ID: 1105164003

View in Genome Browser
Species Human (GRCh38)
Location 13:17480363-17480385
Sequence AAACTGCTGCTTCAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33333
Summary {0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105164003_1105164005 9 Left 1105164003 13:17480363-17480385 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105164005 13:17480395-17480417 CGTTTTGTAGAAACTGTAAGTGG 0: 1
1: 400
2: 6473
3: 22420
4: 69552
1105164003_1105164006 17 Left 1105164003 13:17480363-17480385 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105164006 13:17480403-17480425 AGAAACTGTAAGTGGATATTTGG 0: 430
1: 2152
2: 23914
3: 56259
4: 55859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105164003 Original CRISPR AAACTGCTGCTTCAAAAGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr