985 CACCAGGAAGTTTATGTGAGGGG - Intergenic
1091380911 12:58121-58143 CTCAAGGAGGTATCAGAGAAAGG + Intergenic
1092024907 12:5232232-5232254 AACAAGGAAGGGTCAGAGAAGGG - Intergenic
1093612188 12:21174568-21174590 CACAAGCAAATTTCCTAGAAAGG - Exonic
1094438700 12:30451258-30451280 CATAAGAAAGTTTAAGAGAAAGG - Intergenic
1094859253 12:34442250-34442272 CACAAAGTTGTTTCTCAGAATGG + Intergenic
1094861543 12:34472367-34472389 CACAAAGTAGTTTCTCAGAAAGG + Intergenic
1094862790 12:34488545-34488567 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1094864357 12:34512189-34512211 CACAAGGTACTTTCTCTGAAAGG + Intergenic
1094868484 12:34569916-34569938 CACAAAGTAGTTTCCTAGAAAGG + Intergenic
1094876769 12:34655817-34655839 CACAAAGCAGTTTTTCAGAAGGG - Intergenic
1094878791 12:34687953-34687975 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1094878977 12:34691734-34691756 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1094947299 12:35866352-35866374 CGCAAAGTAGTTTCTGAGAATGG - Intergenic
1095016612 12:36987565-36987587 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1095030346 12:37266483-37266505 CACAAAGTAGTTTCTGGTAATGG + Intergenic
1095031019 12:37279175-37279197 TACAGAGAAGTTTCTGGGAATGG - Intergenic
1095031698 12:37293471-37293493 CACAAAGCAGTTCCTGAGAATGG - Intergenic
1095031707 12:37293642-37293664 CACAAAGAATTTTCTGAGAATGG - Intergenic
1095034600 12:37345266-37345288 CACAAAAGAGTTCCTGAGAATGG + Intergenic
1095036818 12:37390688-37390710 CACAAAGAAGTTTCTGAGTGTGG - Intergenic
1095050984 12:37554228-37554250 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1095056143 12:37603650-37603672 CAGAAAGAAGTTTCTGAGAGTGG - Intergenic
1095057620 12:37633301-37633323 TACAAAGAAGATTCTGAGAATGG + Intergenic
1095057679 12:37634497-37634519 CCCAAAGAACTTACTGAGAATGG + Intergenic
1095058904 12:37658186-37658208 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1095058998 12:37660063-37660085 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1095059626 12:37666745-37666767 CACAAAGAAGTTTCTCAGAGGGG - Intergenic
1095059671 12:37667670-37667692 CACAAAGATGTTTCTGAGAATGG + Intergenic
1095061435 12:37696535-37696557 AAAAAAGAAGTTTCTGAGAATGG + Intergenic
1095062731 12:37719888-37719910 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1095064305 12:37748576-37748598 CACAAAGAAGTTACTCAAAAAGG - Intergenic
1095064910 12:37760305-37760327 CACAAAGAAGTTTCTCATAAAGG - Intergenic
1095066370 12:37781125-37781147 CACATAGAACTTTCTTAGAAAGG - Intergenic
1095066420 12:37781981-37782003 CACAAAGAAGTTTATCAGAATGG - Intergenic
1095070350 12:37835717-37835739 CACAAAGCAATTTCTCAGAAAGG - Intergenic
1095072786 12:37876503-37876525 CACAAAGCAGTTTCTTAGGAAGG + Intergenic
1095076092 12:37928047-37928069 CACAAAGCAGTTTCTCAAAAAGG + Intergenic
1095077457 12:37948658-37948680 CACAAAGCAGTTTCTCTGAAAGG + Intergenic
1095078067 12:37957691-37957713 CACAAAGCAGTTTCTCAAAAAGG - Intergenic
1095079032 12:37974040-37974062 CACAAAGCAATTTCTCAGAAAGG - Intergenic
1095079091 12:37975054-37975076 CACCAAGATGTTTCTCAGAAAGG - Intergenic
1095079249 12:37977793-37977815 CACAAAGCAGCTTCTCAGAAAGG - Intergenic
1095079390 12:37980014-37980036 CACAAAGCAGTTTCTCAGAGAGG - Intergenic
1095079403 12:37980186-37980208 CAGAAAGCAGTTTCTCAGAAAGG - Intergenic
1095302332 12:40599199-40599221 TAGAAGGAAGTTTCTGAGAAAGG + Intergenic
1095727951 12:45473126-45473148 CATAAGGAAATATCTGAGACTGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097036285 12:56126572-56126594 GGCAAGGAGGTTCCTGAGAATGG - Exonic
1097819485 12:64113857-64113879 CACAGGGCAGTTTCTGAGGTGGG - Intronic
1098598033 12:72295456-72295478 AAGAAGGAAGTTTTAGAGAAGGG + Intronic
1099345044 12:81488861-81488883 CACAACAATGTTTCTGAAAAGGG + Intronic
1099470683 12:83044040-83044062 CACAGTGAAGTTTCTATGAATGG - Intronic
1099990218 12:89713575-89713597 TATAAGGAAGTTTCTGAGGCTGG + Intergenic
1100211183 12:92400203-92400225 CACACAGAAGTTTCAGAAAAAGG + Intergenic
1105077214 13:16047164-16047186 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1105079011 13:16081885-16081907 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1105080016 13:16100947-16100969 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1105086880 13:16213975-16213997 CAAAAAGAAGTTTCTCAAAATGG - Intergenic
1105088875 13:16249741-16249763 CAAAAAGAAGTATCTCAGAATGG - Intergenic
1105088889 13:16250083-16250105 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1105089031 13:16252820-16252842 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1105089151 13:16255214-16255236 CAAAAAGAAGTATCTCAGAATGG - Intergenic
1105089169 13:16255556-16255578 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1105090430 13:16279338-16279360 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1105095102 13:16356216-16356238 CACAAAGAAGTTTCTGAGGATGG - Intergenic
1105096306 13:16376172-16376194 CACAAACAAGTTTCACAGAATGG - Intergenic
1105129405 13:16916977-16916999 CACAAGGAAGTTTCTGAGAATGG - Intergenic
1105133294 13:16980591-16980613 CATAAAGGAGTTTCTGAGAATGG - Intergenic
1105135021 13:17008388-17008410 CACAAAGAAGTTTCTGAGGATGG - Intergenic
1105143641 13:17149253-17149275 CATAAAGGAGTTTCTGAGAATGG - Intergenic
1105149698 13:17248206-17248228 CACAAAGAAGTTTCTGAGGATGG - Intergenic
1105153709 13:17313714-17313736 CACAAAGAAGTTTCTGAGGATGG - Intergenic
1105154441 13:17325982-17326004 CACAAAGAAGTTTCTGAGGATGG - Intergenic
1105160046 13:17417537-17417559 CAAAAAGAAGTATCTCAGAATGG - Intergenic
1105160064 13:17417879-17417901 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1107640896 13:42442132-42442154 CAAAAAGAAGTTTCTAAAAATGG - Intergenic
1107678402 13:42820499-42820521 GAAAAAGAAGATTCTGAGAAGGG + Intergenic
1107762420 13:43694778-43694800 AACAAGGAAGTCACTGAGGAAGG - Intronic
1107953055 13:45483334-45483356 CACAAGTCAGTTACTGAAAAGGG + Exonic
1108454361 13:50598121-50598143 CAATTGAAAGTTTCTGAGAAGGG - Intronic
1112300193 13:98223027-98223049 CACATGGTAGTTACTGATAAGGG + Intronic
1112935575 13:104794018-104794040 CAGAAGGCAGTTTCTCAGGAAGG - Intergenic
1112941926 13:104873787-104873809 CACTTGGAAACTTCTGAGAATGG + Intergenic
1113998413 14:16116737-16116759 CTCAAAGAAGTTTCTCACAATGG - Intergenic
1114001145 14:18248419-18248441 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1114001320 14:18251491-18251513 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1114002281 14:18269925-18269947 CACAAAGTAGTTTCTCAGATTGG + Intergenic
1117409542 14:55438794-55438816 GACAGGAAAGGTTCTGAGAAAGG - Intronic
1118408633 14:65452565-65452587 CACAAGGTAGAGTATGAGAAAGG + Intronic
1118993057 14:70813020-70813042 CACTATGAAGTTTTTGAGGAGGG + Intergenic
1119232553 14:72992244-72992266 CGCATGGAAGGTTCTGAGACTGG - Intronic
1120596568 14:86446485-86446507 GACTAGACAGTTTCTGAGAAAGG - Intergenic
1121930958 14:97971775-97971797 GAAAAGGAATTTTCTGGGAAAGG + Intronic
1122584562 14:102796270-102796292 CACGTGGAGGTTTCTGAGGATGG + Intronic
1122869099 14:104626698-104626720 TATAAGGAACTATCTGAGAATGG - Intergenic
1123224101 15:17000136-17000158 CACAAAGAAGCTTCTCAGAATGG - Intergenic
1123224260 15:17002920-17002942 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123224407 15:17005470-17005492 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123227642 15:17059710-17059732 CACAAAGAACTTTCTCAGAATGG - Intergenic
1123229771 15:17092728-17092750 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123230013 15:17096995-17097017 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123230272 15:17101434-17101456 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123230497 15:17105513-17105535 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123230818 15:17111322-17111344 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123231076 15:17115760-17115782 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123231687 15:17126657-17126679 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123231934 15:17130916-17130938 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123232170 15:17135010-17135032 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123232420 15:17139265-17139287 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123232674 15:17143705-17143727 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123232933 15:17148145-17148167 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123233184 15:17152592-17152614 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123233431 15:17156847-17156869 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123233695 15:17161287-17161309 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123233937 15:17165553-17165575 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123234185 15:17169792-17169814 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123234431 15:17174056-17174078 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123234677 15:17178320-17178342 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123234925 15:17182546-17182568 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123235167 15:17186805-17186827 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123235415 15:17191059-17191081 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123235661 15:17195324-17195346 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123235910 15:17199572-17199594 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123236154 15:17203813-17203835 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123236394 15:17208062-17208084 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123236650 15:17212503-17212525 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123236906 15:17216943-17216965 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123237162 15:17221376-17221398 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123237410 15:17225632-17225654 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123237656 15:17229889-17229911 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123237902 15:17234127-17234149 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123238147 15:17238366-17238388 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123238394 15:17242622-17242644 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123238639 15:17246878-17246900 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123238878 15:17251150-17251172 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123239135 15:17255589-17255611 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123239383 15:17259845-17259867 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123239788 15:17266837-17266859 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123240032 15:17271093-17271115 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123240280 15:17275332-17275354 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123240525 15:17279585-17279607 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123240770 15:17283851-17283873 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123241023 15:17288100-17288122 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123241277 15:17292365-17292387 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123241523 15:17296621-17296643 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123241768 15:17300891-17300913 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123242016 15:17305146-17305168 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123242263 15:17309371-17309393 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123242510 15:17313626-17313648 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123242766 15:17317855-17317877 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123243012 15:17322113-17322135 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123243260 15:17326362-17326384 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123243506 15:17330628-17330650 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123243838 15:17336431-17336453 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123244090 15:17340870-17340892 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123244338 15:17345129-17345151 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123244583 15:17349356-17349378 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123244836 15:17353796-17353818 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123245089 15:17358235-17358257 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123245333 15:17362485-17362507 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123245587 15:17366923-17366945 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123245842 15:17371362-17371384 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123246072 15:17375292-17375314 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123246326 15:17379735-17379757 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123246580 15:17384174-17384196 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123246815 15:17388268-17388290 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123247069 15:17392707-17392729 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123247298 15:17396976-17396998 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123247557 15:17401413-17401435 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123247804 15:17405679-17405701 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123248050 15:17409945-17409967 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123248307 15:17414385-17414407 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123248612 15:17419857-17419879 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123248861 15:17424126-17424148 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123249105 15:17428376-17428398 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123249346 15:17432640-17432662 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123249595 15:17436906-17436928 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123249833 15:17441175-17441197 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123250076 15:17445438-17445460 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123250309 15:17449674-17449696 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123250559 15:17453928-17453950 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123251079 15:17462973-17462995 CATGAAGAAGTTTCTCAGAATGG - Intergenic
1123251262 15:17466215-17466237 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123251510 15:17470464-17470486 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123251755 15:17474732-17474754 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123251999 15:17478984-17479006 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123252243 15:17483250-17483272 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123252584 15:17489397-17489419 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123252734 15:17492121-17492143 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1123303088 15:18375232-18375254 CACAAACAAGTTTCTGAGAATGG - Intergenic
1123328703 15:18801022-18801044 CACAAACAAGTTTCTGAGAATGG - Intergenic
1123371435 15:19509874-19509896 CACAAAGAAGATTCTGAGAATGG - Intergenic
1123375034 15:19570044-19570066 CACAAACAAGTTTCTGAGAATGG - Intergenic
1123376426 15:19593066-19593088 CACAAAGAAGATTCTGAGAATGG - Intergenic
1123378244 15:19623407-19623429 TACAAAGAAGTTTCTGAGAATGG - Intergenic
1123386893 15:19820831-19820853 CACAAAGAAGTTTCTCAGATTGG + Intergenic
1123387328 15:19826963-19826985 CACAAAGAATATTCTCAGAATGG + Intergenic
1125358459 15:38840958-38840980 CACTAGGAAGTGCCTGACAATGG - Intergenic
1126123976 15:45278976-45278998 CACAAGGAAGCATGAGAGAAGGG + Intergenic
1126319076 15:47402717-47402739 CACAAAGAAGTTACTTAGGATGG - Intronic
1126510291 15:49463710-49463732 CAGAAGGAACTGTGTGAGAAAGG - Intronic
1126878626 15:53070975-53070997 CAGAAGGACTTTTCTGAGAAAGG + Intergenic
1127785565 15:62351886-62351908 CCCAAGGACTGTTCTGAGAATGG + Intergenic
1127900799 15:63339449-63339471 CCCAAGGCAGTTTCTGAGGTAGG + Intronic
1131499661 15:92949779-92949801 CTCAAGGAATTTTCTCAGCAAGG + Intronic
1131739706 15:95375088-95375110 CCCCAGGAAGATTCTGAAAATGG - Intergenic
1132353930 15:101157810-101157832 CACAAGGAAGGTGCTCAGGAGGG + Intergenic
1134513932 16:14871583-14871605 CAAAAGTAATTTTCAGAGAATGG - Intronic
1134701574 16:16270083-16270105 CAAAAGTAATTTTCAGAGAATGG - Intronic
1134845367 16:17435444-17435466 CACAAGCAAGTTTTTAAAAAAGG + Intronic
1134970256 16:18524568-18524590 CAAAAGTAATTTTCAGAGAATGG + Intronic
1135210260 16:20519926-20519948 CACAATGCAGTTCCTTAGAAGGG + Intergenic
1136738355 16:32485901-32485923 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1136738491 16:32487923-32487945 CACAAAGTGGTTTCTCAGAAAGG - Intergenic
1136739946 16:32509876-32509898 CACAAAGCTGTTTCTCAGAAAGG + Intergenic
1136744050 16:32567635-32567657 CACAATGCAGTTTCAGAGATAGG - Intergenic
1136906988 16:34104016-34104038 CACAAAGAAGTTTGTCAGAATGG - Intergenic
1136907375 16:34110456-34110478 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1136907761 16:34117861-34117883 CACAAAGAATTTTCTCAGAAGGG + Intergenic
1136914964 16:34179687-34179709 CACAAAGAAGTTTCTCAGAAGGG - Intergenic
1136917453 16:34219143-34219165 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1136917822 16:34226467-34226489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1136919489 16:34251607-34251629 CACAAAGTAGTTTGTGAGAATGG - Intergenic
1136943380 16:34613561-34613583 CACAAACAAGTTTCTGAGAATGG + Intergenic
1137027082 16:35486949-35486971 AACAACAAAGTATCTGAGAAAGG + Intergenic
1137076438 16:35969789-35969811 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1137077200 16:35984023-35984045 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1137077257 16:35985385-35985407 CACAAAGAACTCTCTCAGAATGG - Intergenic
1137079810 16:36033792-36033814 TATGAAGAAGTTTCTGAGAATGG - Intergenic
1137080532 16:36047134-36047156 CACAAAGAAGTTTTGGAGAATGG - Intergenic
1137081520 16:36064862-36064884 CACAAAGAAGTTTATCAGAAAGG - Intergenic
1137099114 16:36352943-36352965 CAAAGAGCAGTTTCTGAGAATGG - Intergenic
1137855148 16:51787126-51787148 CACCAGGAAGGTGCTGAGAGAGG + Intergenic
1139672502 16:68501312-68501334 GACAAGCAAGAGTCTGAGAAGGG + Intergenic
1140307388 16:73816302-73816324 CAAAAGGAAGTCAATGAGAAAGG + Intergenic
1140591934 16:76363897-76363919 CTCACAGAAGTTTATGAGAAGGG - Intronic
1140666766 16:77234985-77235007 TACAAGGAACTATCTGAGACGGG - Intergenic
1140736555 16:77903072-77903094 CTCAAGGAAATTTTTAAGAAAGG - Intronic
1141915892 16:87096773-87096795 CAGGAGGGAGTTTGTGAGAATGG + Intronic
1142105100 16:88298345-88298367 CACAAGGGAGTCTCCGGGAAAGG + Intergenic
1203012964 16_KI270728v1_random:317461-317483 CACAAAGCTGTTTCTCAGAAAGG - Intergenic
1203014721 16_KI270728v1_random:343869-343891 CACAAAGTGGTTTCTCAGAAAGG + Intergenic
1203025548 16_KI270728v1_random:507598-507620 CACAATGCAGTTTCAGAGATAGG + Intergenic
1203029418 16_KI270728v1_random:561834-561856 CACAAAGAAGTTTCTTAGATAGG - Intergenic
1203031299 16_KI270728v1_random:590620-590642 CACAAAGCTGTTTCTCAGAAAGG - Intergenic
1203033056 16_KI270728v1_random:617028-617050 CACAAAGTGGTTTCTCAGAAAGG + Intergenic
1203040422 16_KI270728v1_random:743811-743833 CACAAAGCTGTTTCTCAGAAAGG + Intergenic
1203042303 16_KI270728v1_random:772597-772619 CACAAAGAAGTTTCTTAGATAGG + Intergenic
1203046173 16_KI270728v1_random:826833-826855 CACAATGCAGTTTCAGAGATAGG - Intergenic
1143291125 17:5829954-5829976 TACAAGAAAGTTTAGGAGAAAGG - Intronic
1145417709 17:22736034-22736056 CACAAGGAAGTTTCTCAGAAAGG - Intergenic
1145418421 17:22743612-22743634 CACAGGGAAGATTCTCAGAAAGG - Intergenic
1145418460 17:22744298-22744320 CACAAAGTAGTTTCCTAGAAAGG - Intergenic
1145443983 17:23147161-23147183 CACAAAGTAGTTTCTGAGAAGGG - Intergenic
1145457658 17:23344187-23344209 CACAAAGAATTTTCTGAGAAAGG - Intergenic
1145488466 17:23791713-23791735 CACGAAGAGGGTTCTGAGAATGG - Intergenic
1145579180 17:25111629-25111651 CACAAAGTAGTTTCTCAGAATGG - Intergenic
1145599001 17:25400077-25400099 CACGAAGAGGGTTCTGAGAATGG - Intergenic
1145631199 17:25869091-25869113 CACAAAGTAGTTTCTGACAATGG - Intergenic
1145645083 17:26070217-26070239 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1145646502 17:26090914-26090936 CACAAAGTAGTTTCTGACAATGG - Intergenic
1145671265 17:26450363-26450385 CACAGAGAAGTTTCTGAGAAAGG - Intergenic
1145674930 17:26503985-26504007 CACAAAGTAGTTTCTCAGAATGG - Intergenic
1145684994 17:26645098-26645120 CACAAAGAAGTTTCTGTCAATGG - Intergenic
1145686341 17:26670560-26670582 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1145687388 17:26686376-26686398 CACAAAGTAGTTTCTGGGAATGG - Intergenic
1145687431 17:26687229-26687251 AACAAAGAAGTTTTGGAGAATGG - Intergenic
1145687968 17:26695465-26695487 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1150076238 17:62194399-62194421 CACAAGGAAAGTTCTGTGGAAGG + Intergenic
1154378619 18:13829802-13829824 CACAAGCATCTTTGTGAGAAGGG + Intergenic
1154558093 18:15784779-15784801 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1154578947 18:16073769-16073791 CCCAAAGAAGTTTCTGAGAATGG - Intergenic
1154602777 18:16399865-16399887 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154627902 18:16745004-16745026 CACGAGTAAGTTTCTGAGAATGG - Intergenic
1154632506 18:16808421-16808443 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154685260 18:17530867-17530889 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154690449 18:17602132-17602154 CCCAAAGAAGTTTCTGAGAATGG - Intergenic
1154701913 18:17759372-17759394 CACGAGTAAGTTTCTGAGAATGG - Intergenic
1154709391 18:17862031-17862053 CACGAGTAAGTTTCTGAGAATGG - Intergenic
1154715103 18:17940535-17940557 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154723214 18:18051433-18051455 CACGAGTAAGTTTCTGAGAATGG - Intergenic
1154754890 18:18485947-18485969 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1154771961 18:18719726-18719748 CCCAAAGAAGTTTCTGAGAATGG - Intergenic
1154776216 18:18778098-18778120 CACAAAGAACGTTCTGAGAATGG - Intergenic
1154804098 18:19161539-19161561 CAGAAAGCAGTTTCTCAGAACGG - Intergenic
1154809139 18:19230516-19230538 CAGAAAGCAGTTTCTCAGAACGG - Intergenic
1154854315 18:19853495-19853517 CACAAAGATTTTTCTGAGAACGG - Intergenic
1154885076 18:20278118-20278140 CACAAAGATTTTTCTGAGAACGG - Intergenic
1154891271 18:20363385-20363407 CACAAAGATGTTTCTCAGAACGG - Intergenic
1154897394 18:20447634-20447656 CAGAAAGCAGTTTCTCAGAACGG - Intergenic
1154899754 18:20479863-20479885 CACAAAGATTTTTCTGAGAACGG - Intergenic
1154905738 18:20562182-20562204 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1154908364 18:20609200-20609222 CACAAAGAAGTTTCTTAGAATGG - Intergenic
1154910031 18:20635516-20635538 CACAAAGAAGTTTCTGAGTATGG - Intergenic
1154911052 18:20651579-20651601 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1154913149 18:20684532-20684554 CACAAAGCAGTTTCTGAGAGTGG - Intergenic
1154922260 18:20825414-20825436 CACAAAGCAGTTTCTGAGAGTGG + Intergenic
1155198615 18:23498375-23498397 CAGAAAGAATGTTCTGAGAACGG + Intergenic
1156521695 18:37727287-37727309 CTCAATGAGTTTTCTGAGAATGG + Intergenic
1157411079 18:47464103-47464125 CACATGGCAGCTTCTGAAAAAGG + Intergenic
1157617432 18:48995486-48995508 CACAAGGAGGTTTCCAAGAAGGG - Intergenic
1160366694 18:78332231-78332253 CACAAGGGACTTTCTGAGGCTGG + Intergenic
1163406448 19:17126038-17126060 CACAAGGAAGACCCTGCGAAGGG - Intronic
1163659673 19:18569124-18569146 CTCAAGGAGGTTTCTGAGATAGG + Exonic
1164327726 19:24214385-24214407 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1164328233 19:24222435-24222457 CACAAAGCAGTTTCCCAGAAAGG + Intergenic
1164333769 19:24286901-24286923 CACAAAGCAGTGTCTCAGAAAGG - Intergenic
1164335482 19:24314473-24314495 CACAAACTAGTTTCTCAGAATGG - Intergenic
1164339569 19:24375825-24375847 CACAAAGCAGTTTCTAAAAAAGG - Intergenic
1164341995 19:24411796-24411818 GGCAAAGAAGTTTCTCAGAATGG - Intergenic
1164342647 19:24422887-24422909 CACAAAAAAGTTTCTGAGAATGG - Intergenic
1164342837 19:24425783-24425805 CACAAATAAGTTTCTGAGAATGG - Intergenic
1164343027 19:24428679-24428701 CACAAAAAAGTTTCTGAGAATGG - Intergenic
1164346393 19:27266169-27266191 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1164352340 19:27365847-27365869 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1164352374 19:27366533-27366555 CACAAAGATGTTTTTCAGAATGG + Intergenic
1164352557 19:27369773-27369795 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1164354642 19:27407985-27408007 CAAAACGAAGTTTCTGAGAATGG + Intergenic
1164355164 19:27417722-27417744 CACAAATAAGTTTCTCAGGATGG + Intergenic
1164355346 19:27420022-27420044 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1164355910 19:27428767-27428789 CACAGTGAAGTTTCTCTGAATGG - Intergenic
1164356971 19:27447416-27447438 CACAAAGAAGTTTCTCTGAAAGG - Intergenic
1164357040 19:27448619-27448641 CACAAAGAAGTTTCTGAGAAAGG - Intergenic
1164357282 19:27452902-27452924 CACAAAGAAGTTTCTCAAAAAGG - Intergenic
1164358870 19:27477073-27477095 CACAAAGCTGTTTCTCAGAAAGG + Intergenic
1164358890 19:27477590-27477612 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1164359102 19:27481288-27481310 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1164359380 19:27486059-27486081 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1164360792 19:27506570-27506592 CACAAAGCAGTTTCCCAGAAAGG - Intergenic
1164366993 19:27596337-27596359 CACAAAGCTGTTTCTCAGAAAGG - Intergenic
1164367942 19:27607679-27607701 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1164368016 19:27608887-27608909 CACAAAGCAGGTTCTCAGAAAGG - Intergenic
1165533683 19:36424971-36424993 TACAAGGAAACTTCTAAGAAAGG - Intergenic
1166748656 19:45154124-45154146 CACCGGGAAGGTTCTGAGAGTGG + Intronic
1167297325 19:48659211-48659233 GCCAAGGAATTTTCTAAGAAGGG - Intergenic
1167316428 19:48765984-48766006 CAGAGGGAAGGTTCTGATAATGG - Intergenic
1167316794 19:48768366-48768388 CAGAGGGAAGGTTCTGATAATGG - Intergenic
1168719215 19:58545558-58545580 CACAAGGAGGTTTCTGGGGAGGG + Intronic
1202702819 1_KI270713v1_random:1125-1147 GCCAAGAAAGTTTCTGATAATGG - Intergenic
925515016 2:4672052-4672074 CACAGGGAAGTTTCACAGGAGGG + Intergenic
926856520 2:17262324-17262346 CACATGGAAGTTTGTGTAAATGG - Intergenic
928024868 2:27730915-27730937 CCCAAGGAAGTTTAAGAGCAAGG - Intergenic
928354012 2:30591857-30591879 GGCAAGAAAGTTTCTAAGAAGGG - Intronic
928925453 2:36574587-36574609 ATCAAGGAAGGTTCTAAGAAAGG + Intronic
929341730 2:40827159-40827181 AATAAGGAAGTATGTGAGAATGG + Intergenic
931073702 2:58684939-58684961 CACAAAGACATTTTTGAGAAAGG - Intergenic
931127606 2:59295275-59295297 GACAGGGAAGGTTCTGATAAAGG + Intergenic
931751828 2:65337589-65337611 CACAGGTAAGTTTCTGTGTAAGG + Intronic
932126090 2:69146719-69146741 TGCAAGGTAGCTTCTGAGAATGG - Intronic
933474488 2:82771686-82771708 CTCAAGGAGGTATCAGAGAAAGG + Intergenic
933717022 2:85369113-85369135 CACAAGGAAGTCCCTGGGGATGG + Intronic
934120764 2:88836939-88836961 AACAAGGTAGTGACTGAGAAGGG + Intergenic
934332651 2:92085510-92085532 CACAAACTATTTTCTGAGAATGG - Intergenic
934335512 2:92128785-92128807 CACAAATAAGATTCTGAGAATGG - Intergenic
934367943 2:92694014-92694036 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934377778 2:92851521-92851543 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934379070 2:92872249-92872271 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934399640 2:93204495-93204517 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934414491 2:93443459-93443481 CACAAATAAGATTCTGAGAATGG - Intergenic
934424984 2:93611816-93611838 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934427789 2:93656963-93656985 CACAAAGAAGTTACTGGGAATGG - Intergenic
934437607 2:93815512-93815534 CCCATTGAAGCTTCTGAGAATGG - Intergenic
934454437 2:94087161-94087183 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934455332 2:94151554-94151576 CCCAATGAAGCTTCTGAGAATGG - Intergenic
934469122 2:94499227-94499249 CATAAACAAGTTTATGAGAATGG + Intergenic
934469705 2:94509818-94509840 CAGAAATAAGTTTCTGAGAATGG + Intergenic
934472301 2:94560705-94560727 CACAAAGAAGTTTCTCACATTGG + Intergenic
934472625 2:94567514-94567536 CACAAAGTAGTTTCTCAGATTGG + Intergenic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
936620717 2:114094262-114094284 CCCAAGGAAGTTTCTGACTGTGG + Intergenic
936857391 2:116975936-116975958 CTCAAAGAAGTGTCTGGGAAGGG - Intergenic
939134733 2:138279835-138279857 CACCAGGAAGCTTGTTAGAACGG + Intergenic
939671425 2:145017376-145017398 CACAAGGAAATTTCTCAAAGAGG - Intergenic
943729426 2:191286150-191286172 CACAAATATGTTTCTGAGACTGG + Intronic
943812045 2:192198772-192198794 CACAGAGAGGTTTCTGAGACAGG + Intergenic
945430197 2:209755068-209755090 CAGAAGGAAGGTATTGAGAATGG + Intergenic
946294665 2:218774386-218774408 AACAAGGATGTTTCTGTTAATGG + Intergenic
946333337 2:219022429-219022451 CATAGGGTAGATTCTGAGAAAGG - Intronic
1170736650 20:19018753-19018775 GACAAGAATGTTTCTGAAAAAGG + Intergenic
1171387451 20:24779877-24779899 TCCAAGGAAGATTCTGAGGAAGG - Intergenic
1171545515 20:25997682-25997704 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1171573931 20:26280951-26280973 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171575319 20:26305226-26305248 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171575355 20:26305902-26305924 CACAAAGAAGTTTTTGAGAATGG - Intergenic
1171575824 20:26314849-26314871 CAAAAAGAAGTTTCTGAGAATGG - Intergenic
1171575930 20:26317058-26317080 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576005 20:26318594-26318616 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576064 20:26319790-26319812 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576711 20:26333992-26334014 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576942 20:26339098-26339120 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1171585033 20:26510308-26510330 CACCAAGAAGTTTCTCAGAACGG - Intergenic
1171595465 20:26668854-26668876 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171597104 20:26693329-26693351 CACAAATAAATTTCTGAGAATGG - Intergenic
1171641163 20:27353959-27353981 CACAAAGTAGTTTCTGACAATGG - Intergenic
1171662517 20:27673977-27673999 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171665818 20:27723778-27723800 CACAAATAAATTTCTGAGAATGG - Intergenic
1171677853 20:27904162-27904184 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171694106 20:28147370-28147392 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171694464 20:28152639-28152661 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171694625 20:28155023-28155045 CCCAAAGAAGTTTCTGAGAATGG - Intergenic
1171696316 20:28180522-28180544 CATAAACAAGTTTATGAGAATGG - Intergenic
1171717465 20:28504989-28505011 CACCAAGAAGTTTCTCAGAACGG - Intergenic
1171736128 20:28787923-28787945 AACAAAGAAGTTTCTCAGAATGG + Intergenic
1171737663 20:28814153-28814175 CACAAAGAAGTTCCTCAGAATGG + Intergenic
1171738682 20:28831855-28831877 CACAAAGAAGTTTCTCAGAGTGG - Intergenic
1171739331 20:28860177-28860199 CACAAAGAAGTTTCTCAGATTGG + Intergenic
1171743995 20:28943659-28943681 CACAAAGATGTTTCTCAGAAGGG - Intergenic
1171744071 20:28945356-28945378 CACAAAGAAGTTTCTCAGTATGG - Intergenic
1171761148 20:29195620-29195642 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1171761428 20:29201085-29201107 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1171761876 20:29209486-29209508 CAAAAAGAAGTTTCTAAGAATGG - Intergenic
1171763023 20:29229172-29229194 CACAAAGAAGTTTCTCAGAAGGG + Intergenic
1171764905 20:29255360-29255382 CACAAAGAAATTTCGCAGAATGG - Intergenic
1171765461 20:29266400-29266422 CAAAAAGAAATTTCTCAGAATGG - Intergenic
1171765907 20:29275881-29275903 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1171808261 20:29709963-29709985 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1171808379 20:29712655-29712677 CACAAAAAAGTTTCTGAGCATGG + Intergenic
1171808523 20:29716222-29716244 CTCAAAGAAGTTTGTGAGAATGG + Intergenic
1171821002 20:29838914-29838936 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1171821392 20:29846389-29846411 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1171822020 20:29858175-29858197 CACAAAGAAGTTTCTCGGAATGG - Intergenic
1171822043 20:29858516-29858538 AACAAAGAAGTTTCCCAGAATGG - Intergenic
1171825286 20:29895026-29895048 CACAAAGAAGTTTGTAAGAATGG - Intergenic
1171827008 20:29925951-29925973 CACAAAGAAGTTTCAGAGAATGG - Intergenic
1171836398 20:30155192-30155214 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1171864095 20:30465337-30465359 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1171864129 20:30466020-30466042 CACAAAGAAGTTTTTCAGAAAGG + Intergenic
1171912735 20:30980207-30980229 CACAAAGATGTTTCTGAGAGGGG + Intergenic
1172399787 20:34640029-34640051 CACAAAGAAGGCTGTGAGAAAGG + Intronic
1175484372 20:59334728-59334750 CACAAGGAAGCTTCTGGGCATGG + Intergenic
1175564284 20:59960444-59960466 CACAAAGAAGGTTATGAAAAGGG + Intronic
1176321864 21:5334761-5334783 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1176324111 21:5370375-5370397 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1176476170 21:7211605-7211627 CACAAGGAAGTTTCTCAGAATGG + Intergenic
1176481871 21:7304382-7304404 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1176483067 21:7326862-7326884 CTCAAAGAAGTTTCTCACAATGG + Intergenic
1176531809 21:7971637-7971659 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1176532213 21:7979462-7979484 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176532423 21:7983545-7983567 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176532634 21:7987629-7987651 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176532847 21:7991713-7991735 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176533052 21:7995627-7995649 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176533680 21:8007705-8007727 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1176757828 21:10738963-10738985 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1176763082 21:12979810-12979832 CACAAAGCAGTTTCTCTGAATGG + Intergenic
1176763162 21:12981171-12981193 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1176763354 21:12984753-12984775 CACAAATAAGTTTCTCAGATGGG + Intergenic
1177161770 21:17555417-17555439 TACAAGGAAGTTTCTGAGAGTGG + Intronic
1177560472 21:22744382-22744404 TACAAAGAACTTCCTGAGAATGG + Intergenic
1178133134 21:29596039-29596061 GAAAAGGAAATTTCTGAAAATGG + Intronic
1178300436 21:31448649-31448671 CCCAAGGAAGGTGCTGAGCATGG + Intronic
1178404241 21:32311543-32311565 CACAGGCAAATTCCTGAGAAGGG - Exonic
1179727151 21:43347012-43347034 CAGAAGAATGTTTCTGAGATAGG + Intergenic
1180325309 22:11368965-11368987 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1180325431 22:11371359-11371381 CAAAAAGAAGTATCTCAGAATGG - Intergenic
1180396060 22:12340740-12340762 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1180396135 22:12342270-12342292 CACGAAGAAGTTTCTCAGTATGG + Intergenic
1180396376 22:12347575-12347597 CACAAAGAAGTTTTTCAGAATGG + Intergenic
1180397888 22:12374260-12374282 CACAAAGAAGTTTGTCAGAATGG - Intergenic
1180401577 22:12434906-12434928 CACAAAGAAGTTCCTCAGAATGG + Intergenic
1180401862 22:12490385-12490407 CACAAAGAAGTTTGTCAGAATGG + Intergenic
1180403337 22:12516515-12516537 CACAAAGAAGTTTTTCAGAATGG - Intergenic
1180403402 22:12517892-12517914 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1180403604 22:12522323-12522345 CACGAAGAAGTTTCTCAGTATGG - Intergenic
1180403689 22:12524024-12524046 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1180425657 22:15179217-15179239 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180425829 22:15182287-15182309 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180426790 22:15200717-15200739 CACAAAGTAGTTTCTCAGATTGG + Intergenic
1180505856 22:16001814-16001836 CACAAAGATGTTTCTGAGAATGG + Intergenic
1180505947 22:16003689-16003711 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180506057 22:16005732-16005754 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180506137 22:16007093-16007115 CACTAAGAAGTTTCTCTGAATGG + Intergenic
1180508310 22:16042870-16042892 CTGAAAGAAGTTTCTGAGAATGG + Intergenic
1180508415 22:16044740-16044762 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180508496 22:16046103-16046125 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1180509237 22:16060428-16060450 CACAAAGAAGTTTCTCAGATTGG + Intergenic
1180526615 22:16269911-16269933 CAGAAAGAAGTTTCTCAGATTGG - Intergenic
1180526930 22:16275920-16275942 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1180527032 22:16277796-16277818 CACAAAGATGTTTCTGAGAATGG - Intergenic
1181370471 22:22410962-22410984 CACTAGTAAGTTTCAGAAAATGG - Intergenic
1181973212 22:26709506-26709528 CACAAGGAATATTCTGACTAAGG - Intergenic
1182149225 22:28016945-28016967 CACAAGGAAGTGCCAGGGAAAGG + Intronic
1182156476 22:28078150-28078172 TACAAAGGAGTTTCTGAAAATGG - Intronic
1183227868 22:36562784-36562806 GACAAGGAAGGTGCTGCGAATGG - Intergenic
1203332518 22_KI270739v1_random:14954-14976 CACTAAGAAGTTTCTCTGAATGG - Intergenic
1203332600 22_KI270739v1_random:16315-16337 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1203332710 22_KI270739v1_random:18358-18380 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1203332801 22_KI270739v1_random:20233-20255 CACAAAGATGTTTCTGAGAATGG - Intergenic
1202718294 2_KI270715v1_random:37250-37272 CACAAATAAGATTCTGAGAATGG - Intergenic
1202718802 2_KI270715v1_random:45231-45253 CACAAATAAGATTCTGAGAATGG - Intergenic
1202727070 2_KI270716v1_random:12118-12140 CACAAACTATTTTCTGAGAATGG - Intergenic
949113307 3:288739-288761 CACAGGGAATTGTCTGTGAAGGG + Intronic
949193092 3:1273009-1273031 CAGCAGGAAGTGCCTGAGAATGG - Intronic
951542547 3:23796215-23796237 CTCACAGATGTTTCTGAGAATGG + Intergenic
952183669 3:30945405-30945427 CACCAGGAAGCTGCTGAGGAGGG - Intergenic
952760083 3:36905796-36905818 CACAAGGAAGGCTCTAAGCAGGG - Intronic
953036994 3:39220726-39220748 GAGAAGGAAGTTCCTGAGGAAGG + Intergenic
953350959 3:42215813-42215835 TCCAAGGAAGCCTCTGAGAACGG - Intronic
955943053 3:64164888-64164910 CACAGGGACTTTTCTGAGGATGG - Intronic
958085820 3:88804901-88804923 GACAATAAACTTTCTGAGAATGG + Intergenic
958198623 3:90278340-90278362 CACAAAGAAGTTTCTAAGAGAGG + Intergenic
958201262 3:90318672-90318694 CACAAAGAAGTTTCTCAGAGTGG + Intergenic
958202731 3:90340692-90340714 TACAAAGAAGTTTCTCAGTATGG + Intergenic
958202798 3:90341885-90341907 CACAAAGAGGTTTCTCAGAATGG + Intergenic
958203208 3:90349910-90349932 TACAAAGAAGTTTCTCAGAATGG + Intergenic
958203322 3:90351946-90351968 CACAAAGATGTTTCTCAGAATGG + Intergenic
958205056 3:90380718-90380740 CACAAGGAAGTTTCTGAGAATGG + Intergenic
958206059 3:90395069-90395091 CACAACAAAGTTTCTCAGAATGG + Intergenic
958207064 3:90414837-90414859 CACAAAGGAGTTTCTGAGAATGG + Intergenic
958207221 3:90418079-90418101 CACAAAGTGGTTTGTGAGAATGG + Intergenic
958207538 3:90422365-90422387 CATAAAGAGGTTTCTGAGAATGG + Intergenic
958207681 3:90425094-90425116 CGTAAAGAAGTTTCTGAGAATGG + Intergenic
958207968 3:90430085-90430107 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958208731 3:90439024-90439046 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958208902 3:90442079-90442101 CACAAAGAGGTTTCTGAGAATGG + Intergenic
958209472 3:90451936-90451958 CACAAATTACTTTCTGAGAACGG + Intergenic
958210132 3:90463851-90463873 CAAAAAGAGGTTTCTGAGAATGG + Intergenic
958211280 3:90480917-90480939 CACAAAGAAGTTTCTGGGAATGG + Intergenic
958211289 3:90481088-90481110 CTCAAAGAAGTTTCTGAGAATGG + Intergenic
958211354 3:90482283-90482305 CACAAAGTAGTTTCTGAGTATGG + Intergenic
958215468 3:90562778-90562800 CACAAAATAGTTTCTGATAATGG + Intergenic
958215791 3:90573111-90573133 CAAAAAGTAGTTTCTGAGAATGG + Intergenic
958272566 3:91522712-91522734 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958272672 3:91524758-91524780 CACAAAGTAGTTTCTCAGTATGG + Intergenic
958273312 3:91537573-91537595 CACAAAGTAGTTTCTGAGTATGG + Intergenic
958273371 3:91538599-91538621 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958273444 3:91540134-91540156 CACACAGTAGTTTCTCAGAATGG + Intergenic
958289750 3:91807734-91807756 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958321107 3:92320927-92320949 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958323880 3:92366713-92366735 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958328909 3:92449231-92449253 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958368209 3:93092965-93092987 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958377020 3:93237393-93237415 CACAAAGCAGTTTCTGAGAATGG - Intergenic
958403331 3:93718015-93718037 CACAATGCAGTTTCTGAGAATGG + Intergenic
958403509 3:93721764-93721786 CACAAAGTTGTTTCTGAGAATGG + Intergenic
958403615 3:93724150-93724172 CACAAAGTTGTTTCCGAGAATGG + Intergenic
958404364 3:93733809-93733831 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958404416 3:93734829-93734851 CACAAAGATGTTTCTGAGAATGG + Intergenic
958404603 3:93738410-93738432 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958404612 3:93738581-93738603 CACAAAGAAGTTTCTGAGAATGG + Intergenic
958404843 3:93742826-93742848 CACAAAGAACTTTCTGAGAATGG + Intergenic
958405670 3:93755693-93755715 CACGAAGAAGTTTTTGAGAATGG + Intergenic
958407416 3:93766452-93766474 CACAAAGAAGTTTCTGAGAATGG + Intergenic
958407433 3:93766794-93766816 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958408163 3:93774934-93774956 CACAAAGAAGTTTCTGAGAATGG + Intergenic
959155520 3:102662398-102662420 CACTGTGAGGTTTCTGAGAAAGG - Intergenic
959440086 3:106363136-106363158 CAGAGGGAAGTTACTGAGAGTGG - Intergenic
959670008 3:108966012-108966034 CTCCAGGAAGTTTCTATGAAAGG + Intronic
959783090 3:110259476-110259498 ACCAAGGAAGCTTCTGAGGAGGG + Intergenic
960040225 3:113143061-113143083 CACAAAGAAGTCTGGGAGAAAGG + Intergenic
961383929 3:126513820-126513842 CCCATGGAAGTTTCTGAATAGGG - Intronic
962925381 3:139988543-139988565 CACAAGAAAGTTTCTGGGGCAGG - Intronic
963182484 3:142373444-142373466 TACAAGAAAGTTTCTCAGAATGG + Intronic
963182863 3:142378726-142378748 TACAAGAAAGTTTCTCAGAATGG + Intronic
963930246 3:150996602-150996624 TACAAGAAAGTTTCTGATACTGG - Intergenic
964310313 3:155385278-155385300 CACAAGCAAGTGTCTGATATTGG - Intronic
964766931 3:160188554-160188576 CACATGGAGGTTCCAGAGAAGGG - Intergenic
965024252 3:163278849-163278871 TATAAGGAAGTTCTTGAGAATGG - Intergenic
965515130 3:169613379-169613401 CAGAAGGAAGCTTCTAACAATGG - Intronic
966589680 3:181668008-181668030 CACACAGACTTTTCTGAGAATGG - Intergenic
966877947 3:184334205-184334227 CACGAGGAAGTTTCCGGCAAAGG + Intronic
970231263 4:13913546-13913568 CACAAGGAGGCATCTGAGAGAGG - Intergenic
970576079 4:17429497-17429519 CACAAGAAAGTTGATGATAAAGG - Intergenic
971634034 4:29033574-29033596 CACAAGTCAGTTTCTGCCAAAGG - Intergenic
971866843 4:32183599-32183621 CATAAGGAACTATCTGAGACTGG - Intergenic
972229081 4:37049486-37049508 CACAAGGGAGTTTGAGAGAGGGG - Intergenic
972548562 4:40105899-40105921 AAAAAGGAAGTGTCAGAGAAGGG + Intronic
973171838 4:47154985-47155007 AACAAGCAAATTCCTGAGAAAGG + Intronic
973433718 4:50195469-50195491 CACAAAAAAGTTTCTGAGAATGG - Intergenic
973449897 4:50462927-50462949 CAAAAAGAAGTTTCTGAGAATGG - Intergenic
973459499 4:50621395-50621417 CACAAAGAAGTTTCTGAGAATGG - Intergenic
973459648 4:50623777-50623799 CAAAAAGAAGTTTCTGAGAATGG - Intergenic
973462620 4:50672580-50672602 CAAAAAGAAGTTTCTGAGAATGG - Intergenic
973469927 4:50792938-50792960 CACAGAGCAGTTTCTGACAATGG - Intergenic
973474238 4:50864002-50864024 CACAAATAAGTTTCTGAGGATGG - Intergenic
973491551 4:51150022-51150044 CACAAACAAGTTTCTGAGACGGG - Intergenic
973498393 4:51262965-51262987 CACAAATAAGTTTCTGAGGATGG - Intergenic
973501411 4:51312946-51312968 CAAAAAGAAGTTTCTGAGAATGG - Intergenic
973516495 4:51561273-51561295 CACAAATAAGTTTCTGAGGATGG - Intergenic
973522343 4:51657200-51657222 CACAGAGATGTTTCCGAGAATGG - Intergenic
975567634 4:75775824-75775846 AACAAGGGAGTTTCTAAAAAAGG + Intronic
975670173 4:76772575-76772597 CACGAGGAAGATGCTGAGAGTGG - Intronic
977150802 4:93508995-93509017 CAAAAGGTTGTTTCTGAGAATGG + Intronic
977417652 4:96754698-96754720 AGCAGGGTAGTTTCTGAGAATGG + Intergenic
977810774 4:101353458-101353480 CACAAGGTATTTACTGAGACTGG + Intergenic
978072417 4:104490625-104490647 CTGAATGAAGCTTCTGAGAAGGG + Intronic
978730597 4:112022068-112022090 AACTACAAAGTTTCTGAGAAGGG - Intergenic
978962164 4:114693382-114693404 CATATGAAAGTTTCTAAGAAAGG + Intergenic
980101167 4:128542899-128542921 CACAAGGAAGATGTTGACAAAGG - Intergenic
980854516 4:138423550-138423572 CAAAGGGAGGTTCCTGAGAAAGG + Intergenic
981021305 4:140031751-140031773 TAGAAGGAAGTTTCTGATGAAGG - Intronic
981369423 4:143941905-143941927 TACAAAGAACTATCTGAGAAGGG - Intergenic
981849931 4:149218412-149218434 CAGAAGGAAGGTGCTGAGAGTGG + Intergenic
982108732 4:152033921-152033943 AACCAGGAAGATTCTGATAAGGG + Intergenic
983246915 4:165298134-165298156 CAAAAGCAAATTTCTAAGAACGG - Intronic
983848723 4:172552680-172552702 CACACGTAAGTTTTTAAGAAGGG - Intronic
984835658 4:184017898-184017920 CCCATGGAAGTGTGTGAGAAGGG + Exonic
986422699 5:7600287-7600309 CCAGAGGAAGTTTCTGGGAAGGG + Intronic
986737433 5:10678544-10678566 CACAATGTATTTACTGAGAATGG + Intergenic
987169157 5:15235461-15235483 CACAAGAAAGTGTCTTTGAAGGG + Intergenic
987262995 5:16222197-16222219 GAAATGGAAGTTTCTGAAAATGG - Intergenic
987991847 5:25222922-25222944 CATAAGGATTTTTCTGAAAAAGG - Intergenic
988034687 5:25811178-25811200 CTTAAGGAAGTTTCTGGGCAAGG - Intergenic
988955468 5:36312124-36312146 GACAAGCAGTTTTCTGAGAATGG + Intergenic
989381780 5:40816426-40816448 CACAAGTAGTTTTATGAGAAAGG + Intergenic
989709970 5:44387191-44387213 CACTTGAAAGTATCTGAGAAAGG + Intronic
989830437 5:45910823-45910845 CACAAAGCAGTTTTTCAGAAAGG + Intergenic
989837982 5:46018875-46018897 CACAAAGCAGTTTCTCAAAATGG - Intergenic
989838152 5:46021963-46021985 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
989841532 5:46079035-46079057 CACAAGGAAGTTTCTCAAAAAGG - Intergenic
989842106 5:46089497-46089519 CAGAAAGAAGTTTCATAGAAAGG - Intergenic
989844675 5:46126769-46126791 CACAAAGCAGTTTCTCAAAAAGG + Intergenic
989845902 5:46140632-46140654 CACAAAGCAGTTTCTCAGAGAGG - Intergenic
989845997 5:46142114-46142136 CACAAAGCAGTTTCTCAGAGAGG - Intergenic
989846041 5:46142800-46142822 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
989846107 5:46144001-46144023 CACAAAGCAGTTTCTCAGAGAGG - Intergenic
989846171 5:46145201-46145223 CACAAAGCAGTCTCTCAGAAGGG - Intergenic
989852538 5:46232617-46232639 CACAAAGCAGTTTCTCAGATAGG - Intergenic
989852676 5:46234683-46234705 CACAAAGCAGTTTCTCAGATAGG - Intergenic
989855735 5:46287482-46287504 CACAAAGTGGTTTCTCAGAAAGG + Intergenic
989857190 5:46312603-46312625 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
989859253 5:46345609-46345631 GACAAAGGAGTTTCTGAGAATGG + Intergenic
989862887 5:46403998-46404020 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
989883467 5:46831936-46831958 CACAAAGCAGTTTCTGAGAATGG - Intergenic
989887396 5:46908982-46909004 CACAAAGCAGTTTCTGAGAATGG - Intergenic
989890758 5:46975460-46975482 CACAAAGCAGTTTCTGAGAATGG - Intergenic
989891414 5:46988412-46988434 CACAAAGGAGTTTCGGAGAACGG - Intergenic
989891629 5:46992503-46992525 CACAAAGCAGTTTCTGAGAATGG - Intergenic
989913404 5:49689173-49689195 CACGTAGCAGTTTCTGAGAATGG - Intergenic
989915081 5:49715074-49715096 CATAAAGAAGTTTCTGAGGATGG - Intergenic
989941370 5:50155167-50155189 CACAAAGAAGTTTCTCAGAATGG + Intergenic
989943368 5:50183224-50183246 CACAAAGAAGTTTCTCAGAATGG + Intergenic
989944579 5:50205336-50205358 CAGAAAGTAGTTTCTCAGAATGG + Intergenic
989946393 5:50236011-50236033 CAAAAAGAAGTTTCTGAGAATGG + Intergenic
989946880 5:50246181-50246203 CACAAAGAAGTTTCTCAGAATGG + Intergenic
990350695 5:54912676-54912698 CAAAAAGAAGTTACTGAGATTGG - Intergenic
990733647 5:58836506-58836528 CACAAGGAAGTATTTGTTAAAGG - Intronic
993566890 5:89487685-89487707 CAGAAGAAAGTTTCAGAGCAAGG + Intergenic
994208578 5:97062618-97062640 CTCAAGGAAATTTCACAGAATGG - Intergenic
994662254 5:102668065-102668087 CACAAGACAGTATCTGATAAAGG - Intergenic
995015557 5:107305140-107305162 CACAAGGAAGTTTCAAGCAAAGG + Intergenic
996411844 5:123167021-123167043 CACAAGAAATTTTCAGAAAAAGG - Intronic
997839022 5:137221307-137221329 CACATGGCAGTTTCTGAAATGGG - Intronic
998252939 5:140564685-140564707 CACGTGGAAGTATCTGAGAGAGG + Intronic
998558200 5:143146676-143146698 CAGAAAGATGTGTCTGAGAAAGG + Intronic
999845849 5:155479376-155479398 CACAAGGCCGTTCCAGAGAAAGG - Intergenic
1001711169 5:173779407-173779429 CACAAGATAATTTCTGAGCATGG - Intergenic
1001955757 5:175847159-175847181 CCGCAGGAAGTTTCTGAGCAGGG + Intronic
1202774288 5_GL000208v1_random:50885-50907 CAGAAAGAAGTTTCTGAGAATGG + Intergenic
1202776541 5_GL000208v1_random:82081-82103 CACGTAGCAGTTTCTGAGAATGG + Intergenic
1003415568 6:5904959-5904981 CACAAGGAAGTAACTGAGGCAGG - Intergenic
1004522816 6:16378249-16378271 CACAAGGCAGTATCTGAGTTAGG - Intronic
1005217728 6:23551346-23551368 CTCAAGCAAGTTCCTGAGAATGG - Intergenic
1006565069 6:34949078-34949100 GACAAGGATGTTTCTGATAAAGG + Intronic
1006951103 6:37821296-37821318 CACAGGGAAATTTTTGAGAAAGG - Intronic
1007632036 6:43277898-43277920 CACGAGGCAGTTTCTGAGAGAGG + Intronic
1008189764 6:48439905-48439927 CATAAGGGATTTTCTGAGACTGG - Intergenic
1008441882 6:51540943-51540965 CTCAAGGAAGTTTCACAAAAAGG - Intergenic
1009061966 6:58407758-58407780 CACAAAGCAGTTTCTCAGATAGG + Intergenic
1009065232 6:58452529-58452551 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065513 6:58556440-58556462 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065727 6:58559497-58559519 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065947 6:58562554-58562576 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009066165 6:58565613-58565635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009066385 6:58568673-58568695 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009066602 6:58571730-58571752 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009066822 6:58574792-58574814 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067041 6:58577846-58577868 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067260 6:58580906-58580928 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067480 6:58583964-58583986 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009067702 6:58587022-58587044 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067922 6:58590081-58590103 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009068144 6:58593137-58593159 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009068370 6:58596195-58596217 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009068589 6:58599252-58599274 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009068806 6:58602290-58602312 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009069027 6:58605347-58605369 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009069245 6:58608404-58608426 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009069462 6:58611461-58611483 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009069683 6:58614519-58614541 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009069902 6:58617576-58617598 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070120 6:58620632-58620654 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070338 6:58623682-58623704 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009070551 6:58626740-58626762 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009070766 6:58629779-58629801 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070985 6:58632836-58632858 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009071207 6:58635893-58635915 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009071423 6:58638951-58638973 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009071643 6:58642008-58642030 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009071862 6:58645065-58645087 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072079 6:58648123-58648145 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072295 6:58651180-58651202 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009072514 6:58654237-58654259 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072732 6:58657294-58657316 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072953 6:58660351-58660373 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009073170 6:58663409-58663431 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009073390 6:58666466-58666488 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009073612 6:58669526-58669548 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009073830 6:58672577-58672599 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074052 6:58675635-58675657 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009074273 6:58678692-58678714 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074494 6:58681749-58681771 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009074714 6:58684806-58684828 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074931 6:58687863-58687885 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075149 6:58690920-58690942 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009075372 6:58693976-58693998 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075586 6:58697033-58697055 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075802 6:58700090-58700112 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009076023 6:58703147-58703169 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076239 6:58706204-58706226 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076455 6:58709262-58709284 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076674 6:58712319-58712341 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009076898 6:58715377-58715399 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009077119 6:58718436-58718458 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009077340 6:58721493-58721515 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009077555 6:58724549-58724571 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009077995 6:58730663-58730685 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009078211 6:58733720-58733742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009078437 6:58736779-58736801 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009078654 6:58739817-58739839 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009078875 6:58742874-58742896 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009079097 6:58745933-58745955 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079317 6:58748990-58749012 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009079539 6:58752048-58752070 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079756 6:58755106-58755128 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079938 6:58757657-58757679 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080154 6:58760714-58760736 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080378 6:58763773-58763795 CACAAAGTCGTTTCTGAGAATGG - Intergenic
1009080599 6:58766830-58766852 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080815 6:58769867-58769889 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009081035 6:58772924-58772946 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081256 6:58775982-58776004 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009081474 6:58779038-58779060 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081692 6:58782095-58782117 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081909 6:58785153-58785175 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009082127 6:58788212-58788234 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082346 6:58791270-58791292 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082567 6:58794327-58794349 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082782 6:58797384-58797406 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009083007 6:58800444-58800466 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083226 6:58803502-58803524 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083438 6:58806539-58806561 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009083661 6:58809596-58809618 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083884 6:58812653-58812675 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084104 6:58815709-58815731 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009084325 6:58818767-58818789 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084544 6:58821825-58821847 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084766 6:58824882-58824904 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084989 6:58827942-58827964 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085210 6:58830998-58831020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085429 6:58834055-58834077 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085643 6:58837093-58837115 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085862 6:58840151-58840173 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086078 6:58843208-58843230 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086301 6:58846265-58846287 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009086520 6:58849323-58849345 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009086738 6:58852381-58852403 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086958 6:58855438-58855460 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087174 6:58858475-58858497 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087397 6:58861534-58861556 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087614 6:58864591-58864613 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087833 6:58867648-58867670 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088052 6:58870706-58870728 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088274 6:58873765-58873787 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009088494 6:58876822-58876844 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009088710 6:58879879-58879901 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088928 6:58882918-58882940 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089146 6:58885955-58885977 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089366 6:58889012-58889034 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089585 6:58892070-58892092 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009089803 6:58895127-58895149 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009090024 6:58898185-58898207 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090246 6:58901244-58901266 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090465 6:58904302-58904324 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090687 6:58907359-58907381 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090906 6:58910417-58910439 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091124 6:58913473-58913495 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091341 6:58916530-58916552 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091558 6:58919587-58919609 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009091777 6:58922643-58922665 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091993 6:58925680-58925702 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092213 6:58928738-58928760 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092433 6:58931795-58931817 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092654 6:58934853-58934875 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092877 6:58937910-58937932 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093097 6:58940968-58940990 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009093314 6:58944025-58944047 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093532 6:58947082-58947104 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009093748 6:58950141-58950163 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093965 6:58953197-58953219 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094184 6:58956254-58956276 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094401 6:58959311-58959333 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094619 6:58962369-58962391 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094840 6:58965426-58965448 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095062 6:58968484-58968506 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009095279 6:58971542-58971564 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009095496 6:58974597-58974619 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095716 6:58977654-58977676 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095935 6:58980713-58980735 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009096153 6:58983771-58983793 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009096373 6:58986829-58986851 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009096593 6:58989886-58989908 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009096817 6:58992943-58992965 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097039 6:58996001-58996023 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097260 6:58999056-58999078 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097480 6:59002111-59002133 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097703 6:59005169-59005191 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097924 6:59008225-59008247 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009098143 6:59011282-59011304 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009098364 6:59014338-59014360 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009098578 6:59017375-59017397 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009098796 6:59020432-59020454 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099018 6:59023486-59023508 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009099239 6:59026543-59026565 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099463 6:59029597-59029619 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009099683 6:59032654-59032676 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099902 6:59035709-59035731 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100121 6:59038766-59038788 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100342 6:59041824-59041846 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009100560 6:59044883-59044905 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100784 6:59047940-59047962 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101005 6:59050998-59051020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101223 6:59054055-59054077 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101442 6:59057112-59057134 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009101661 6:59060170-59060192 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009101882 6:59063229-59063251 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102103 6:59066286-59066308 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009102321 6:59069344-59069366 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102536 6:59072401-59072423 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102759 6:59075458-59075480 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102975 6:59078495-59078517 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009103192 6:59081550-59081572 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009103420 6:59084607-59084629 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009103642 6:59087665-59087687 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009103863 6:59090723-59090745 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104085 6:59093781-59093803 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009104306 6:59096838-59096860 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009104527 6:59099895-59099917 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104750 6:59102952-59102974 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104970 6:59106009-59106031 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105190 6:59109065-59109087 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105367 6:59111613-59111635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009105584 6:59114670-59114692 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105803 6:59117727-59117749 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009106021 6:59120786-59120808 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009106237 6:59123841-59123863 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106457 6:59126900-59126922 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106680 6:59129950-59129972 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106898 6:59133007-59133029 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009107338 6:59139123-59139145 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009107556 6:59142162-59142184 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108004 6:59148276-59148298 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009108222 6:59151335-59151357 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108443 6:59154394-59154416 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108660 6:59157452-59157474 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009108880 6:59160509-59160531 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109099 6:59163566-59163588 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109318 6:59166624-59166646 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009109539 6:59169681-59169703 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109753 6:59172736-59172758 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009109971 6:59175794-59175816 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009110191 6:59178850-59178872 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009110411 6:59181907-59181929 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009110630 6:59184961-59184983 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009110848 6:59187998-59188020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111067 6:59191055-59191077 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009111284 6:59194114-59194136 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111502 6:59197173-59197195 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111722 6:59200230-59200252 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009111939 6:59203287-59203309 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112160 6:59206344-59206366 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112382 6:59209402-59209424 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112597 6:59212439-59212461 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112817 6:59215496-59215518 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113040 6:59218551-59218573 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009113258 6:59221608-59221630 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113477 6:59224667-59224689 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113694 6:59227719-59227741 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113913 6:59230778-59230800 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009114133 6:59233836-59233858 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009114349 6:59236896-59236918 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009114570 6:59239953-59239975 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009114793 6:59243009-59243031 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009115011 6:59246066-59246088 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115227 6:59249125-59249147 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115445 6:59252183-59252205 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115666 6:59255242-59255264 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009115887 6:59258300-59258322 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009116556 6:59267473-59267495 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009116721 6:59269682-59269704 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009116942 6:59272740-59272762 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009117162 6:59275797-59275819 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009117384 6:59278854-59278876 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009117602 6:59281912-59281934 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009117817 6:59284969-59284991 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118037 6:59288027-59288049 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118254 6:59291083-59291105 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118521 6:59294777-59294799 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118613 6:59295963-59295985 CACTAAGCACTTTCTGAGAACGG - Intergenic
1009118742 6:59297828-59297850 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118960 6:59300884-59300906 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009119179 6:59303921-59303943 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009119403 6:59306978-59307000 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009119838 6:59313094-59313116 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120014 6:59315642-59315664 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120235 6:59318697-59318719 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120456 6:59321754-59321776 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009120672 6:59324812-59324834 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120894 6:59327869-59327891 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121111 6:59330928-59330950 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009121316 6:59333814-59333836 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121535 6:59336870-59336892 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009121763 6:59339928-59339950 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121984 6:59342986-59343008 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009122211 6:59346044-59346066 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009122427 6:59349102-59349124 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009122643 6:59352159-59352181 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009122865 6:59355196-59355218 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009123092 6:59358259-59358281 CACAAAGTCGTTTCTGAGAATGG - Intergenic
1009123304 6:59361297-59361319 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009123524 6:59364355-59364377 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009123748 6:59367414-59367436 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009123968 6:59370471-59370493 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009124190 6:59373528-59373550 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009124412 6:59376585-59376607 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009124628 6:59379641-59379663 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009124846 6:59382699-59382721 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125067 6:59385756-59385778 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009125286 6:59388816-59388838 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125502 6:59391873-59391895 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125722 6:59394911-59394933 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009125944 6:59397969-59397991 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009126165 6:59401026-59401048 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009126381 6:59404085-59404107 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009126597 6:59407143-59407165 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009126819 6:59410203-59410225 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127040 6:59413260-59413282 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127260 6:59416317-59416339 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009127482 6:59419376-59419398 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009127708 6:59422435-59422457 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127919 6:59425493-59425515 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128139 6:59428552-59428574 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128361 6:59431611-59431633 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009128581 6:59434663-59434685 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128801 6:59437720-59437742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009129034 6:59440971-59440993 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129253 6:59444028-59444050 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129471 6:59447084-59447106 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129692 6:59450143-59450165 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009129914 6:59453200-59453222 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009130355 6:59459314-59459336 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009130578 6:59462372-59462394 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131016 6:59468489-59468511 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131234 6:59471546-59471568 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131451 6:59474603-59474625 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009131671 6:59477661-59477683 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009131894 6:59480720-59480742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132114 6:59483779-59483801 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132332 6:59486836-59486858 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132548 6:59489893-59489915 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132784 6:59493121-59493143 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009132998 6:59496179-59496201 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009133216 6:59499237-59499259 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133435 6:59502293-59502315 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133655 6:59505350-59505372 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133873 6:59508408-59508430 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134097 6:59511465-59511487 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134320 6:59514524-59514546 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009134540 6:59517582-59517604 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134762 6:59520640-59520662 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135033 6:59524389-59524411 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009135253 6:59527448-59527470 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135471 6:59530508-59530530 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135502 6:59530845-59530867 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135691 6:59533566-59533588 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009135908 6:59536623-59536645 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009136131 6:59539680-59539702 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009136349 6:59542742-59542764 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009136567 6:59545800-59545822 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009136783 6:59548857-59548879 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137003 6:59551912-59551934 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137222 6:59554970-59554992 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137441 6:59558027-59558049 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137657 6:59561084-59561106 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137885 6:59564142-59564164 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138107 6:59567200-59567222 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138328 6:59570241-59570263 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138545 6:59573299-59573321 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009138917 6:59578569-59578591 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009139143 6:59581626-59581648 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009139367 6:59584684-59584706 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009139588 6:59587742-59587764 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009139809 6:59590801-59590823 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009140030 6:59593861-59593883 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140251 6:59596918-59596940 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009140466 6:59599976-59599998 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140689 6:59603035-59603057 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140906 6:59606093-59606115 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009141130 6:59609149-59609171 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009141348 6:59612207-59612229 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009141789 6:59618318-59618340 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142007 6:59621355-59621377 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009142226 6:59624412-59624434 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142442 6:59627450-59627472 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142668 6:59630509-59630531 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009142890 6:59633567-59633589 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009143106 6:59636604-59636626 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009143331 6:59639661-59639683 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009143558 6:59642719-59642741 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009143777 6:59645775-59645797 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144000 6:59648834-59648856 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144219 6:59651891-59651913 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144442 6:59654947-59654969 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009144662 6:59658007-59658029 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009144878 6:59661044-59661066 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145099 6:59664101-59664123 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009145321 6:59667158-59667180 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145538 6:59670215-59670237 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145755 6:59673272-59673294 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009145977 6:59676325-59676347 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146197 6:59679383-59679405 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146421 6:59682442-59682464 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146640 6:59685499-59685521 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146859 6:59688556-59688578 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147075 6:59691613-59691635 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147292 6:59694670-59694692 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147514 6:59697728-59697750 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147738 6:59700785-59700807 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009147959 6:59703842-59703864 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009148181 6:59706898-59706920 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009148400 6:59709954-59709976 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009148621 6:59713011-59713033 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009148840 6:59716069-59716091 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149055 6:59719119-59719141 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149273 6:59722176-59722198 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009149491 6:59725239-59725261 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149707 6:59728296-59728318 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149925 6:59731353-59731375 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009150145 6:59734405-59734427 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009150364 6:59737461-59737483 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009150581 6:59740519-59740541 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009150802 6:59743577-59743599 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151017 6:59746636-59746658 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151240 6:59749695-59749717 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151461 6:59752752-59752774 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151684 6:59755810-59755832 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009151903 6:59758868-59758890 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152123 6:59761925-59761947 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009152341 6:59764981-59765003 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009152561 6:59768037-59768059 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152779 6:59771094-59771116 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152997 6:59774151-59774173 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153219 6:59777208-59777230 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153436 6:59780266-59780288 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153663 6:59783324-59783346 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009153883 6:59786382-59786404 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154111 6:59789440-59789462 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154337 6:59792499-59792521 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009154560 6:59795556-59795578 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154779 6:59798613-59798635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154996 6:59801653-59801675 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155217 6:59804712-59804734 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155436 6:59807770-59807792 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009155465 6:59808107-59808129 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155654 6:59810827-59810849 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009155873 6:59813884-59813906 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156091 6:59816941-59816963 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156325 6:59820259-59820281 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009156541 6:59823316-59823338 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009156755 6:59826372-59826394 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156980 6:59829430-59829452 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009254447 6:61365575-61365597 CACAAAGAAGTCTCTGAGAATGG - Intergenic
1009255814 6:61395885-61395907 CAAAAAGTAGTTTCTGAGAATGG - Intergenic
1009255873 6:61397246-61397268 CACAAAATAGTTTCTGAGAATGG - Intergenic
1009256524 6:61411169-61411191 CACATAGTAGTTTCTGAGAAAGG - Intergenic
1009259179 6:61462025-61462047 CACAAAGCACTTTCTCAGAAAGG - Intergenic
1009260236 6:61476993-61477015 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1009261270 6:61492239-61492261 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1009261350 6:61493606-61493628 CACAAAGTAGTTTCTCAGATAGG + Intergenic
1009261859 6:61501058-61501080 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1009262956 6:61519077-61519099 CACAAAGCAGTTTCTGAGAGAGG - Intergenic
1009874841 6:69493112-69493134 AACAAAGAAGTATCTGAGACAGG - Intergenic
1012079571 6:94737991-94738013 CTCAAGGAAATATCAGAGAAAGG + Intergenic
1012384893 6:98668935-98668957 TGCCAGAAAGTTTCTGAGAAGGG + Intergenic
1012513090 6:100026889-100026911 AACCAGGAAACTTCTGAGAAAGG + Intergenic
1013859933 6:114623704-114623726 CACAAGGAAGTATGTGTAAAGGG + Intergenic
1013981160 6:116131274-116131296 AACAAGGAATATTCAGAGAAGGG + Intronic
1014177223 6:118343813-118343835 CACATGTAAGTATATGAGAATGG + Intergenic
1016622675 6:146130683-146130705 CACCAAGAAGAGTCTGAGAAAGG + Intronic
1020226682 7:6285742-6285764 CACAAGGAAGTGTGTGACAATGG + Intergenic
1020364966 7:7371446-7371468 AGCAAAAAAGTTTCTGAGAATGG + Intronic
1021101602 7:16590872-16590894 TAGAAGGAATTTTATGAGAAGGG - Intergenic
1021350509 7:19587976-19587998 CAAAAGTACGCTTCTGAGAAAGG + Intergenic
1022317671 7:29260620-29260642 CATAAGGAAGCTTCTTATAAGGG - Intronic
1022491714 7:30825531-30825553 GCCATGGAAGTTTCTGAGCAGGG + Intronic
1022708294 7:32827250-32827272 CCCATGGAAGTTCCTGCGAAGGG - Intergenic
1023333618 7:39145719-39145741 TACAAAGCAGCTTCTGAGAAAGG - Intronic
1024646653 7:51376672-51376694 CAGAAGGAAGGTTATGAGCAGGG + Intergenic
1025296922 7:57782740-57782762 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1025309098 7:57904858-57904880 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1025314804 7:58007584-58007606 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025315774 7:58025978-58026000 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025323352 7:58174250-58174272 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025331936 7:58326590-58326612 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025336719 7:58410978-58411000 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342532 7:58514200-58514222 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342591 7:58515222-58515244 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025343226 7:58526467-58526489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025348194 7:58614353-58614375 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025349131 7:58631044-58631066 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025351003 7:58664431-58664453 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025360520 7:58832834-58832856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025363103 7:58878492-58878514 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025380951 7:59194981-59195003 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384302 7:59254592-59254614 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384361 7:59255614-59255636 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384805 7:59263446-59263468 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025387967 7:59319649-59319671 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025388370 7:59326803-59326825 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025395628 7:59455906-59455928 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025403121 7:59588274-59588296 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025403793 7:59600198-59600220 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025411029 7:59728289-59728311 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025413274 7:59768156-59768178 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025418980 7:59869680-59869702 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025425523 7:59985858-59985880 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025427337 7:60018234-60018256 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025428938 7:60046834-60046856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025429905 7:60063868-60063890 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025433593 7:60129615-60129637 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025434227 7:60140863-60140885 CACAAAGTACTTTCTGAGAATGG - Intergenic
1025436351 7:60178671-60178693 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025436625 7:60183442-60183464 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025443920 7:60312917-60312939 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025444904 7:60330292-60330314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025468864 7:60757202-60757224 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025472074 7:60814440-60814462 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025473046 7:60882172-60882194 CACAATGAAGTTTCTGAGAATGG + Intergenic
1025473108 7:60883546-60883568 CACAAAGAACTTTCTGAGAATGG + Intergenic
1025473267 7:60886590-60886612 CTCAAAGAAGTTTCTGAGAATGG + Intergenic
1025473290 7:60886932-60886954 CACAAAGAAGTTTCTGAGACTGG + Intergenic
1025490367 7:61111434-61111456 CACAAAGAAATTTCTGAGAATGG - Intergenic
1025490913 7:61121176-61121198 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491074 7:61123910-61123932 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491236 7:61126644-61126666 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491397 7:61129378-61129400 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491552 7:61132112-61132134 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491712 7:61134846-61134868 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025491849 7:61137238-61137260 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492021 7:61140142-61140164 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492181 7:61142876-61142898 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492339 7:61145610-61145632 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492503 7:61148344-61148366 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492665 7:61151078-61151100 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492824 7:61153811-61153833 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025492982 7:61156545-61156567 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025493142 7:61159279-61159301 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025493305 7:61162013-61162035 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025493628 7:61167481-61167503 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025493786 7:61170215-61170237 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025493992 7:61173805-61173827 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494151 7:61176539-61176561 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494308 7:61179273-61179295 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494468 7:61182007-61182029 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494610 7:61184400-61184422 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494770 7:61187134-61187156 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025494929 7:61189867-61189889 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495087 7:61192600-61192622 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495260 7:61195506-61195528 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495419 7:61198240-61198262 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495581 7:61200974-61200996 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495744 7:61203708-61203730 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025495903 7:61206441-61206463 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496061 7:61209175-61209197 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496224 7:61211909-61211931 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496387 7:61214643-61214665 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496551 7:61217377-61217399 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496711 7:61220111-61220133 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025496869 7:61222844-61222866 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497032 7:61225578-61225600 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497189 7:61228312-61228334 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497364 7:61231387-61231409 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497527 7:61234121-61234143 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497688 7:61236855-61236877 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497848 7:61239589-61239611 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025497998 7:61242323-61242345 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025498160 7:61245057-61245079 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025498321 7:61247791-61247813 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025498479 7:61250524-61250546 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025498634 7:61253258-61253280 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025498794 7:61255992-61256014 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025498967 7:61259068-61259090 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025499305 7:61265462-61265484 CACAAATAATTTTCTGAGAATGG - Intergenic
1025501064 7:61298481-61298503 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025501302 7:61302935-61302957 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1025501314 7:61303114-61303136 CACAAAGAAGCTCCTCAGAATGG + Intergenic
1025502748 7:61325610-61325632 CACAAAGAAGTTTCCCAGAAAGG + Intergenic
1025503140 7:61382575-61382597 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025503302 7:61385310-61385332 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025503461 7:61388045-61388067 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025503620 7:61390779-61390801 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025503778 7:61393513-61393535 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025504098 7:61398981-61399003 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025504259 7:61401715-61401737 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025504583 7:61407183-61407205 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025504907 7:61412651-61412673 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505067 7:61415384-61415406 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505230 7:61418119-61418141 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505393 7:61420853-61420875 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505557 7:61423584-61423606 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505722 7:61426318-61426340 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025505903 7:61429222-61429244 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025506061 7:61431957-61431979 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025506220 7:61434691-61434713 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025506384 7:61437425-61437447 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025506537 7:61440159-61440181 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025506702 7:61442892-61442914 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025506863 7:61445626-61445648 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025507018 7:61448355-61448377 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025507185 7:61451109-61451131 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025507345 7:61453843-61453865 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025507842 7:61462052-61462074 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025508005 7:61464787-61464809 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025508165 7:61467520-61467542 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025508324 7:61470254-61470276 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025508485 7:61472988-61473010 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025508644 7:61475722-61475744 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025508803 7:61478456-61478478 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025508963 7:61481189-61481211 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025509128 7:61483931-61483953 CACAAAGGAGTTTCTGAGAATGG - Intergenic
1025509447 7:61489399-61489421 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025509605 7:61492134-61492156 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025509930 7:61497601-61497623 CTCAAAGGGGTTTCTGAGAATGG - Intergenic
1025510092 7:61500336-61500358 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025510253 7:61503070-61503092 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025510360 7:61504779-61504801 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025510416 7:61505805-61505827 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025510578 7:61508539-61508561 CTCAAAGGAGTTTCTGAGAATGG - Intergenic
1025510749 7:61511271-61511293 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025510902 7:61514007-61514029 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025511060 7:61516741-61516763 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025511225 7:61519476-61519498 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025511559 7:61524945-61524967 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025511718 7:61527681-61527703 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025513715 7:61602934-61602956 CACAAAGAAGTTTCTGAGACTGG - Intergenic
1025513738 7:61603276-61603298 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025513897 7:61606320-61606342 CACAAAGAACTTTCTGAGAATGG - Intergenic
1025513959 7:61607694-61607716 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025514156 7:61611694-61611716 CACAAATAATTTTCTGAGAATGG - Intergenic
1025515924 7:61644704-61644726 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025516162 7:61649158-61649180 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1025516174 7:61649337-61649359 CACAAAGAAGCTCCTCAGAATGG + Intergenic
1025517616 7:61671831-61671853 CACAAAGAAGTTTCCCAGAAAGG + Intergenic
1025518421 7:61685884-61685906 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025519928 7:61713500-61713522 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
1025520230 7:61719482-61719504 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025523117 7:61766508-61766530 CACAACGCAGTTTCTCATAAAGG + Intergenic
1025523681 7:61776145-61776167 CACAAAGAGGTTTCTCAGAAAGG + Intergenic
1025523977 7:61781350-61781372 CACAAAGCAGTGTCTCAGAATGG + Intergenic
1025524796 7:61791622-61791644 CACAAAGCAATTTCTCAGAAAGG + Intergenic
1025526611 7:61821051-61821073 CACAAAGTAGTTTCTCAGAAAGG - Intergenic
1025527403 7:61832863-61832885 CACAAAGCTGTTTCTCAGAAAGG + Intergenic
1025530089 7:61868872-61868894 CACAAAGAAGTTTCTTAGATAGG + Intergenic
1025533203 7:61916090-61916112 CACAAAGCAGTTTCTGAGATAGG - Intergenic
1025537110 7:61962708-61962730 CACAGAGTAGTTCCTGAGAATGG - Intergenic
1025538061 7:62031773-62031795 CACAAAGAAGTTTCTGAGACTGG - Intergenic
1025538084 7:62032115-62032137 CTCAAAGAAGTTTCTGAGAATGG - Intergenic
1025538241 7:62035160-62035182 CACAAAGAACTTTCTGAGAATGG - Intergenic
1025538303 7:62036534-62036556 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025538500 7:62040534-62040556 CACAAATAATTTTCTGAGAATGG - Intergenic
1025540262 7:62073530-62073552 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025540499 7:62077984-62078006 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1025540511 7:62078163-62078185 CACAAAGAAGCTCCTCAGAATGG + Intergenic
1025541941 7:62100479-62100501 CACAAAGAAGTTTCCCAGAAAGG + Intergenic
1025542746 7:62114531-62114553 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025544252 7:62142152-62142174 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
1025544552 7:62148137-62148159 CACAAAGAAGTTTCTCAGAAAGG + Intergenic
1025545104 7:62155632-62155654 CAGAGAGAAGTTTCTTAGAAAGG + Intergenic
1025546013 7:62170228-62170250 CACAAAGAAGTTTCTCAGTAAGG + Intergenic
1025547337 7:62193553-62193575 CACAAAGCAGTGTCTCAGAATGG + Intergenic
1025548177 7:62204184-62204206 CACAAAGCAATTTCTCAGAAAGG + Intergenic
1025549981 7:62233607-62233629 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1025550116 7:62235628-62235650 CACAAAGTGGTTTCTCAGAAAGG - Intergenic
1025568231 7:62517479-62517501 CACAAAGTAGTGTCTGATAATGG - Intergenic
1025568328 7:62519175-62519197 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025568789 7:62528363-62528385 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025569077 7:62533650-62533672 CACTATGTAGTTTCTGAGAATGG - Intergenic
1025569599 7:62543556-62543578 TGCAAAGAAGTTCCTGAGAATGG - Intergenic
1025570341 7:62554250-62554272 CACAAAGCAGTTTCAGAGAATGG + Intergenic
1025571366 7:62574783-62574805 CACAAAGAAGTTTCTCATAATGG + Intergenic
1025574023 7:62612124-62612146 CAGAAAGCAGTTTCTAAGAAAGG + Intergenic
1025574887 7:62624113-62624135 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1025575055 7:62627195-62627217 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1025575089 7:62627880-62627902 CACAAAGCAGTTTCTCACAAAGG + Intergenic
1025575100 7:62628049-62628071 CACAAAGCAGTTTCTCAGACAGG + Intergenic
1025575210 7:62629941-62629963 CACAAAGCTGTTTCTCAGAAAGG + Intergenic
1025575219 7:62630113-62630135 CACAAAGCAGTCTCTCAGAAAGG + Intergenic
1025575331 7:62632173-62632195 CAGAAAGCAGTTTCTCAGAAAGG + Intergenic
1025575341 7:62632345-62632367 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1025575426 7:62633887-62633909 CAGAAAGCAGTTTCTCAGAAAGG + Intergenic
1025575455 7:62634399-62634421 CACAAATCAGTTTCTCAGAAAGG + Intergenic
1025575499 7:62635177-62635199 CAGAAAGCAGTTTCTCAGAAAGG + Intergenic
1025576206 7:62645080-62645102 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1025576228 7:62645423-62645445 CACAAAGCAGTTTCTGTGAAAGG + Intergenic
1025588950 7:62830714-62830736 CAAAAAGAAGTTTCTCAGAATGG - Intergenic
1025589126 7:62833275-62833297 CACAAAGCAGTTTCTCAGAATGG - Intergenic
1025589721 7:62842116-62842138 CACAAGGCAGTCTTTCAGAATGG - Intergenic
1025590430 7:62852820-62852842 CACAAAGCAGTTTCTCAGATAGG - Intergenic
1025592889 7:62885342-62885364 CACAAAATAGTTTCTCAGAAAGG - Intergenic
1025593030 7:62887403-62887425 CACAAAGCAGTTTCTCATAAAGG - Intergenic
1025594399 7:62905923-62905945 TACAAAGCAGTTTCTCAGAAAGG - Intergenic
1025596377 7:62932257-62932279 CACAAAGCAGTTTCTGAGAAAGG + Intergenic
1025598309 7:62960615-62960637 CACAAAGCAGTTTCTCAGATAGG - Intergenic
1026180113 7:68031796-68031818 GCCAAGAAAGTTTCTGAAAATGG - Intergenic
1026381594 7:69805308-69805330 CACAAGGAAATTTCTGGGCAGGG - Intronic
1029501306 7:100932305-100932327 CACCAGGATGTTTCTGGGCATGG - Intergenic
1030785379 7:113653880-113653902 TATAAGGAAATTTCTGAGACTGG - Intergenic
1031142063 7:117953637-117953659 CATAAGGAAGGTTGTAAGAAAGG - Intergenic
1031459904 7:122036084-122036106 CCCTAGGAAGTTTCTGTGAATGG - Intronic
1031610820 7:123824980-123825002 CAGAAGGAATGTTCTGTGAAAGG - Intergenic
1032999851 7:137492378-137492400 CAGAAGGAAGGTATTGAGAATGG + Intronic
1033392025 7:140937599-140937621 CACAAGTAAGCTTCAGGGAAAGG + Intergenic
1036726449 8:11224978-11225000 CCCATGTAGGTTTCTGAGAAAGG - Intergenic
1037139464 8:15503012-15503034 CACAAGGATGGGTCTCAGAATGG - Intronic
1037745749 8:21642827-21642849 CCCAAGAAAGTTTCTCAAAAGGG - Intergenic
1037869119 8:22474986-22475008 TTCAAGGAAGTATTTGAGAATGG + Exonic
1038073424 8:24044313-24044335 CAGAAGGAATTTTCTAGGAATGG - Intergenic
1038406165 8:27324607-27324629 CACAATGTACTTTCTGAGAATGG - Intronic
1038730210 8:30120192-30120214 CCCAAGCAAGTTTCTGAAAAGGG + Intronic
1039681318 8:39740009-39740031 GACACAAAAGTTTCTGAGAAAGG + Intergenic
1040113186 8:43583196-43583218 CACAAGGCGGTTTCTCAGATAGG - Intergenic
1040120357 8:43677697-43677719 CACAAAGCAGTTTCAGAGACAGG - Intergenic
1040129927 8:43783532-43783554 CACAAAGGAGTTTCTCAGATAGG - Intergenic
1040141429 8:43921102-43921124 CACAACGTAGTTTTTGAGAATGG - Intergenic
1040142679 8:43943034-43943056 CACAAACTAGTTTCTGAGAAAGG - Intergenic
1040143069 8:43949478-43949500 CACAAAGTAGTTTCTGAATATGG - Intergenic
1040143141 8:43951014-43951036 CACAATGTAGTTTCTGACAATGG - Intergenic
1040143286 8:43954235-43954257 CACAAAGTTGTTTCTGAGAATGG - Intergenic
1040163951 8:44310844-44310866 CACAATCAAGGTTCTGAGAATGG - Intergenic
1040173803 8:44456710-44456732 CACAATCAAGGTTCTGAGAATGG - Intergenic
1040271343 8:45949234-45949256 CACAAACTAGTTTCTGAGAAAGG - Intergenic
1040271728 8:45955681-45955703 CACAAAGTAGTTTCTGAATATGG - Intergenic
1040271844 8:45958239-45958261 CACAATGTAGTTTCTGACAATGG - Intergenic
1040271991 8:45961463-45961485 CACAAAGTTGTTTCTGAGAATGG - Intergenic
1040272712 8:45973039-45973061 CACAAAGAATTTTCTGAGAATGG - Intergenic
1040469960 8:47728790-47728812 CAGAATCAAGTTTCTGAGAGAGG - Intronic
1041192683 8:55369328-55369350 CACAAGCATGATGCTGAGAAAGG + Intronic
1042099208 8:65255977-65255999 CACAGGGTAGGTGCTGAGAAAGG - Intergenic
1044014904 8:87039502-87039524 CAAAAAGCAGTTTCTTAGAAAGG - Intronic
1044115582 8:88329103-88329125 CAGATGGAAAATTCTGAGAATGG + Intergenic
1044277160 8:90315071-90315093 GACAAAGAAGATCCTGAGAAAGG + Intergenic
1044770886 8:95632658-95632680 CATAAAGAAGTATCTGAGAGTGG + Intergenic
1045740692 8:105356068-105356090 TACATGGAAGTTTTTGTGAAAGG + Intronic
1046050341 8:109014418-109014440 CATGAGGAAGTTACTGAGACTGG - Intergenic
1046182394 8:110668347-110668369 GACATGAAAATTTCTGAGAATGG + Intergenic
1046363352 8:113191133-113191155 CACCAGGAACTTCCAGAGAATGG + Intronic
1047476197 8:125233657-125233679 TACAAGGAAGTTTATGAGTTGGG + Intronic
1048153731 8:131920699-131920721 CAAAAAGAACTTTCTCAGAAAGG + Intronic
1049716897 8:144097204-144097226 GACAAGGAAGGCTCAGAGAAGGG - Intronic
1050166726 9:2772190-2772212 CACTAGGAATTCACTGAGAATGG + Intronic
1050396534 9:5203985-5204007 TATAAGGAAGTATCTGAGACTGG + Intergenic
1050594289 9:7190468-7190490 CACTGGTAACTTTCTGAGAAAGG - Intergenic
1050727356 9:8666555-8666577 AAAAAGGTAGTTTCTGTGAAAGG - Intronic
1050729731 9:8695237-8695259 CACTGGGGAGTTTTTGAGAAGGG - Intronic
1051532528 9:18120485-18120507 CACATGGAACTTTCTAAGCAGGG + Intergenic
1052501075 9:29291043-29291065 CAGAAAGAAATTTTTGAGAAAGG - Intergenic
1053316695 9:37058212-37058234 CACCTGGAAGCTTCTTAGAATGG + Intergenic
1053687608 9:40553185-40553207 CAAAAAGAAGTATCTCAGAATGG - Intergenic
1053687643 9:40553721-40553743 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1053687797 9:40556664-40556686 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1053711744 9:40818652-40818674 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1053714266 9:40868789-40868811 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1053937214 9:43172671-43172693 CACAAAGTAGTTTCTCAGACTGG - Intergenic
1053939505 9:43218166-43218188 CAGAAAGAAGTTTCTCTGAATGG - Intergenic
1053949999 9:43362402-43362424 CACAAACAAGTTTATGAGAATGG - Intergenic
1053951329 9:43390489-43390511 CAGAAACAAGTTTCTGAGAATGG - Intergenic
1053964536 9:43619889-43619911 CGCAAATAAGTTTCTGAGAATGG - Intergenic
1053967385 9:43669413-43669435 CGCAAATAAGTTTCTGAGAATGG - Intergenic
1053991303 9:44082941-44082963 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054020486 9:44590188-44590210 CACAAAGCAGTTTCTGAGAATGG - Intergenic
1054032058 9:44788341-44788363 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054056530 9:45204624-45204646 CACAAACAAGTTTCTGAGAATGG - Intergenic
1054069554 9:45428076-45428098 CTCAAATAAGTTTCTGAGAATGG - Intergenic
1054072090 9:45472135-45472157 CACAAAGCAGTTTCTGAGAATGG - Intergenic
1054275962 9:63069960-63069982 CACAAAGAAGTTTCTCTGAATGG + Intergenic
1054276059 9:63071838-63071860 CAGAAAGAAGTTTCTCTGAATGG + Intergenic
1054276674 9:63083940-63083962 CACAAAGTAGTTTCTCAGATTGG + Intergenic
1054299311 9:63362009-63362031 CACAAAGAAGTTTGTCTGAATGG - Intergenic
1054362588 9:64190917-64190939 CACAAAGCACTTTCTCAGAAAGG - Intergenic
1054364121 9:64214296-64214318 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1054398161 9:64680991-64681013 CACAAAGTAGTTTCTCAGATTGG - Intergenic
1054398774 9:64693091-64693113 CAGAAAGAAGTTTCTCTGAATGG - Intergenic
1054398871 9:64694969-64694991 CACAAAGAAGTTTCTCTGAATGG - Intergenic
1054422209 9:64950530-64950552 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1054426124 9:65070074-65070096 CACAAAGAAGTTTCTTAGAATGG - Intergenic
1058448839 9:105077628-105077650 CACAAGGAAATTTCTTGTAAGGG + Intergenic
1058700196 9:107593839-107593861 CAGGAGAAAGTCTCTGAGAATGG + Intergenic
1060035043 9:120247997-120248019 GACAAGGAGCTTTCTGAGCATGG + Intergenic
1060094432 9:120775021-120775043 CAGAAAAAAGTTTTTGAGAAGGG - Intronic
1060115692 9:120938386-120938408 CACAAGGAAGCTGATGTGAAAGG + Intergenic
1061314911 9:129789049-129789071 CACAAGGAATCTTCTGGGCATGG + Intergenic
1062111165 9:134782803-134782825 CACAGGGCAGCTTCTCAGAATGG + Intronic
1203339892 Un_KI270320v1:1172-1194 CAAAATGTAGTTTCGGAGAATGG - Intergenic
1203417730 Un_KI270364v1:1910-1932 GGCAAAGAAGTTTCTCAGAATGG + Intergenic
1203418052 Un_KI270366v1:1647-1669 CAGAAAGAAGTTTCTGAGAATGG + Intergenic
1203420390 Un_KI270373v1:698-720 CACAAATAATTTTCTGAGAATGG - Intergenic
1203420028 Un_KI270382v1:3481-3503 CAGAAACAAGTTTCTGAGAATGG - Intergenic
1203419397 Un_KI270383v1:1281-1303 CGCAAATAAGTTTCTGAGAATGG + Intergenic
1203382220 Un_KI270435v1:64668-64690 CACAAAGAACTTTCTCAGAATGG - Intergenic
1203383238 Un_KI270435v1:83362-83384 CTCAAAGAAGTTTCTCAGAATGG + Intergenic
1203383982 Un_KI270438v1:771-793 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1203353027 Un_KI270442v1:97046-97068 CACAAAGAAGTTTGTGAGAATGG - Intergenic
1203356918 Un_KI270442v1:160749-160771 CACAAAGAAGTTTGTAAGACTGG + Intergenic
1203358523 Un_KI270442v1:189135-189157 CACAAAGAAGTTTCTCAGAAGGG + Intergenic
1203374502 Un_KI270442v1:354041-354063 CACAAAGAAGTTTATCAGATTGG - Intergenic
1203375088 Un_KI270442v1:364962-364984 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1203394013 Un_KI270512v1:5803-5825 CATAAAGAAGTTTCTCAGAATGG + Intergenic
1203396405 Un_KI270519v1:17853-17875 CATAAAGAAGTTTCTCAGAATGG - Intergenic
1203396446 Un_KI270519v1:18709-18731 CACAAAGAAGTTTCTCTGAACGG - Intergenic
1203399258 Un_KI270519v1:68485-68507 CACAAAAAAGTTTCTCAGAATGG - Intergenic
1203400171 Un_KI270519v1:81456-81478 CACAAATAAGTTTCTCAGAATGG - Intergenic
1203400234 Un_KI270519v1:82823-82845 CACCATGAAGTTTCTCAGAATGG - Intergenic
1203400548 Un_KI270519v1:88954-88976 CACAAAGAAGTTTTTCAGAATGG - Intergenic
1203401969 Un_KI270519v1:114836-114858 CACAAAGAAGTTTCTCCGAATGG - Intergenic
1203402861 Un_KI270519v1:131014-131036 CTCAAAGAAGTTTCTCACAATGG + Intergenic
1203406008 Un_KI270538v1:3183-3205 CACAAAGCATTTTCTGAGAATGG - Intergenic
1203406510 Un_KI270538v1:22949-22971 CACAAATCAGTTTATGAGAATGG - Intergenic
1203411602 Un_KI270579v1:14291-14313 CACAAGGAAGTTTCTCAGAATGG + Intergenic
1203415104 Un_KI270584v1:2531-2553 CACAAAGAAGTTTTTCAGAATGG + Intergenic
1203413874 Un_KI270589v1:29491-29513 CACAAAGAAGTTTTTCAGATAGG + Intergenic
1203593178 Un_KI270747v1:90603-90625 CACAAACAAGTTTATGAGAATGG - Intergenic
1203597666 Un_KI270747v1:166224-166246 CGCAAATAAGTTTCTGAGAATGG - Intergenic
1203598900 Un_KI270747v1:186963-186985 CGCAAATAAGTTTCTGAGAATGG - Intergenic
1203683049 Un_KI270757v1:3650-3672 CTCAAAGAAGTTTCTCACAATGG + Intergenic
1203684405 Un_KI270757v1:30387-30409 CACAAAGAAGTTTTTCAGATAGG - Intergenic
1188533445 X:31167945-31167967 GTCAAGGAATTTTCTGAGAAAGG + Intronic
1188688430 X:33098934-33098956 CACAAGTTACTTGCTGAGAAAGG + Intronic
1189287823 X:39864711-39864733 CACAAGGGAGCTTCTGGGACAGG + Intergenic
1189327632 X:40122513-40122535 CTCAAGGAATAATCTGAGAAGGG - Intronic
1190752060 X:53370994-53371016 ATCAAGTAAGTTTCTCAGAAAGG - Intergenic
1191262043 X:58334169-58334191 CAAAAAGCAGTTTCTCAGAAAGG + Intergenic
1191262344 X:58338942-58338964 CACAAAGAAGTCTCTTAGAATGG + Intergenic
1191262720 X:58344404-58344426 CACAAAGCAGTTTATCAGAAAGG - Intergenic
1191262743 X:58344745-58344767 CACAAAGCAGTTTCTCAGAAAGG - Intergenic
1191262929 X:58347589-58347611 CTCAAAGCAGTTTCTCAGAAAGG - Intergenic
1191267038 X:58407303-58407325 CACAAAAGAGTTTCTCAGAAAGG - Intergenic
1191267234 X:58410215-58410237 CACAAAGCAGTTTCTCAGATAGG + Intergenic
1191268013 X:58422549-58422571 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1191268542 X:58430698-58430720 CACAAAGCAGTTTCTCAGAAAGG + Intergenic
1191271672 X:58479766-58479788 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
1191273192 X:58506283-58506305 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1191274889 X:58532376-58532398 CAGAAAGAAGCTTCTGAGAATGG + Intergenic
1191275103 X:58535942-58535964 CACAAAGTAGTTTCTGACAATGG + Intergenic
1191566792 X:62547608-62547630 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1191572365 X:62644501-62644523 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1191573503 X:62664234-62664256 CACAAATATGTTTCTCAGAATGG - Intergenic
1191573615 X:62666445-62666467 CACAAAGAAGTTTCTCAGAATGG - Intergenic
1191574069 X:62675330-62675352 CACAAAGAAGTTTCTCAGAAAGG - Intergenic
1191575056 X:62693395-62693417 CAAAAAGAAGTTTCTCAGAAAGG + Intergenic
1193185660 X:78508716-78508738 CTCAAGGAGGTATCAGAGAAAGG + Intergenic
1194526095 X:94978702-94978724 CAGAGGGAAGGTCCTGAGAATGG - Intergenic
1194841242 X:98745469-98745491 TATAAGGAAGTATCTGAGACTGG - Intergenic
1195283318 X:103357806-103357828 CAAAAGGAACTTTTAGAGAAAGG + Exonic
1195675767 X:107506383-107506405 CACAAGGTAGCTTTTGAGACAGG + Intergenic
1195761407 X:108250279-108250301 CCCCAACAAGTTTCTGAGAAGGG + Intronic
1197829791 X:130629477-130629499 TACAAGGAAGCCTCTGTGAATGG - Intronic
1197830244 X:130634233-130634255 AACAAGGAAGTTTTGGTGAATGG + Intronic
1198184468 X:134239931-134239953 GAAAAGGAAGTTCCTGAGAAAGG - Intronic
1198561803 X:137858336-137858358 GACAAGGAAACTGCTGAGAATGG + Intergenic
1200892310 Y:8337052-8337074 CACAATGATGTTTCTGGGTATGG - Intergenic
1201064725 Y:10086260-10086282 CACAGAGAAGTTTCTCAGAATGG + Intergenic
1201064761 Y:10086943-10086965 CACAGAGAAGTTTCTCAGAATGG + Intergenic
1201079454 Y:10222670-10222692 CACCAAGAAGTTTCTCAGTAGGG + Intergenic
1201079560 Y:10224709-10224731 CACAAATAATTTTCTCAGAATGG + Intergenic
1201096596 Y:10625817-10625839 CACAAAGAAGTTTCTCAGAATGG + Intergenic
1201396688 Y:13555932-13555954 CAAAAGGAAGTTGCTGAAACAGG + Intergenic
1201770911 Y:17615826-17615848 CACACGGACCTGTCTGAGAATGG - Intergenic
1201830644 Y:18290160-18290182 CACACGGACCTGTCTGAGAATGG + Intergenic