ID: 1105213837

View in Genome Browser
Species Human (GRCh38)
Location 13:18273262-18273284
Sequence CATTTCCACCACAAGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105213833_1105213837 16 Left 1105213833 13:18273223-18273245 CCGTCTCAAAAAAAAAAGCAAAA 0: 27
1: 1869
2: 92398
3: 73993
4: 111223
Right 1105213837 13:18273262-18273284 CATTTCCACCACAAGTCATGGGG 0: 3
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105213837 Original CRISPR CATTTCCACCACAAGTCATG GGG Intergenic
902380695 1:16050971-16050993 CATTCCCACCACAGGTGCTGGGG - Exonic
907574653 1:55515193-55515215 CTTTTCAACCACACTTCATGAGG + Intergenic
908077364 1:60535249-60535271 TATTGTCACCACAAGTCATAGGG - Intergenic
909647606 1:77934782-77934804 CATTGCCAGTCCAAGTCATGAGG - Intronic
910850005 1:91640700-91640722 AATTTCCACAACAATCCATGAGG - Intergenic
911064731 1:93777940-93777962 AATTTCCAACAGAATTCATGTGG + Intronic
911734320 1:101320750-101320772 CATCTCTACCACCTGTCATGAGG + Intergenic
912598590 1:110903997-110904019 CACTACCACCACAAGCCATAGGG - Intergenic
916573317 1:166046002-166046024 CATTTCCTCTATAAGTCATGGGG - Intergenic
917583924 1:176405753-176405775 CATTACCACCCCAGGCCATGAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919653556 1:200175307-200175329 CATTTCCATCCCAACTCTTGAGG - Exonic
920175274 1:204097233-204097255 CATTTCAACCACGGGGCATGGGG + Intronic
920319315 1:205106036-205106058 CATTACCACCAGCAGTAATGAGG + Intronic
921456334 1:215376439-215376461 CCTCTGCACCACAATTCATGTGG + Intergenic
922662803 1:227444808-227444830 CATTTCCATAACTGGTCATGTGG - Intergenic
1064094478 10:12412925-12412947 TAGTTCCACCACAAGACAAGTGG - Intronic
1064210629 10:13357911-13357933 CATTTTCACCAGAAGTGAGGAGG - Intergenic
1068402441 10:56547904-56547926 CATTTACCCCACAAGACATTAGG - Intergenic
1074590965 10:114812798-114812820 CATTTCTACAACTGGTCATGTGG + Intergenic
1074710174 10:116170588-116170610 AATTTCCATGAAAAGTCATGGGG - Intronic
1076567654 10:131409914-131409936 CATGTCTACCCCAAATCATGTGG + Intergenic
1079112341 11:17612002-17612024 CCTACCCACCACAAGCCATGTGG - Intronic
1080871138 11:36238038-36238060 CATTTCTCCCACAACTCATTGGG - Intergenic
1083440551 11:62673112-62673134 CATTTTCAAAACAGGTCATGTGG + Exonic
1084496420 11:69506471-69506493 CATTCCCACCACAACGAATGAGG + Intergenic
1086144047 11:83531530-83531552 CATTTCCACAACAATGCATGAGG - Intronic
1088472212 11:110198638-110198660 CTGTTCCACCTCAAATCATGAGG - Intronic
1090160302 11:124486031-124486053 CGTATCTACCAGAAGTCATGTGG + Intergenic
1090744539 11:129695712-129695734 CAGTTCCACCACGGGCCATGAGG - Intergenic
1093773750 12:23048223-23048245 CATTTCAACCACTAGCCACGGGG - Intergenic
1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG + Intronic
1099490409 12:83282232-83282254 CATTTCTGCAACTAGTCATGTGG + Intergenic
1100994459 12:100288481-100288503 CAGTTTCACCACAAGTAAAGAGG - Intronic
1102933038 12:116876874-116876896 CTCTTCCCCCGCAAGTCATGGGG + Intronic
1103836173 12:123823025-123823047 CATTTCCAGCACATATCTTGGGG - Intronic
1105213837 13:18273262-18273284 CATTTCCACCACAAGTCATGGGG + Intergenic
1107177213 13:37412808-37412830 CTTTTCCACCAGAATTCATAAGG + Intergenic
1108110776 13:47069580-47069602 CAATTCAACCACCAGTCATTGGG - Intergenic
1108540780 13:51442755-51442777 CTTTTCCACCTCAGGTCATCAGG - Intronic
1110363834 13:74659372-74659394 CTGTTCCACCTCAGGTCATGAGG + Intergenic
1112837269 13:103531483-103531505 AAATTCCACCACATGTCATATGG + Intergenic
1113397940 13:109965978-109966000 CATTACCACCACATGTCCCGGGG + Intergenic
1114505935 14:23213467-23213489 AAATTCCACCAGGAGTCATGAGG + Intronic
1117342440 14:54803933-54803955 CATGTCCATCACAGGTCATCAGG + Intergenic
1119475864 14:74927745-74927767 CATGTCCAACACAAGTCTTAGGG - Intergenic
1120149804 14:81020536-81020558 CAGTTCCACCTCAGGTCATCAGG - Intronic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1121646369 14:95519963-95519985 CATCTCCACCACCACTCATGGGG + Intergenic
1125178328 15:36851788-36851810 CATTTCCACCAAAAGTGCTGGGG - Intergenic
1126351650 15:47750651-47750673 CATTTCCTCCACATGCCATGGGG + Intronic
1126709401 15:51440906-51440928 CACTGCCACCCCAAGCCATGAGG + Intergenic
1126860616 15:52879170-52879192 CATTTCCCCCACAACACAAGTGG - Intergenic
1127387810 15:58481200-58481222 CCCTCCCACCACAAGTCATGAGG - Intronic
1130179639 15:81612107-81612129 GTTTTCCACCACAGGTCATTGGG + Intergenic
1131358278 15:91765523-91765545 CATTCCAAACAAAAGTCATGAGG - Intergenic
1131577666 15:93608024-93608046 GATTTCCATGACAACTCATGAGG + Intergenic
1134112253 16:11522978-11523000 CAGTTCAATCACAAGCCATGGGG - Intronic
1134583465 16:15391268-15391290 CTGTTCCACCACAAATCATCAGG - Intergenic
1134586406 16:15415085-15415107 CTGTTCCACCACAAATCATCAGG - Intronic
1135314954 16:21436703-21436725 CTGTTCCACCACAAATCATCAGG - Intronic
1135367880 16:21868971-21868993 CTGTTCCACCACAAATCATCAGG - Intronic
1135443937 16:22502178-22502200 CTGTTCCACCACAAATCATCAGG + Intronic
1135449452 16:22544778-22544800 CTGTTCCACCACAAATCATCAGG + Intergenic
1136192815 16:28628094-28628116 CTGTTCCACCACAAATCATCAGG + Intergenic
1136311624 16:29415364-29415386 CTGTTCCACCACAAATCATCAGG - Intergenic
1136325067 16:29517159-29517181 CTGTTCCACCACAAATCATCAGG - Intergenic
1136439752 16:30257143-30257165 CTGTTCCACCACAAATCATCAGG - Intergenic
1137775954 16:51054457-51054479 CTTTTACACCATAAGTCAGGTGG + Intergenic
1139859150 16:70006407-70006429 CTGTTCCACCACAAATCATCAGG - Intergenic
1139886254 16:70209440-70209462 CTGTTCCACCACAAATCATCAGG - Intergenic
1140684589 16:77421106-77421128 TATTACCACTACAAGTCAAGGGG - Intronic
1141111987 16:81277390-81277412 CAGTTCCAGCTCAAGTCCTGGGG - Intronic
1142501603 17:336262-336284 CATTTCCTCCACCTGTCAGGCGG + Intronic
1142933304 17:3306927-3306949 TTTTTCCACAACAAGGCATGTGG + Intergenic
1143359912 17:6361073-6361095 CATTTCCTCCAGAAGACAGGAGG + Intergenic
1145687305 17:26684798-26684820 CTTTTCCACCACAAGCCACAAGG - Intergenic
1147422972 17:40331741-40331763 CATTTCCATCAAATGTCAAGAGG - Intronic
1150239524 17:63621185-63621207 CAAGTCCACCACAATTAATGTGG - Intergenic
1151105029 17:71603152-71603174 CCTCTCCATCACAAGTCATATGG - Intergenic
1152050072 17:77967381-77967403 TATTGCTTCCACAAGTCATGCGG + Intergenic
1153012163 18:548967-548989 CATTTGCATGAAAAGTCATGGGG - Intergenic
1155439962 18:25851966-25851988 CACTCCCTCCACAAATCATGCGG - Intergenic
1156682767 18:39610994-39611016 CATTTCCACTCCAAGTCTTCTGG + Intergenic
1156848694 18:41700393-41700415 CATTTCGAAGACAAGTCAGGCGG + Intergenic
1156951736 18:42908771-42908793 CATTTCCACCAGCAGTCCTATGG - Intronic
1157650291 18:49322278-49322300 ACTTTCCACCACAAGTACTGAGG - Intronic
1163674338 19:18647898-18647920 CATGTCCAGCACCAGGCATGGGG - Intronic
1164623494 19:29711804-29711826 GATTTTCACCTCAAGTCATTCGG - Intronic
1167973399 19:53203977-53203999 CATTTCACCAAGAAGTCATGGGG - Intergenic
928737305 2:34307022-34307044 TACTTCCACCTGAAGTCATGGGG + Intergenic
930051695 2:47221004-47221026 CACTTCTTCCACAAGTCATAGGG - Intergenic
930795054 2:55380542-55380564 CATTTCCACCACATGTTAGCTGG + Intronic
931140028 2:59447365-59447387 CATTTCCTCCAAAATTTATGGGG - Intergenic
931172669 2:59820792-59820814 CATTTCCATCTCAAGTCACTTGG - Intergenic
931234500 2:60401839-60401861 CATTTTCCCCACAAGCCAAGAGG + Intergenic
934300489 2:91773487-91773509 CATTTCCACCACAAGTCATGGGG - Intergenic
935256166 2:101311563-101311585 CCTTGTAACCACAAGTCATGTGG - Intergenic
936049258 2:109210899-109210921 CAATTCCACCACGTGTCAAGTGG - Intronic
938700255 2:133871598-133871620 CATTTCTACCACAATATATGGGG + Intergenic
939306337 2:140416254-140416276 CATCTCCACCTCAAATCATCAGG - Intronic
939610294 2:144301717-144301739 CATTTCCTCCAGAAAGCATGTGG - Intronic
941237435 2:162992728-162992750 CATTTCTCCCACAAGCCTTGTGG - Intergenic
941482392 2:166032747-166032769 CATTTCAACAGCAATTCATGTGG + Intronic
942594753 2:177582429-177582451 CATTTCCACCTCAAGGCTTTTGG - Intergenic
946868404 2:224063457-224063479 CATTTCCACCCCTTGTCAGGAGG + Intergenic
1169427242 20:5506031-5506053 CATTCCCACCAGCAGTGATGAGG + Intergenic
1170647759 20:18212053-18212075 CATTTCCAGCACAATTAATTTGG + Intergenic
1174858708 20:54070122-54070144 CATTTCAAGCACAGGACATGGGG - Intronic
1175381519 20:58567452-58567474 CATTCCCACCACAACCCGTGAGG - Intergenic
1181698846 22:24608620-24608642 CATTTCCACCACAAGTCATGGGG - Intronic
1183142436 22:35955582-35955604 CTGTTCCACCTCAAGTCATCAGG + Intronic
1184401602 22:44277724-44277746 CACTTCCACCTCAGGCCATGGGG - Intronic
950575487 3:13829835-13829857 CATTTCCCCCAGAGGTCATTAGG + Intronic
952142436 3:30494714-30494736 CATCTCCACTAATAGTCATGAGG + Intergenic
953009382 3:39010267-39010289 CATTTTCCCAACAAGTCCTGTGG + Intergenic
954530414 3:51314006-51314028 CATTTCCACCAAAAGAAATGAGG - Intronic
956447522 3:69340066-69340088 CCTTTCCAGCTCAAGGCATGAGG + Intronic
956846265 3:73185916-73185938 CATTTCCATCACCAACCATGGGG - Intergenic
956888423 3:73584416-73584438 CATTTCCAGCACAAGTTAAGTGG + Intronic
963578924 3:147099715-147099737 CACTTCCACCACAAATCATCAGG + Intergenic
963855141 3:150245466-150245488 CATCTCAACCACATGTCATGGGG + Intergenic
967450515 3:189617817-189617839 CATTTCCAACAAAATTCTTGTGG + Intergenic
971674166 4:29603621-29603643 CATTTCCAACAAAAGTAATCTGG + Intergenic
972104107 4:35461394-35461416 CACTGACACCACAAGCCATGAGG + Intergenic
976617557 4:87093771-87093793 CATTTCCCACAAATGTCATGTGG - Intronic
978656494 4:111071378-111071400 CATGTCCAGAACTAGTCATGTGG + Intergenic
979055152 4:115984202-115984224 CTTTTCCACCTCAAATCATCAGG - Intergenic
979116132 4:116826691-116826713 CTTTCCCACCACAGGTCAGGAGG - Intergenic
979763008 4:124430049-124430071 CAATTCAAGCACAATTCATGGGG - Intergenic
981728062 4:147868715-147868737 CTTTTCCACCTCAGGTCATCAGG + Intronic
981959822 4:150523227-150523249 AATTTCCCCCAAAATTCATGTGG + Intronic
982958372 4:161801799-161801821 CATTTCAATCACAACTCATCAGG - Intronic
983823786 4:172231113-172231135 CATTTTCACGACCATTCATGGGG - Intronic
986340512 5:6785129-6785151 CTTTACCACCACAAGTCAGATGG - Intergenic
986585634 5:9314174-9314196 GTTTTCTACCACAAATCATGGGG - Intronic
986850986 5:11813478-11813500 CATTTCCATAACAAGTGTTGGGG - Intronic
988077308 5:26368533-26368555 AATTTTCCCCACATGTCATGGGG + Intergenic
989349739 5:40472945-40472967 CCTTTACACCACAAGAAATGCGG - Intergenic
991205295 5:64042642-64042664 CATTGCCACCGCAGGCCATGAGG - Intergenic
991577282 5:68118200-68118222 AATTTCCACCCTAAGTCAAGAGG - Intergenic
992164473 5:74035742-74035764 CGTTTCCACCAAAGGTCAAGGGG + Intergenic
992180914 5:74197571-74197593 CCTTTCCAAAACATGTCATGAGG + Intergenic
1001517764 5:172367788-172367810 CATTTCAACCAGTAGTAATGAGG - Intronic
1003916276 6:10789428-10789450 CATATCCCCCACACGTAATGGGG - Intronic
1007507160 6:42344589-42344611 CTTTTCTACCACAAGGCATCTGG + Intronic
1009815291 6:68725496-68725518 CATTTCCACCACAAATCAAAAGG + Intronic
1012838971 6:104305491-104305513 CCTTTCCACTACAAGTAATAAGG + Intergenic
1012938689 6:105394992-105395014 CATTTCCAACAGAAGTCATTAGG + Intronic
1013026755 6:106282462-106282484 CCTTTCCTCCAAAAGTCCTGTGG + Intronic
1015770781 6:136766062-136766084 CAGCTGCACCACAGGTCATGAGG + Intronic
1016602476 6:145878094-145878116 CTTTTCATCTACAAGTCATGTGG + Intronic
1017736240 6:157367634-157367656 AATTTCCATCCCATGTCATGAGG + Intergenic
1018179162 6:161205505-161205527 CATTTACAGCACATCTCATGGGG + Intronic
1018600163 6:165529545-165529567 CATTTCTGCCACTGGTCATGTGG - Intronic
1022499772 7:30875327-30875349 CAATTCTCCCACAAGTCCTGTGG - Intronic
1022612321 7:31889112-31889134 CAAATTCACCACAAGTCATTTGG + Intronic
1023310390 7:38880512-38880534 CATTTCCATCACCAGTGATTGGG - Intronic
1024684967 7:51734828-51734850 CCTTCCCATCACAAGCCATGAGG - Intergenic
1025058020 7:55780767-55780789 CAATTCCTCAACAAGTCATAGGG + Intergenic
1025760632 7:64387147-64387169 CATTTCCCCTAAAAATCATGTGG - Intergenic
1025828425 7:65029706-65029728 CAATTCCTCAACAAGTCATAGGG - Intergenic
1025915948 7:65866137-65866159 CAATTCCTCAACAAGTCATACGG - Intergenic
1027781430 7:82525229-82525251 CATTTCCACTAAAAGTAATCAGG + Intergenic
1029674959 7:102062225-102062247 CTGTTACACCACAAGTCACGTGG + Intronic
1031237131 7:119190278-119190300 CATTTCTACAACTGGTCATGTGG - Intergenic
1033591657 7:142813405-142813427 CATTTCCTCCCCAGCTCATGGGG - Intergenic
1037737200 8:21577398-21577420 CATTGCCACCACAAGAACTGGGG + Intergenic
1038618291 8:29115960-29115982 CATTCTCACCACAAGTGATGAGG + Intronic
1044176080 8:89124442-89124464 CATTACCACCATAGGTCATTTGG - Intergenic
1045891588 8:107164357-107164379 CAGTTCCACCTCAGGTCATCAGG - Intergenic
1048013901 8:130480837-130480859 CATCTCCACCACAAGCCTTAAGG - Intergenic
1049296208 8:141840991-141841013 CCTTTCCACTTCCAGTCATGAGG - Intergenic
1051385270 9:16501285-16501307 CATTTTCACCAAAAATCTTGAGG + Intronic
1051774158 9:20616147-20616169 CATTTCAACCTCAACTTATGAGG + Intronic
1052910921 9:33880855-33880877 CTGTTCCACCTCAAGTCATCAGG - Intronic
1056389101 9:86124059-86124081 CATGACCACCACAGGGCATGAGG - Intergenic
1059530550 9:115031544-115031566 CATCTTCACCACAAGTAAGGAGG - Exonic
1060053695 9:120394833-120394855 CACTTCCACCAGAGGTCACGAGG - Intronic
1060890886 9:127187480-127187502 AGTTTCCACCTCAAGTCTTGTGG + Intronic
1062253790 9:135611450-135611472 CTTTTCCACCAGAAGGGATGGGG + Intergenic
1186219184 X:7331403-7331425 CTTTTCCACCAAGAGCCATGAGG + Intronic
1186522869 X:10221270-10221292 CATTTTTCCCACAAGTCCTGTGG - Intronic
1188046200 X:25428377-25428399 CACTGCCACCACAGGCCATGGGG + Intergenic
1188626493 X:32291627-32291649 CAATGACACCACAAATCATGTGG - Intronic
1192043496 X:67647414-67647436 CTTTCCCACCTCAACTCATGTGG + Intronic
1193280302 X:79641204-79641226 CACTACCACCACAGGCCATGGGG + Intergenic
1193287739 X:79732424-79732446 CATTACCACCACACACCATGAGG - Intergenic
1193417116 X:81238362-81238384 CACTGCCACCACAGGCCATGGGG - Intronic
1193599598 X:83493941-83493963 CAGTTCCACCTCAAATCATCGGG - Intergenic
1194358472 X:92918118-92918140 CATCTCCACCTCAGGCCATGTGG + Intergenic
1194857817 X:98956197-98956219 CACTGCCACCACAGGCCATGAGG + Intergenic
1196579135 X:117359053-117359075 CACTGCCACCACAGGCCATGAGG + Intergenic
1197172051 X:123445155-123445177 TATTTCCACCACAAATTATTTGG + Intronic
1197350801 X:125380961-125380983 CTTTTCCACAACAAGTGAGGAGG + Intergenic
1200666652 Y:6033809-6033831 CATCTCCACCTCAGGCCATGTGG + Intergenic
1201588171 Y:15584686-15584708 CTTTTCCACCAAGAGCCATGTGG + Intergenic