ID: 1105201000

View in Genome Browser
Species Human (GRCh38)
Location 13:18177613-18177635
Sequence GACAGTAAAAGGATGGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105201000_1105201004 20 Left 1105201000 13:18177613-18177635 CCATTGACCATCCTTTTACTGTC 0: 1
1: 0
2: 4
3: 36
4: 287
Right 1105201004 13:18177656-18177678 GCTTTCTGCACTCAGCTTGAAGG 0: 7
1: 0
2: 4
3: 16
4: 157
1105201000_1105201003 -4 Left 1105201000 13:18177613-18177635 CCATTGACCATCCTTTTACTGTC 0: 1
1: 0
2: 4
3: 36
4: 287
Right 1105201003 13:18177632-18177654 TGTCTTCTTCTAGTAAAAGACGG 0: 3
1: 2
2: 1
3: 27
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105201000 Original CRISPR GACAGTAAAAGGATGGTCAA TGG (reversed) Intergenic
901117718 1:6861882-6861904 GACAGTAAAAGGGTGGTTGCCGG - Intronic
904441024 1:30530879-30530901 AACAGGAAAAGGATGGGCAAGGG - Intergenic
908418584 1:63937266-63937288 GGCAGTAAAAGGACGGCCCAGGG - Intronic
909071728 1:71002343-71002365 GACATTTAATGGATTGTCAAGGG + Intronic
909266531 1:73565924-73565946 GACAGTGAAAGTATAGTGAAAGG + Intergenic
909938594 1:81584182-81584204 GACAGCAAAAGGGAGGTCTAGGG - Intronic
910332509 1:86090508-86090530 AACAATAAATGTATGGTCAATGG - Intronic
910484080 1:87691970-87691992 GACAGTAAAAGGATGGACACAGG + Intergenic
911493203 1:98595075-98595097 TACAGTAGAAGGATGGTTATCGG - Intergenic
911687650 1:100795415-100795437 GACGGGAAAAGGATGATAAATGG + Intergenic
912539508 1:110402971-110402993 TACAGTAAAAGTATGGTATAGGG - Intronic
913137217 1:115903927-115903949 GACATTAAAAGGATGATGAGAGG - Intergenic
913706426 1:121428824-121428846 GACAGGAAAAGGAGGATCAAAGG - Intergenic
915798959 1:158768103-158768125 GACATTAAAAGGATGGGGCATGG - Intergenic
916471356 1:165125923-165125945 AACAGGAAAAGAATGCTCAATGG - Intergenic
916672455 1:167035156-167035178 GACAGTAGAAGCAGGGTGAAGGG - Intergenic
916860191 1:168795300-168795322 GAGAGTAAAAGAATGGTGACAGG + Intergenic
918916925 1:190653401-190653423 GATAGGAAAACGTTGGTCAAAGG + Intergenic
919251670 1:195064808-195064830 AAAAGTAAAAAGATGGACAAAGG - Intergenic
919399750 1:197097739-197097761 AACAGTAAAAGACTGGTTAATGG + Intronic
919402691 1:197139239-197139261 GTTGGTAAAAGGATGGTCAGAGG - Intronic
921298375 1:213725793-213725815 AACAGTAAAAGAATGAACAAAGG - Intergenic
921717801 1:218436201-218436223 CACAGTAAAAGAAAGGGCAAAGG - Intronic
921760477 1:218907989-218908011 GAGAGTAAAAAGATGGTTACCGG - Intergenic
924811322 1:247405114-247405136 GAAGGTAAAAGGAGGGTCAGAGG - Intergenic
1063269888 10:4496609-4496631 GAGAGTAGAAGGATGGTTACTGG - Intergenic
1063554829 10:7068480-7068502 GAAAGTAAAATGATGGGCAGGGG - Intergenic
1064497232 10:15924608-15924630 CACAGTAGAAGGAGTGTCAATGG - Intergenic
1065636102 10:27736151-27736173 GAGAGTGAAAGCAGGGTCAAGGG + Intronic
1067347948 10:45451450-45451472 GACAGTAAAAAGATTGCCAGGGG + Intergenic
1067360878 10:45577193-45577215 GACAGTAGAAGGATGGTTACTGG + Intronic
1067790367 10:49283207-49283229 TACATTAAAACGACGGTCAATGG + Intergenic
1068110680 10:52676658-52676680 GACAGAAAAAGGGTGCCCAAAGG + Intergenic
1068963014 10:62884211-62884233 GTTAGTAAGAGGATGGACAATGG + Intronic
1069308838 10:67007367-67007389 GCCAATAAAAAGTTGGTCAAGGG - Intronic
1069510955 10:69042237-69042259 TACAGCAAAAGCATGGACAAAGG - Intergenic
1069588313 10:69625310-69625332 GAAAGTAAAATGATGGAAAAAGG + Intergenic
1071172841 10:82887641-82887663 GACAATTAAAGGAAGGTAAAGGG + Intronic
1071355228 10:84786871-84786893 GACAGAAGAAAGATGATCAATGG + Intergenic
1071934108 10:90507761-90507783 GTCAGTAGAAGGATAGTGAAAGG + Intergenic
1072987982 10:100159082-100159104 GAAAGTAAAAGAATGGGAAAAGG + Intronic
1075652399 10:124137054-124137076 GACAGTAAATGGATGTAAAATGG - Intergenic
1076580305 10:131504160-131504182 TACAGTAAAATTAAGGTCAATGG + Intergenic
1078615324 11:12860037-12860059 GACAGACAAAGGATGGTCACAGG + Intronic
1078820381 11:14874236-14874258 AAAAATAAAAGGATGGTTAAAGG - Intergenic
1079150320 11:17893253-17893275 GACATTAAAAGCCTGGTCCAAGG + Intronic
1079699870 11:23531617-23531639 GAAAGTGAAAGGATGGGAAAAGG - Intergenic
1080989550 11:37514224-37514246 GTTAGTAAAAGGATGTTCTAGGG + Intergenic
1082718672 11:56646554-56646576 GACAGAAGAAGGATGGTTCATGG - Intergenic
1082774600 11:57235749-57235771 GACAGTTAAAGGATGTGCATAGG + Exonic
1083516508 11:63263652-63263674 AACAGTAAAAAGATGGGCAGAGG - Intronic
1084371641 11:68749251-68749273 TACAGGAAAAGGATGGGCAGAGG - Intronic
1085761930 11:79248586-79248608 GGCAGTAAAAGGATTTTCAGGGG + Intronic
1085977227 11:81672731-81672753 GAGAGTAGAAGGATGGTTACTGG + Intergenic
1086404092 11:86485628-86485650 GACAGTGAAAGGGTGATCAATGG - Intronic
1087355641 11:97090466-97090488 AATAGGAAAATGATGGTCAAAGG - Intergenic
1087416766 11:97866512-97866534 GAGAGTAGAAGGATGGTTACAGG - Intergenic
1087494155 11:98867731-98867753 GACAGTGAAAGGAAGGGCAAGGG - Intergenic
1088685089 11:112278377-112278399 CACAGTAAAAGAAAGGTCACTGG + Intergenic
1088835116 11:113571291-113571313 GACAGTAAAAGGATGAAAAAAGG + Intergenic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1088998250 11:115023502-115023524 GAAAGTGAAAGGATGGAAAAAGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1091072152 11:132577213-132577235 GTCAGGAAAAGGATGGTCCAGGG + Intronic
1091651331 12:2312444-2312466 GAGGGCAGAAGGATGGTCAATGG - Intronic
1092773067 12:11916190-11916212 GATAGAAAAAGGACTGTCAAAGG - Intergenic
1093555404 12:20467633-20467655 GACAGTAAAGAGTTGGTCAATGG + Intronic
1093890977 12:24520778-24520800 GAAAGTGAAAGGATGGGAAAAGG + Intergenic
1094394198 12:29987876-29987898 GAAAGTAAAATGATGGATAAGGG + Intergenic
1094596705 12:31872831-31872853 GACAGTGAAAGGAAGGGAAATGG + Intergenic
1096184032 12:49566721-49566743 GACTGTAAGAGGATGGACAAAGG - Intronic
1096545705 12:52338703-52338725 GACAGTGAAAGGAGGGAGAAGGG - Intergenic
1097208648 12:57346643-57346665 TGCACTAAAAGAATGGTCAAAGG + Intronic
1098913197 12:76231590-76231612 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1098966144 12:76790834-76790856 GATAGTTAAAGGTTGGTTAAGGG + Intronic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1101430783 12:104625290-104625312 AAAAGAAAAAGGATGGTCACTGG - Intronic
1101894103 12:108742048-108742070 GAAAGTAAAAGGATGGTGGCTGG - Intergenic
1105201000 13:18177613-18177635 GACAGTAAAAGGATGGTCAATGG - Intergenic
1105941746 13:25153795-25153817 GACAGGAAAAGGTTTGTTAAAGG - Intergenic
1106817897 13:33429737-33429759 GAGAGTAGAAGGATGGTTACCGG + Intergenic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107664698 13:42676717-42676739 GACAGTAGAATGATGGTTACTGG - Intergenic
1108438319 13:50423160-50423182 GACAGTAAATGAATGATAAAAGG + Intronic
1108711656 13:53038937-53038959 GACACTTAAAGGATGCTCAGTGG - Intronic
1108955575 13:56153023-56153045 GACAGTAAAAGGATGTATATTGG - Intergenic
1109588400 13:64442102-64442124 GAGATTAAAAGAATGGGCAAAGG - Intergenic
1111608707 13:90576131-90576153 GACAATGGAAGGATGGTGAAGGG - Intergenic
1112855376 13:103762800-103762822 GACTGTGAAACCATGGTCAATGG - Intergenic
1113445888 13:110366527-110366549 GACAGTAAAATAATAGCCAAGGG + Intronic
1115460924 14:33659853-33659875 AAAAATCAAAGGATGGTCAATGG + Intronic
1115867568 14:37764622-37764644 GAAAGTGAAAGGATGGGAAAAGG - Intronic
1116376800 14:44212535-44212557 AACAGTAGAAGGATGGGAAAGGG + Intergenic
1117222022 14:53616060-53616082 CACAGAAAAAGGAAGGTTAAGGG - Intergenic
1117260419 14:54027244-54027266 GGCATTAAAAGGATAGTAAAGGG - Intergenic
1117915397 14:60672765-60672787 GACAGCAAAAGGATGGGAAAAGG - Intergenic
1118099367 14:62579030-62579052 GAGAGTAGAAGGATGGTTACTGG + Intergenic
1120727391 14:87960151-87960173 GACAGGAAGAGGTCGGTCAACGG + Intronic
1121264727 14:92593457-92593479 AACAGTAAATGGATGGAGAAAGG + Intronic
1122011242 14:98750765-98750787 GCAAGCAAAAGGATGGTCACTGG - Intergenic
1123881967 15:24685206-24685228 TGCAGTAAAATGATGGTTAATGG - Intergenic
1123960005 15:25387806-25387828 GACATTAAAAGGATAATCAAGGG + Intronic
1126961760 15:54004179-54004201 GAAAGTAGAAGGATGGTTACTGG - Intergenic
1128884417 15:71273406-71273428 AAAAGTAAAATGTTGGTCAAAGG + Intronic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1128999944 15:72323821-72323843 GAAAGTAAAAGGATAGAAAAAGG - Intronic
1129629579 15:77244216-77244238 GACAGCAAAAGGAGGATAAAAGG + Intronic
1130399878 15:83540958-83540980 GAGAGTAGAACGATGGTCACCGG - Intronic
1131279863 15:91012273-91012295 GACATTCAAAGGAAGGTCACTGG + Intronic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1135528847 16:23235119-23235141 GTCAGTAACAGGATGGAAAATGG - Intergenic
1137288244 16:47033891-47033913 TTCAGTAAAATGAAGGTCAAAGG + Intergenic
1137552587 16:49450285-49450307 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
1138063594 16:53917060-53917082 GTCAGTGAAACCATGGTCAAGGG + Intronic
1140240525 16:73195769-73195791 GACAGGTAAAGGTTGGTGAAGGG + Intergenic
