ID: 1105167496

View in Genome Browser
Species Human (GRCh38)
Location 13:17535452-17535474
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33333
Summary {0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105167496_1105167498 9 Left 1105167496 13:17535452-17535474 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105167498 13:17535484-17535506 CTTTTTGTAGAAACTGTAAGTGG 0: 396
1: 5054
2: 20936
3: 64029
4: 78433
1105167496_1105167499 17 Left 1105167496 13:17535452-17535474 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105167499 13:17535492-17535514 AGAAACTGTAAGTGGATATTTGG 0: 430
1: 2152
2: 23914
3: 56259
4: 55859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105167496 Original CRISPR AAACTGCTGCTTCAAAAGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr