ID: 1105209122

View in Genome Browser
Species Human (GRCh38)
Location 13:18247515-18247537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3178
Summary {0: 10, 1: 1, 2: 17, 3: 303, 4: 2847}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105209122 Original CRISPR ATGGGGGAATGGAGGGAAGA AGG Intergenic
Too many off-targets to display for this crispr