1142576815 17:914509-914531 GACAGTAGAGGCAAGGTCAAAGG + Intronic
1143495482 17:7309889-7309911 GACAGTAAAAGCAGAGTTAAAGG - Intronic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146514782 17:33480635-33480657 GAAAGTAAGGAGATGGTCAATGG - Intronic
1149410697 17:56403513-56403535 TACAGTAAAAGGGTGGAAAAAGG - Intronic
1150056676 17:62023114-62023136 GGGAGAGAAAGGATGGTCAAGGG + Intronic
1153403091 18:4702777-4702799 GACAGCAAATGGATGTTTAAAGG + Intergenic
1154496906 18:14968091-14968113 AACAGGAAGATGATGGTCAAAGG - Intergenic
1155458862 18:26053626-26053648 ACCAGTAAAAGAATGGGCAAAGG + Intronic
1156585953 18:38431284-38431306 GACAGAAAGAGCATGATCAAGGG + Intergenic
1156927462 18:42598801-42598823 CACATTAAAAGGATAATCAAGGG - Intergenic
1157569328 18:48702089-48702111 GATATTAAAAGAATGGTCCATGG + Intronic
1158629292 18:59098369-59098391 GAGAGTAGAAGGATGGTAACTGG + Intergenic
1158909392 18:62045043-62045065 GACAGTAAAAAGAAATTCAAAGG + Exonic
1159463273 18:68747203-68747225 AACAGGAAAAGAATGGTTAATGG - Intronic
1159480349 18:68982369-68982391 GAAAGTAGAAGGATAGTTAAGGG - Intronic
1159685383 18:71412567-71412589 GACAGTAAATTGATTGTCATTGG + Intergenic
1161621468 19:5299503-5299525 GACAGTAAAATAATGGGTAATGG - Intronic
1162466751 19:10846698-10846720 GACATTAAAAGGATAGTAAGGGG + Intronic
1162559016 19:11405239-11405261 GACAGGAGAAGGGTGGTCAGGGG + Intronic
1163072690 19:14857613-14857635 GAGAGTAGAAGGATGGTTACTGG - Intergenic
1164725869 19:30465251-30465273 GCCAGTAACAGGATGGTCTGCGG - Intronic
1164895041 19:31868805-31868827 AAAAGTTAAATGATGGTCAAGGG + Intergenic
1165280281 19:34791675-34791697 GGGGGTAAGAGGATGGTCAAAGG + Intergenic
1165566975 19:36738843-36738865 CAGAGTAGAAGGATGGTTAATGG + Intronic
1165612052 19:37163930-37163952 GACATTAAAAAGATGACCAAAGG + Intronic
1165616016 19:37201157-37201179 GACAGTAAAAGGAGGAGCAAAGG + Intronic
1166273366 19:41732963-41732985 GACAGAAATAGGATGGTGAAAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925009662 2:473152-473174 GAAAGTAAAAGTATGGAAAAGGG + Intergenic
925737033 2:6972547-6972569 AAAAGGAAAAGGATTGTCAAGGG - Intronic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927441830 2:23124261-23124283 GAAAGTAAAAGGATGGTAAAGGG - Intergenic
930705697 2:54502724-54502746 GACAGTGAAAGCAAGGTGAAGGG + Intronic
931588567 2:63855829-63855851 TACAGAAAAAGGCTGGGCAATGG - Intronic
933053542 2:77632142-77632164 GACAGTATAAGGATTGTTACTGG - Intergenic
935023145 2:99251101-99251123 GAGAGTAAGAGGAAGGTAAAGGG + Intronic
935490145 2:103709493-103709515 AACAGTAAAAGGAAGGGGAAAGG + Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
935851646 2:107227878-107227900 GAAAGTAAAAGGAAGGACAAAGG - Intergenic
937237501 2:120439651-120439673 GACAGTAAAGAGATGTTTAAAGG - Intergenic
937351676 2:121168606-121168628 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
937561822 2:123233741-123233763 GAAAGTAAAAGGATGAGAAAAGG - Intergenic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
938779219 2:134569749-134569771 GACAGTAGAATCATGGACAAAGG - Intronic
938872307 2:135492328-135492350 GAAAATAAAAAGATGGTTAAAGG + Intronic
940954089 2:159709319-159709341 GACAAAAAGAGGATGGTTAATGG + Intergenic
941304467 2:163845397-163845419 GAAAGAAAAAGGATGGACAAAGG - Intergenic
943366719 2:186973567-186973589 AACAGTAGAAGAATGGACAAAGG - Intergenic
943481856 2:188428971-188428993 GACAGGAAAAGGATACTCACAGG + Intronic
943561922 2:189473902-189473924 GACAGCAAAAGGGTTTTCAAAGG - Intronic
944289108 2:197984835-197984857 GAAAATAAAAGGATAGTGAATGG + Intronic
944759848 2:202803441-202803463 GAAAGGAAAAGGATGGAAAAGGG + Intronic
947620947 2:231590722-231590744 GTCAGTAAAAGGAGTGTGAAGGG + Intergenic
1169541960 20:6609400-6609422 GAGACTAGAAGGATGGTCACCGG + Intergenic
1170015656 20:11778912-11778934 GAGAGGAAATGGATGGTTAAAGG + Intergenic
1170721427 20:18883222-18883244 GAGAGGAAAAGGATGGTTGAGGG - Intergenic
1171042512 20:21778580-21778602 TCCAGTAAAAGGTTGGGCAAAGG - Intergenic
1172333353 20:34092223-34092245 GCCAGTAAACTTATGGTCAATGG - Intronic
1172378471 20:34467079-34467101 GACATTAAAAGGATAATAAAGGG + Intronic
1173203592 20:40972802-40972824 CAGAGTAGAAGGATGGTTAATGG - Intergenic
1175353280 20:58341604-58341626 GAGAGTAGAAGGGTGGTCCAGGG + Intronic
1175406250 20:58731846-58731868 AATAGTAAAAGGATGGAAAAAGG + Intergenic
1176865448 21:14049995-14050017 GACATCAAAAGGATGATAAAGGG + Intergenic
1178601813 21:34000933-34000955 GAGTGTCAAAGGATGGACAAAGG + Intergenic
1180250481 21:46583043-46583065 GACAGTAAAAGGATGAGAAAAGG + Intergenic
1183313706 22:37125700-37125722 GAAAGGAAAAGGATTGTAAAGGG - Intergenic
1183522688 22:38304529-38304551 GACAGGACAAGGATGGACACAGG + Intronic
1184050090 22:41997938-41997960 GACAGGAAGAGGGTGGGCAAAGG - Exonic
951412703 3:22384249-22384271 GAGAGTAGAAGGATGGTTACTGG + Intergenic
952428251 3:33197201-33197223 GACAGGAAAAGGAAGGTGCATGG + Intronic
952724628 3:36570877-36570899 GAAAGTAAAAGAATGGAAAAAGG - Intergenic
952770047 3:36991833-36991855 GAAAGTACAAATATGGTCAAAGG + Exonic
953369905 3:42378555-42378577 GACAATAAAAGGTTGTTTAATGG + Intergenic
953631350 3:44620761-44620783 GAGGGTAAAAGGATAGGCAATGG + Intronic
954910583 3:54104032-54104054 GACATTAAAAGAATGGTAATTGG - Intergenic
956107415 3:65834935-65834957 CAAAGTAAAAGGATGGAAAAAGG - Intronic
956179541 3:66504320-66504342 GACAGAAAATGACTGGTCAAAGG - Intergenic
957087479 3:75695121-75695143 GAAAATAAAAGGATGGAAAAAGG + Intergenic
957319407 3:78609713-78609735 TACATGAAAATGATGGTCAATGG - Intronic
957633626 3:82752095-82752117 GACAGAAAAAAAATGTTCAATGG - Intergenic
958067692 3:88565064-88565086 GATGGTAACAGGCTGGTCAAAGG + Intergenic
958590177 3:96147411-96147433 AACATTAAAAGGCTGATCAAAGG + Intergenic
958997118 3:100917499-100917521 GCCAGTAAAAGGATATTAAAGGG - Intronic
959019202 3:101169790-101169812 GACAGTAAATGGAAGGAGAATGG - Intergenic
959082144 3:101813257-101813279 AACAGTAAAAGGCAGGACAAAGG - Intronic
959733082 3:109626483-109626505 GACAGTTAATGGAGTGTCAATGG + Intergenic
960551659 3:118982541-118982563 GACAATAAAAAGAAGGACAAAGG + Intronic
960880360 3:122338903-122338925 GAGGGCAAAAGGGTGGTCAAGGG - Intronic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
963341215 3:144036034-144036056 GACATTTAAAGGATGTTGAAAGG - Intronic
963868666 3:150389834-150389856 GACAATAAAAGTATGTACAAAGG - Intergenic
963949177 3:151179695-151179717 CACAGGAAAAGGAAGGTCAATGG - Intronic
964693237 3:159477608-159477630 CACAGTTAAAGAATGGGCAAAGG - Intronic
965399170 3:168197597-168197619 GTCAGTAAAAGGAGGGTGTATGG - Intergenic
965903918 3:173678961-173678983 GAGAGAAAAAGTATGGTAAATGG + Intronic
965935052 3:174098436-174098458 GAGGGTAAAAGGAGGGTCAGTGG + Intronic
968447813 4:661185-661207 GACAGCAGATGGATGGTGAATGG + Intronic
969101873 4:4775504-4775526 GTCTGTAAAAGGATGGGGAAGGG + Intergenic
969287790 4:6216684-6216706 GAAAGTCAAAGGATGGAAAAAGG - Intergenic
970093965 4:12441587-12441609 GACAGTAAAAGGAAGGACCCAGG + Intergenic
970384235 4:15540356-15540378 GACAGTAAGTGAATGTTCAATGG - Intronic
971560342 4:28072094-28072116 GACAGAAAAAGGAGGCTCACAGG + Intergenic
971728348 4:30343179-30343201 GGCAGTAAAAGGATAATCCATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
972145475 4:36019660-36019682 GACAGTCAAAGGTAGATCAAAGG + Intronic
974329988 4:60465631-60465653 CAAAGTAAAAGGATGGAGAAAGG + Intergenic
976183051 4:82417398-82417420 GATGGGAAGAGGATGGTCAACGG - Intergenic
984674801 4:182534546-182534568 GACAGTAAACACATGGTCACTGG + Intronic
985223693 4:187735794-187735816 GACACTAAAAGGATAGTAAAGGG + Intergenic
985519361 5:364784-364806 GAAAGTAAAAGGATGGGAAAGGG + Intronic
985860875 5:2469737-2469759 GAGAGAAAAAGCATGTTCAAGGG - Intergenic
986849059 5:11789363-11789385 GACAGTAGAAGGTTTGTGAATGG - Intronic
987501276 5:18712635-18712657 GGCAGGAAGAGGTTGGTCAATGG - Intergenic
987875850 5:23680404-23680426 GACAGGCATAGGATGGTCTAGGG + Intergenic
987965964 5:24872811-24872833 GACAGTAAAAGGTAGATGAAAGG - Intergenic
987988283 5:25178295-25178317 CACAATAAAAAGATGATCAAGGG - Intergenic
988020214 5:25611614-25611636 GAAAGTAAAAGAATGGGAAAAGG + Intergenic
989223691 5:38999910-38999932 GAAAGTAAAAGGATGGTAAAAGG + Intronic
989971242 5:50527111-50527133 GACAGGAAAAGGAAGATCAAAGG + Intergenic
991178086 5:63714155-63714177 GAAAGTAAAAGAATGAGCAAAGG - Intergenic
991671983 5:69056877-69056899 GAGAGTAGAAGGATGGTTACTGG - Intergenic
992459069 5:76943529-76943551 GACAGGAACAGGAGGGGCAAAGG - Intergenic
992504448 5:77372721-77372743 GACATTAAAAGGATGATGAGAGG - Intronic
994309518 5:98251793-98251815 GACACTAAAAGGAGGGAGAAAGG + Intergenic
994436589 5:99742949-99742971 GATAATGAAAGGATGGTTAATGG - Intergenic
995267858 5:110185548-110185570 GAGAGTAAAAGGATAGTTACCGG - Intergenic
995940690 5:117579307-117579329 GACTATAAAAAGATGATCAACGG - Intergenic
