ID: 1105188652

View in Genome Browser
Species Human (GRCh38)
Location 13:17865178-17865200
Sequence AAACTGCTGCTTCAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33333
Summary {0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105188652_1105188654 -4 Left 1105188652 13:17865178-17865200 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105188654 13:17865197-17865219 GTTTGGAAACACTCTTTTTGTGG 0: 852
1: 15428
2: 21522
3: 15418
4: 20342
1105188652_1105188656 17 Left 1105188652 13:17865178-17865200 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105188656 13:17865218-17865240 GGAAACTGTAAGTGGATATTTGG 0: 4
1: 486
2: 18725
3: 32108
4: 50803
1105188652_1105188655 9 Left 1105188652 13:17865178-17865200 CCTCTCTTTTGAAGCAGCAGTTT 0: 4
1: 248
2: 360
3: 10349
4: 22372
Right 1105188655 13:17865210-17865232 CTTTTTGTGGAAACTGTAAGTGG 0: 4
1: 530
2: 20300
3: 45426
4: 67266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105188652 Original CRISPR AAACTGCTGCTTCAAAAGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr