ID: 1105212219

View in Genome Browser
Species Human (GRCh38)
Location 13:18263674-18263696
Sequence CTGTCTAACCACAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 6, 2: 0, 3: 11, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105212219_1105212222 28 Left 1105212219 13:18263674-18263696 CCTTCCACCTTGTGGTTAGACAG 0: 1
1: 6
2: 0
3: 11
4: 176
Right 1105212222 13:18263725-18263747 TTGTTTGTTTGTTTTTGAGATGG 0: 2013
1: 1569
2: 3104
3: 101837
4: 84700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105212219 Original CRISPR CTGTCTAACCACAAGGTGGA AGG (reversed) Intergenic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
905949423 1:41936144-41936166 CTCTGTAACCCCAAGATGGAGGG + Intronic
908483424 1:64566514-64566536 CTGTCTTACCACAGAATGGAAGG + Intronic
908850527 1:68371451-68371473 CTGTCTATCGACCAGGAGGAGGG - Intergenic
910011455 1:82468752-82468774 CTGTATCCCCACATGGTGGAAGG + Intergenic
912992953 1:114507814-114507836 CTATCTAAAAACACGGTGGATGG + Intronic
915433217 1:155883056-155883078 ATGTCTTACCACATGGTGGAGGG + Exonic
915717778 1:157960750-157960772 CTTTCTAACCTCTAGGTGGGAGG - Intergenic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919540370 1:198837821-198837843 CTGCCTAACCATGGGGTGGAAGG - Intergenic
922439313 1:225639539-225639561 CTGTCTCATAACATGGTGGAAGG - Intronic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
1063021471 10:2133226-2133248 CTGCCTCATCACATGGTGGAGGG - Intergenic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063195387 10:3736650-3736672 CTGTGTACCCGCAAGGCGGAAGG + Intergenic
1063590769 10:7393744-7393766 GTGTCCAACTACACGGTGGAAGG + Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1070681683 10:78453383-78453405 CTGTCTAACTACCTGGGGGAAGG - Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1075465762 10:122649090-122649112 CTGTCTGACAACAGAGTGGATGG + Intergenic
1077400441 11:2353505-2353527 CTGTGTCACCACACTGTGGATGG + Intergenic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1079279190 11:19072677-19072699 GTGTCTGACCCCACGGTGGAGGG + Intergenic
1086448137 11:86889498-86889520 CTGTATTCCCACAAGGTGGAAGG + Intronic
1086779524 11:90884966-90884988 CTGTCTCTCCAAAAGGTGAAGGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087128729 11:94651100-94651122 CTGTCTAAGGACAAGATAGAGGG + Intergenic
1087477721 11:98657977-98657999 CTGTGTATTCACATGGTGGATGG - Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1087984226 11:104657663-104657685 CTGTCTAACCACAGCTGGGAAGG + Intergenic
1088812426 11:113400680-113400702 CTGTCTCCTCTCAAGGTGGAAGG - Intergenic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1094452592 12:30598358-30598380 CTGTCTAGCCAGAAGGGAGATGG - Intergenic
1097271284 12:57776050-57776072 CACTCTGACCACTAGGTGGAAGG - Intronic
1098279567 12:68849023-68849045 TTTTTTAACCACAAGGTGGGAGG + Exonic
1098740562 12:74169049-74169071 CTGTCCAAACACAAGATGAAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1107523497 13:41206267-41206289 CTGTGTCACAACATGGTGGAAGG - Intergenic
1110472590 13:75876569-75876591 TTGTCTCACCACTAGGGGGAAGG + Intronic
1110738452 13:78965963-78965985 CTGGATAACCACAGGGTGTAGGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1114658434 14:24329872-24329894 CTGGCTAACCACATGGAGGCAGG - Exonic
1116528820 14:45941042-45941064 CTGTGTATTCACATGGTGGAAGG + Intergenic
1118628297 14:67679117-67679139 CTGTGTAATAACAAGATGGAAGG + Intronic
1118815468 14:69310474-69310496 CTGTTTAACTACAGGGTGGGTGG + Intronic
1125426770 15:39556753-39556775 CTGCCAAAGCACAAGGTGGGTGG + Intergenic
1126243997 15:46481955-46481977 CTGTATCATCACATGGTGGAAGG - Intergenic
1127773785 15:62250462-62250484 CTGTCAAAGCACCAGGTTGAAGG + Intergenic
1128733195 15:70034554-70034576 CTGTGCTACCACAAGGTAGAAGG + Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1143614601 17:8042354-8042376 CTCTCTACCCTCCAGGTGGAAGG + Exonic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1147957661 17:44145733-44145755 CTGTCTAATCACAAGATGAGGGG + Intronic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1151728553 17:75897991-75898013 CTGGCTAACTAGTAGGTGGAGGG - Intergenic
1153063094 18:1014192-1014214 CTGCCTAACCACAAAGAGGCTGG + Intergenic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1156919642 18:42505158-42505180 GTGTTTACCCTCAAGGTGGATGG + Intergenic
1156997675 18:43486866-43486888 CTGTCCACCTGCAAGGTGGATGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1160117854 18:76098850-76098872 CTTTCCAACCACAGGGTGGTCGG + Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
925031815 2:655720-655742 CTGCCTCACAACAAGGTGGCTGG - Intergenic
927304376 2:21553893-21553915 ATATAGAACCACAAGGTGGAAGG + Intergenic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
931282383 2:60805548-60805570 CTGTCTAACCAGTAGGGGGTAGG + Intergenic
931749331 2:65317060-65317082 TTGTCTAAACACAATGTGGCTGG + Intronic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
934089333 2:88537772-88537794 CTGTATAACCACCACGTGGGGGG + Intergenic
934301405 2:91778728-91778750 CTGTCTAACTACAAGGTGGAAGG + Intergenic
935683940 2:105667207-105667229 CTGCCTACCCTCAAGGGGGAAGG + Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
938948540 2:136236433-136236455 CTGTCTAACCACATAGATGATGG + Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
941180740 2:162256182-162256204 CTATATAATCACAAGGTAGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
1170036217 20:11992954-11992976 TTGTTAAACCACAAGCTGGACGG - Intergenic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1171203355 20:23259376-23259398 CTGTCTATGCAAATGGTGGAAGG + Intergenic
1172660290 20:36563414-36563436 CTGCCTCATCACATGGTGGAAGG + Intergenic
1173187084 20:40848581-40848603 CTGCCTAATCACCAGGGGGAGGG - Intergenic
1173441495 20:43080830-43080852 AAGTCGAACCACAAGATGGAGGG + Intronic
1174883295 20:54304247-54304269 CTGTCTCAAAAAAAGGTGGATGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175231292 20:57475064-57475086 ATCTCTAACCACAAGGGGGGCGG - Intergenic
1175807151 20:61835970-61835992 CTGACTACCCACAGGCTGGAGGG + Intronic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1179369335 21:40790126-40790148 CTATTTAACCAAAAGGTGTATGG - Intronic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1180815032 22:18783994-18784016 CTGTCTAACTACAAGGTGGAAGG - Intergenic
1181201220 22:21218331-21218353 CTGTCTAACTACAAGGTGGAAGG - Intronic
1181700523 22:24618636-24618658 CTGTCTAACTACAAGGTGGAAGG + Intronic
1181977419 22:26740789-26740811 CTGGCAAACGACAAGTTGGAGGG - Intergenic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184090642 22:42291316-42291338 CTGTCTAACCCCAAGGCTGTGGG - Intronic
1203225693 22_KI270731v1_random:77100-77122 CTGTCTAACTACAAGGTGGAAGG + Intergenic
1203265135 22_KI270734v1_random:9684-9706 CTGTCTAACTACAAGGTGGAAGG - Intergenic
949274958 3:2268963-2268985 CTGCCGATCCACAAGGTGGCAGG + Intronic
953462244 3:43090735-43090757 CTGTCTTACCAGGGGGTGGAAGG + Intronic
954589798 3:51773557-51773579 GTGTCTAACCTCAAGGAGAAGGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
959995829 3:112679366-112679388 TTGTATCCCCACAAGGTGGAAGG + Intergenic
964757811 3:160104668-160104690 CTGTATAACCACCTGGTGGTTGG + Intergenic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
966297790 3:178444166-178444188 CTGCATCCCCACAAGGTGGAAGG - Intronic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
971022142 4:22547568-22547590 CTGTCTCTTCACATGGTGGAAGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
975475199 4:74815236-74815258 TTGCCTAACCACAAGCAGGAAGG + Intergenic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
975854348 4:78607382-78607404 ATGTCTAAACAATAGGTGGAAGG - Intronic
976198976 4:82561421-82561443 CTGGCTAACCGCAAAGTGCAGGG + Intronic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
977431297 4:96933435-96933457 CTGGCTAGCCAAAATGTGGAGGG - Intergenic
979090502 4:116477519-116477541 CTCTCTACCCACAATGTGGCAGG + Intergenic
979871128 4:125823498-125823520 CTGTGTAATCACATGGTGAAAGG + Intergenic
980257005 4:130394630-130394652 CTGTCTAGTCACAAGGGAGAAGG + Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
983031802 4:162811939-162811961 CTGTGTATTCACATGGTGGAAGG + Intergenic
985268331 4:188171044-188171066 CTGTGTAACCACAAGCTCCATGG - Intergenic
986854173 5:11849683-11849705 ATCTCAAACCACAAGTTGGAGGG + Intronic
987660523 5:20867502-20867524 CTGTTTCATCACAAGGTTGAAGG + Intergenic
988763124 5:34338181-34338203 CTGTTTCATCACAAGGTTGAAGG - Intergenic
988822212 5:34898455-34898477 CTGTCGCACCACAAGGTGGCAGG - Intronic
993822885 5:92642339-92642361 TTTTCTAACCACAGGATGGAAGG - Intergenic
995703430 5:114960884-114960906 TGGTATAACCACAAGCTGGAGGG - Intergenic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
997436181 5:133877381-133877403 CTGTCTACCCCAAAGGTGGGAGG + Intergenic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1001584948 5:172827536-172827558 CTGTCTCATAACATGGTGGAGGG - Intergenic
1002843586 6:926253-926275 CTGTCTAATCACAAGGGAAAAGG + Intergenic
1004037693 6:11939838-11939860 CTGTCTAACTGCAAGGAGGCTGG - Intergenic
1010383434 6:75250047-75250069 CTGGCTTACCTCAAGGTGGTTGG + Exonic
1011860738 6:91753022-91753044 CTGTCTGAACTCAAGGGGGAAGG + Intergenic
1014532925 6:122580951-122580973 CTGTGCTACCACTAGGTGGATGG + Intronic
1014805668 6:125826867-125826889 CTGTATCACCCCATGGTGGAAGG + Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1019116880 6:169772156-169772178 CTGTGTTACGACAAGGTGAAGGG - Intronic
1019476249 7:1245868-1245890 CTGGCTAAACCCACGGTGGAAGG + Intergenic
1020874765 7:13678547-13678569 CTGTCTCACCTCAGGGTGAAGGG + Intergenic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1022686854 7:32605239-32605261 CTGTCTCATCCCATGGTGGAAGG + Intergenic
1024063734 7:45716639-45716661 CTGTCTACCCACCACCTGGATGG - Exonic
1024211444 7:47209234-47209256 ATGTCTAACCACATTCTGGAAGG + Intergenic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1038418766 8:27418521-27418543 CTGTCAAACCAAAAAGAGGAGGG - Intronic
1040693186 8:49964253-49964275 CTGGCTCCCCACAAGGAGGAGGG + Intronic
1040836441 8:51736459-51736481 CTGTTGAACCATAAGGTGTATGG - Intronic
1042735849 8:71987716-71987738 CTGTCTTGCCAAAATGTGGAGGG + Intronic
1043159171 8:76824426-76824448 TTCTCTTACCAGAAGGTGGATGG + Intronic
1043209051 8:77487653-77487675 CTGTCCAGCCACATGGCGGAGGG + Intergenic
1045193997 8:99911650-99911672 CTGCCTCACAACATGGTGGAAGG + Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1053272267 9:36758573-36758595 CTGTCTCCCTACATGGTGGAAGG - Intergenic
1056082098 9:83106212-83106234 CTCTCTTAAAACAAGGTGGAGGG - Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056710085 9:88985381-88985403 CTGTTTAACCACAACGTGAAAGG - Intergenic
1058280936 9:103113892-103113914 CTGCCTAACCACAAGGTGTTAGG - Intergenic
1060706492 9:125806492-125806514 CTGTCTGTTCACATGGTGGAAGG + Intronic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1193284816 X:79699487-79699509 CTGTCTAACAACAACCTGCAGGG + Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195664671 X:107418079-107418101 CTATCTGACCAGCAGGTGGAAGG - Intergenic
1195964971 X:110421823-110421845 CTGTCACACCTCAAGGTGGTTGG - Intronic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1198407223 X:136325627-136325649 CTATCTACCCACAAAGTGGTAGG - Intronic