996396726 5:123021151-123021173 GACAGTGAAGGGGTGGTCAGCGG - Intronic
997311742 5:132891093-132891115 TACAGTTAAAGGATGGGAAATGG + Intronic
997511112 5:134455190-134455212 GAAAGTAGAAGGATGGTTACCGG + Intergenic
998236569 5:140402857-140402879 GACAGGAAAAGGAAGTTCCAGGG + Intronic
999970320 5:156853936-156853958 GAAAGTAAAAGAATGGAAAAAGG + Intergenic
1001734409 5:173987207-173987229 AACAGGAAAAGGATGGTGATTGG + Intronic
1002802279 6:535513-535535 GACATTAAAAGGATAGTAAAAGG + Intronic
1004500780 6:16208120-16208142 GACAGCAAAAGCATGTTCCATGG - Intergenic
1006733544 6:36254886-36254908 GACTGCAAAAGGATGTTCAAAGG + Intronic
1006937127 6:37726265-37726287 GAGAGTAAATGGATGGTATATGG - Intergenic
1008857514 6:56108397-56108419 GACAATAGAAGGATGGGCGAAGG + Intronic
1009677981 6:66851599-66851621 CCAAGTAAAAGAATGGTCAATGG - Intergenic
1009751831 6:67885690-67885712 CAGAGTAAAAGGAGGGGCAAGGG + Intergenic
1010008804 6:71027041-71027063 GACAGTAAAGGGTTGGAAAAAGG - Intergenic
1010403610 6:75477242-75477264 GAGAGTAAAATGATGGTTACCGG + Intronic
1011256612 6:85428108-85428130 GAAAATACAAGGATGGTGAAGGG + Intergenic
1017186376 6:151605021-151605043 CACAGGAAAAGGTTGGTTAATGG - Intronic
1018682896 6:166279731-166279753 TAATGGAAAAGGATGGTCAAAGG - Intergenic
1019721267 7:2573142-2573164 GACAGTAAAAGGATGAAAGAAGG - Intronic
1020653046 7:10898048-10898070 GAGTATAAAAGGATGGTTAACGG + Intergenic
1022952157 7:35349383-35349405 GAAAGGAAAAGTATGGTCACTGG - Intergenic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1023441293 7:40187508-40187530 GACAGGAAATGTATGGTTAAAGG - Intronic
1023496152 7:40799475-40799497 CAGAGTAAAAGGATAGACAAGGG + Intronic
1026305094 7:69133776-69133798 AACAGAATAAAGATGGTCAATGG + Intergenic
1026495746 7:70901174-70901196 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1028027450 7:85863991-85864013 GACAGGGAAAGGTTGGTAAAAGG + Intergenic
1028057140 7:86260031-86260053 GACAGTAAAACGGTGGTTACTGG + Intergenic
1028355808 7:89906072-89906094 GATAGAGAGAGGATGGTCAATGG - Intergenic
1028782036 7:94748415-94748437 CAGAGTAAAGGGATGGTGAAAGG + Intergenic
1031562203 7:123251958-123251980 GAAATCAAAAGGATGGTAAAAGG + Intergenic
1032187217 7:129736826-129736848 GAGAGTAAAAGGAGGAGCAATGG + Intronic
1033706638 7:143893062-143893084 GAAAGTGAAAGGATGGAAAAAGG + Intronic
1034081961 7:148287491-148287513 GTCAGGAAAAGGAGGGCCAATGG - Intronic
1034743291 7:153498206-153498228 GACAGGAAATGGCTGGTCAGTGG - Intergenic
1034999025 7:155596567-155596589 CACATTAAAATGATGGTCACAGG + Intergenic
1036626274 8:10474817-10474839 TACAGTAACAGGATGGCCCAGGG + Intergenic
1038425478 8:27461572-27461594 GACGGTCAAAAGATGGTCAGCGG + Exonic
1039222598 8:35351238-35351260 GAAAGGAAAAGGATTTTCAATGG - Intronic
1040370053 8:46760761-46760783 GACAGTAAAAGACTGTTCATTGG - Intergenic
1041060495 8:54030280-54030302 GAATGTAAAAGGATGGAAAAAGG - Intergenic
1041392724 8:57360989-57361011 GACAGTCAATGAATGGTCACTGG + Intergenic
1041816470 8:61977800-61977822 GAAAGTCAAAGGATGGAAAAGGG + Intergenic
1043310890 8:78858473-78858495 AACAATAAAAGGATGGACAAAGG + Intergenic
1044009479 8:86975405-86975427 GACAGTAGAATGGTGGTCACTGG - Intronic
1045018277 8:98018486-98018508 GACCGTAAAAGTAAGGGCAAAGG + Intronic
1045494931 8:102700209-102700231 GTCAGTAACAGTATGGTCAGTGG + Intergenic
1045680738 8:104657132-104657154 GAATGTAGAAGGATGGTCCATGG + Intronic
1046168804 8:110477447-110477469 AACAGTAAAATGACGGTCCAGGG - Intergenic
1046608558 8:116397738-116397760 GAAAGCAAAAGGATGGAAAAAGG + Intergenic
1046619589 8:116514313-116514335 GACAGTTGAAGGCTGGTCATGGG - Intergenic
1047663456 8:127064127-127064149 GACAGTAACAGAATGGTCCATGG + Intergenic
1048433521 8:134393282-134393304 CACAGAAAAAGGAGAGTCAATGG + Intergenic
1048790901 8:138102340-138102362 GAAAGTAATAGGATGCTAAATGG + Intergenic
1052707608 9:32011415-32011437 AACAGGAAAATGAAGGTCAAAGG + Intergenic
1057323899 9:94042129-94042151 ATAAGTAAAAGGATGGTGAATGG - Intronic
1057613540 9:96567651-96567673 GAGAGTAGAAGGATGGTTATCGG + Intronic
1058672988 9:107376418-107376440 GACAGAAAAAGGAAAATCAATGG + Intergenic
1059380978 9:113924324-113924346 GACATTAAAAGGATGATCAAAGG - Intronic
1060099096 9:120822439-120822461 GACTGTAAAACGATTGTCATAGG + Intronic
1060879012 9:127104635-127104657 GACAGTAACAGGGTGGTCCCAGG - Intronic
1061778219 9:132980245-132980267 GACAGTACAAGGATTTTCAAAGG + Intronic
1062115246 9:134805131-134805153 GCCATGAAAAGGTTGGTCAAGGG - Intronic
1203583357 Un_KI270746v1:36330-36352 AACAGTAAAATGTTGGTCAATGG + Intergenic
1186135860 X:6519743-6519765 GACAGTAAAAAGATAGTCAGTGG - Intergenic
1186684641 X:11912826-11912848 GACAGTAGAAAAATGGTGAAGGG + Intergenic
1187073298 X:15910219-15910241 GAATGTCAAAGGATGGTTAATGG - Intergenic
1189017276 X:37297291-37297313 GACAGTGAAAGCTGGGTCAAGGG + Intergenic
1189214866 X:39314297-39314319 GAAAGGGAAAGGAAGGTCAAAGG + Intergenic
1189710454 X:43806217-43806239 AACAGAAAAAGGATGGTTAGTGG - Intronic
1190530886 X:51374974-51374996 GACAGTAGAAGGATGGTTACTGG + Intergenic
1190614964 X:52220848-52220870 GAAAATAAAAGGATGGAAAAAGG + Intergenic
1193141906 X:78036466-78036488 CAGAGTAAATGGATGGGCAAGGG + Intronic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194546827 X:95246107-95246129 GAGAGTAGAAGGATGGTTACTGG + Intergenic
1194824001 X:98539625-98539647 GAGAGTAGAAGGATGGTTACTGG + Intergenic
1194921219 X:99767661-99767683 GTGAGTAGAAGGATGGTCACTGG + Intergenic
1195057220 X:101157976-101157998 GAGAGTAGAATGATGGTCATTGG - Intronic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1196254544 X:113500859-113500881 GAGAGTAGAAGGATGGTTACCGG - Intergenic
1196610013 X:117702081-117702103 GAGAGTAGAAGGATGGTTACTGG + Intergenic
1197294384 X:124700007-124700029 GACAGCAAAAGGATTGATAACGG + Intronic
1198798646 X:140426951-140426973 TTCAGTAAGAGGGTGGTCAAAGG + Intergenic
1201890377 Y:18937353-18937375 GACAGTAAAATAATGGACACTGG - Intergenic